CN112176105A

CN112176105A - Special primer for virus BVDV, BRV and BCV one-tube multiplex fluorescence PCR detection and application thereof

Info

Publication number: CN112176105A
Application number: CN202011079561.7A
Authority: CN
Inventors: 常丽云; 刘志勇; 秦建华; 李颖; 赵月兰
Original assignee: Tangshan Animal Disease Prevention And Control Center (tangshan Animal Husbandry And Veterinary Research Institute); Heibei Agricultural University
Current assignee: Tangshan Animal Disease Prevention And Control Center (tangshan Animal Husbandry And Veterinary Research Institute); Heibei Agricultural University
Priority date: 2020-10-10
Filing date: 2020-10-10
Publication date: 2021-01-05
Anticipated expiration: 2040-10-10
Also published as: CN112176105B

Abstract

The invention discloses a special primer for virus BVDV, BRV and BCV one-tube multiplex fluorescence PCR detection and application thereof, belonging to the technical field of molecular biology detection. The invention designs the optimal multiple fluorescence PCR reaction condition aiming at the special primer, and the minimum detection limits of the primer and the reaction condition on plasmid standard products of BVDV, BRV and BCV are respectively 1.19 multiplied by 10²Copy/. mu.L, 3.89X 10¹Copy/. mu.L, 3.74X 10¹The lowest sensitivity is 100 times higher than that of the conventional PCR and the sensitivity is high; the method only specifically amplifies BVDV, BRV and BCV, has no cross reaction with Escherichia coli, salmonella and infectious bovine rhinotracheitis virus, and has strong specificity; coefficient of variation within the group is less than1 percent and the variation coefficient among groups is less than 1 percent, and has good repeatability.

Description

Special primer for virus BVDV, BRV and BCV one-tube multiplex fluorescence PCR detection and application thereof

Technical Field

The invention belongs to the technical field of molecular biological detection, and particularly relates to a special primer for one-tube multiple fluorescence PCR detection of viruses BVDV, BRV and BCV and application thereof.

Background

In recent years, along with the scale expansion of the dairy cow breeding industry, the incidence rate of calf diarrhea is on a trend of rising year by year, the calf diarrhea seriously affects the growth and development of calves in early stage and the stability of production performance in later stage, the death rate is up to 90%, and the amplification of herds and the benign development of the dairy cow breeding industry are seriously affected. The factors causing calf diarrhea are intricate, wherein the diarrhea caused by infectious viruses is the most serious and is mostly mixed infection, and Bovine Viral Diarrhea Virus (BVDV), Bovine Rotavirus (BRV) and Bovine Coronavirus (BCV) are the most common pathogens. In the clinical diagnosis process, the three pathogenies have relatively similar clinical symptoms and are often mixed to infect, thereby causing great difficulty in the accurate diagnosis of the pathogeny, having rapid propagation, great harm and no specific drug treatment, and causing great economic loss to the dairy cow industry.

At present, BVDV, BRV and BCV diagnosis methods mainly comprise pathogen cell separation, electron microscopy, single PCR, multiple PCR, ELISA, gene chip, loop-mediated isothermal amplification and other methods, but the detection methods have obvious limitations. The real-time fluorescence quantitative PCR has the advantages of simple operation, higher sensitivity, good repeatability, short time consumption and the like, and is widely applied to detection in a laboratory. The real-time fluorescent quantitative PCR has two fluorescent dye methods and a TaqMan probe method, the most common fluorescent dye method can be used for carrying out multiple gene detection, the requirement of detecting various nucleic acid sequences by the same reaction tube can be met, the time consumption is shorter, and meanwhile, the fluorescent quantitative PCR overcomes the defects of the conventional PCR in the aspects of sensitivity, efficiency, pathogen content measurement and the like. Therefore, it is urgently needed to establish a multiplex fluorescence quantitative PCR method capable of simultaneously detecting the three pathogens, which provides certain help for disease prevention and control.

Disclosure of Invention

In order to solve the technical problems, the invention provides a special primer for one-tube multiple fluorescence PCR detection of viruses BVDV, BRV and BCV.

The invention designs the following specific primers by respectively referring to highly conserved sequences of BVDV E2 gene, BRVVP6 gene and BCVN gene in GenBank:

BVDV upstream primer SEQ ID NO. 1: 5'-GGTCATAGCTCTCGACACCA-3', respectively;

BVDV downstream primer SEQ ID NO. 2: 5'-GAGCACGTATCTACCACCCA-3', respectively;

BRV upstream primer SEQ ID NO. 3: 5'-AGACAAAGAACGGGTTTCACA-3', respectively;

BRV downstream primer SEQ ID NO. 4: 5'-AGTCAAATCCAGCGACCTGA-3', respectively;

BCV upstream primer SEQ ID NO. 5: 5'-GCGTCCTCTGGAAATCGTTC-3', respectively;

BCV downstream primer SEQ ID NO. 6: 5'-AGCAGTTTGCTTGGGTTGAG-3' are provided.

The reaction system for performing one-tube multiplex fluorescence PCR by using the primers is 25 μ L: PerfectStartTM Green SuperMix 12.5. mu.L, BVDV, BRV, BCV upstream and downstream primers 0.5. mu.L respectively, test sample 1.0. mu.L, deionized water 3.5. mu.L.

Further, the reaction procedure of the one-tube multiplex fluorescence PCR is 95 ℃ for 5min, 95 ℃ for 20s, 55 ℃ for 20s, and 72 ℃ for 20s, and the total number of the reaction procedures is 45 cycles.

Furthermore, sterile water is set as a negative control when performing one-tube multiplex fluorescence PCR.

The invention also provides application of the special primer in preparation of products for detecting viruses BVDV, BRV and BCV.

Compared with the prior art, the invention has the following beneficial effects:

the invention provides a special primer and corresponding optimal reaction conditions, and the minimum detection limits of the special primer on plasmid standard products of BVDV, BRV and BCV are respectively 1.19 multiplied by 10²Copy/. mu.L, 3.89X 10¹Copy/. mu.L, 3.74X 10¹Copy/. mu.L, sensitivity 100 times higher than conventional PCR at least, sensitivityThe performance is high; the method only specifically amplifies BVDV, BRV and BCV, has no cross reaction with E.coli, Salmonella and IBRV, and has strong specificity; the coefficient of variation among groups is less than 1 percent, and the repeatability is good. The multiplex fluorescence quantitative PCR detection method established by the invention provides a rapid, sensitive and specific technical means for the clinical detection and epidemiological investigation of BVDV, BRV and BCV.

Drawings

FIG. 1 is a diagram of the electrophoresis of the PCR gel in example 2.

FIG. 2a is a standard curve diagram of the BVDV recombinant plasmid in example 3.

FIG. 2b is a standard curve of the BRV recombinant plasmid in example 3.

FIG. 2c is a standard graph of the BCV recombinant plasmid of example 3.

FIG. 3a is a melting curve diagram of the recombinant plasmid of BVDV in example 4.

FIG. 3b is a melting curve diagram of the BRV recombinant plasmid in example 4.

FIG. 3c is a melting profile of the BCV recombinant plasmid in example 4.

FIG. 4a is a graph showing the result of fluorescent quantitative PCR amplification of the BVDV standard in example 5.

FIG. 4b is a graph of the results of fluorescent quantitative PCR amplification of the BRV standard in example 5.

FIG. 4c is a graph of the results of fluorescent quantitative PCR amplification of the BCV standard in example 5.

FIG. 5 is a graph showing the results of ordinary PCR assay of different dilutions of the BVDV, BRV and BCV standards in example 5.

FIG. 6 is a graph showing the results of fluorescent quantitative PCR amplification in example 6.

FIG. 7 is a dissolution chart of the results of the clinical sample BVDV + BRV + BCV mixed infection assay of example 8.

FIG. 8 is a dissolution chart of the results of the clinical sample BVDV + BCV mixed infection assay in example 8.

Detailed Description

The main reagents used in the following examples are as follows: DL1000 DNA Marker and DL2000 DNA Marker are purchased from Dalibao bioengineering GmbH; viral geneThe gene-directed RNA extraction kit (magnetic bead method) was purchased from Jiangsu Shuicheng Biotechnology Co., Ltd; agarose was purchased from Biowest; super

Nucleic acid gel dyes (S2001) were purchased from US

lnc corporation; 2 × EsTaqMasterMix, PerfectStart^TMThe Green qPCR Supermix kit is purchased from Beijing Quanyujin Biotechnology Co., Ltd; pUC57 was purchased from Bao bioengineering (Dalian) Co., Ltd; SDH5 α competent cells were purchased from beijing hologold biotechnology limited; plasmid mini-extraction kit was purchased from BIOMIGA, USA; the SanPrep column type DNA gel recovery kit is purchased from Biotechnology engineering (Shanghai) GmbH.

Example 1

3 pairs of specific primers are respectively designed by using DNA Star and Primer5.0 software according to BVDV (MK170077), BRV (MNo47454) and BCV (MK903505) reference strain sequences published in GenBank, and are used for amplifying BVDV E2 gene, BRVVP6 gene and BCV N gene. The primers were synthesized by Changchun Kumei bioengineering GmbH, and the sequences of the primers are shown in Table 1.

TABLE 1 PCR primer sequences

Example 2

The preparation of BVDV, BRV and BCV recombinant plasmid standard comprises the following steps:

(1) and (3) treating a clinical sample: collecting 150 parts of fresh diarrhea and excrement samples from 10 cattle farms in Shijiazhuang Xinle and Xinji areas, respectively adding the 150 parts of fresh excrement samples into a sterilized centrifugal tube containing 5ml of PBS (phosphate buffer solution) with pH7.2, repeatedly oscillating for 1min, centrifuging for 10min at 5000r/min, and taking supernatant; extracting viral nucleic acid by using a full-automatic nucleic acid extractor according to the instruction of a viral genome RNA extraction kit (magnetic bead method), carrying out reverse transcription on the extracted nucleic acid product by using a reverse transcription kit to obtain cDNA, and storing at-20 ℃ for later use.

(2) The cDNAs of BVDV, BRV and BCV were amplified by PCR using the specific primers designed in example 1, respectively, and sterile deionized water was used as a negative control.

Reaction system: 2 × EsTaqMasterMix reaction solution 10 μ L, ddH₂O6. mu.L, 1. mu.L of each of the upper and lower primers, and 2. mu.L of the DNA template, 20. mu.L in total. Reaction procedure: 5min at 94 ℃; 30s at 94 ℃; 30s at 55 ℃; 30s at 72 ℃; a total of 35 cycles; 7min at 72 ℃.

(3) And (2) purifying and recovering an amplified PCR product, respectively connecting the three recovered fragments to a pUC57 vector, transforming DH5 alpha competent cells, coating a plate, screening positive clone plasmids, culturing, extracting recombinant plasmids, carrying out PCR, enzyme digestion and sequencing identification, carrying out agarose gel electrophoresis on the recombinant plasmids after PCR, and carrying out the result as shown in figure 1 (wherein M: DL1000 Marker, 1: negative control, 2: BVDV recombinant plasmids, 3: BRV recombinant plasmids and 4: BCV recombinant plasmids), wherein the sizes of the amplified target fragments are respectively 280bp, 151bp and 111bp, and are consistent with the expected result. The concentrations of BVDV, BRV and BCV recombinant plasmids are respectively 0.05 ng/mu L, 1.67 ng/mu L and 1.60 ng/mu L by using the NanoDrop 2000 to determine the correctly identified positive recombinant plasmids, and the copy numbers of the recombinant plasmids are respectively 1.19 multiplied by 10 through conversion of a formula¹⁰Copy/. mu.L, 3.89X 10¹⁰Copy/. mu.L, 3.74X 10¹⁰Copies/. mu.L, were used as plasmid standards, respectively.

The copy number is calculated as follows: copy number plasmid concentration × 6.02 × 10²³/(660X total length of plasmid).

Single fluorescent quantitative PCR reaction: the prepared plasmid standard substances are respectively subjected to 10-fold gradient dilution and then subjected to PCR amplification. Three replicates of each gradient were performed and the amplification results were analyzed to establish respective standard curves. And simultaneously analyzing the melting curve of the primer to eliminate the interference of primer dimer and nonspecific amplification. The reaction system is 15 μ L: PerfectStartTM Green SuperMix 7.5. mu.L, upstream and downstream primers 0.5. mu.L, template 1.0. mu.L, and deionized water 4.5. mu.L. Reaction conditions are as follows: 5min at 95 ℃; 20s at 95 ℃; at 56 ℃ for 20 s; 20s at 72 ℃; a total of 45 cycles; meanwhile, sterile water is set as a negative control.

Optimizing the reaction conditions of the multiple fluorescent quantitative PCR: and optimizing the reaction temperature and the reaction system of the multiple fluorescent quantitative PCR and determining the reaction conditions. Performing multiple fluorescent quantitative PCR amplification in the same reaction system by using a standard substance diluted in a gradient manner as a template, respectively optimizing annealing temperature (52 ℃, 53 ℃, 54 ℃, 55 ℃, 56 ℃, 57 ℃ and 58 ℃), primer concentration (final concentration is (0.2 muL, 0.3 muL, 0.4 muL, 0.5 muL, 0.6 muL, 0.7 muL and 0.8 muL), judging results when Ct value is less than or equal to 45 cycles to determine the optimal reaction condition of the fluorescent quantitative PCR, wherein the optimal reaction system is 25 muL of PerfectStartTM Green SuperMix 12.5 muL, BVDV, BRV, BCV upstream and downstream primers are 0.5 muL respectively, BVDV, BRV and BCV templates are 1.0 muL respectively, deionized water is 3.5 muL, reaction program is 95 ℃ for 5min, 95 ℃ for 20s, 55 ℃ for 20s, 72 ℃ for 20s, and 45 cycles in total, and sterile water negative control is set at the same time.

Example 3

Diluting the three prepared plasmid standard substances according to 10-fold gradient, and taking the concentration interval as 10⁷-10⁰After copying/mu L, respectively carrying out fluorescent quantitative PCR amplification, wherein the BVDV recombinant plasmid standard substance is at the concentration of 10⁷-10²Between copies/. mu.L, at a concentration of 10 for BRV, BCV recombinant plasmid standards⁷-10¹Fluorescence signals can be detected between copies/. mu.L, and a standard curve of fluorescence quantitative PCR can be obtained by analyzing with automatic system analysis software, wherein the logarithm of the copy number is used as a vertical coordinate, the Ct value is used as a horizontal coordinate, and the results are shown in FIGS. 2a-2c, wherein FIG. 2a is the standard curve of BVDV recombinant plasmid, FIG. 2b is the standard curve of BRV recombinant plasmid, and FIG. 2c is the standard curve of BCV recombinant plasmid. As can be seen from FIGS. 2a-2c, BVDV is 10⁷-10²The copy/. mu.L range of BRV and BCV is 10⁷-10¹The amplification efficiency of the standard substance constructed in the range of copy/. mu.L is more than 90 percent, and the correlation coefficient R²The values are all above 0.99, which indicates that the initial template number and the Ct value of various standards show good linear relation.

The linear equation for the copy number (x) and Ct value (y) obtained is: BVDV, y ═ 3.911x +40.21, R²＝0.995；

BRV，y＝-3.657x+37.64，R²＝0.992；BCV，y＝-3.647x+37.73，R²＝0.997。

Example 4

The melting curves of the respective dilutions of the BVDV, BRV, BCV standards had one and only one peak, with the melting temperature of BVDV E2 gene being about 85 ℃, as shown in fig. 3a, the melting temperature of BRVVP6 gene being about 83 ℃, as shown in fig. 3b, and the melting temperature of BCVN gene being about 84 ℃, as shown in fig. 3 c.

Example 5

The BVDV, BRV and BCV standard is diluted by 10 times of gradient, and fluorescence quantitative PCR amplification is carried out according to the established reaction conditions, the results are shown in figures 4a-4c, wherein figure 4a is a diagram of the fluorescence quantitative PCR amplification results of the BVDV standard (1-6: 10 in the figure)⁷-10²Copy/. mu.L; 7-8: 10¹-10⁰Copy/. mu.L), FIG. 4b is a graph of the results of fluorescent quantitative PCR amplification of BRV standards (1-7 in the figure: 10⁷-10¹Copy/. mu.L; 8: 10⁰Copy/. mu.L), FIG. 4c is a graph of the results of fluorescent quantitative PCR amplification of BCV standards (1-7 in the figure: 10⁷-10¹Copy/. mu.L; 8: 10⁰Copy/. mu.L). As can be seen from FIGS. 4a-4c, the lowest detection limit of BVDV is 10²Copy/. mu.L, minimum detection limits of BRV and BCV of 10¹Copies/. mu.L.

BVDV, BRV, BCV standards were diluted 10-fold gradiently and tested by the general PCR method, the results are shown in fig. 5, where M: DL2000 Marker, 1-8: 10⁷-10⁰At a copy/. mu.L, the minimum detection limit of BVDV was found to be 10⁴Copy/. mu.L, minimum detection limits of BRV and BCV of 10³Copy/. mu.L; compared with the common multiplex PCR, the sensitivity of the established multiplex fluorescent quantitative PCR method is greatly improved.

Example 6

Using BVDV, BRV, BCV standards as positive controls, genomic DNA of e.coli, Salmonella, IBRV and water as templates, and performing fluorescent quantitative PCR amplification according to the established reaction conditions, the results are shown in fig. 6, wherein 1-3: BVDV, BRV and BCV recombinant plasmids; 4-7: coli, Salmonella, IBRV genomic DNA and water. As can be seen from FIG. 6, the amplification curves of the 3 types of standards were detected, but no amplification curve was observed for any of the other pathogens and the negative control, indicating that the method has good specificity.

Example 7

BVDV, BRV and BCV recombinant plasmids are respectively diluted by 10 times and mixed in equal proportion, and 3 concentration gradients (final concentration is 10 respectively)⁶Copy/. mu.L, 10⁵Copy/. mu.L, 10⁴Copies/. mu.L) of plasmid mixture, while setting sterile water negative control. Repeatedly detecting for 3 times by using the established fluorescent quantitative PCR method, and performing an intra-group repeatability test; the test results are counted and the repeatability of the method is evaluated, wherein the results are shown in table 2.

TABLE 2 repeatability results of multiplex fluorescent quantitative PCR

As can be seen from Table 2, the intra-group coefficient of variation is less than 1%, and the inter-group coefficient of variation is less than 1%, indicating that the multiple fluorescence quantitative detection method established by the test has good repeatability.

Example 8

The results of testing 150 clinical stool samples collected using the established method are shown in Table 3, wherein the clinical sample BVDV + BRV + BCV mixed infection test results are shown in FIG. 7, and the clinical sample BVDV + BCV mixed infection test results are shown in FIG. 8.

As shown in Table 3, the mixed infection positive rate of the three viruses detected by multiplex quantitative PCR was 12.0% (18/150), and the mixed infection positive rate of the three viruses detected by ordinary PCR was 10.0% (15/150). The coincidence rate of the detection of the two methods is 83.3 percent. The detection method established by the test is more sensitive and can be applied to clinical detection.

TABLE 3 test results for clinical diarrhea samples

Comparative example 1

The following 3 pairs of primers SEQ ID NO.7-12 were used in place of the primers SEQ ID NO.1-6 used in example 8, and the results are shown in Table 4.

BVDV upstream primer SEQ ID NO. 7: CTTGGTGCGAAGATGGGAAG, respectively;

BVDV downstream primer SEQ ID NO. 8: ATCACATGGGCAGAGTCCAA are provided.

BRV upstream primer SEQ ID NO. 9: TCAGGTCGCTGGATTTGACT, respectively;

BRV downstream primer SEQ ID NO. 10: GTACCATGTAGTCGCTCCGT are provided.

BCV upstream primer SEQ ID NO. 11: GATCTACTTCACGCGCATCC, respectively;

BCV downstream primer SEQ ID NO. 12: GTGGCTTAGTGGCATCCTTG are provided.

TABLE 4 multiplex fluorescent quantitation PCR clinical sample detection results

Pathogens	Number of positive samples	The positive rate%
			BVDV+BRV+BCV	12	8
BVDV+BRV	6	4
			BRV+BCV	35	23.3
BVDV+BCV	6	4
			BVDV	0	0
BRV	5	3.3
			BCV	2	1.3
Total up to	66	43.9

The primers SEQ ID NO.1-6 provided by the invention have higher detection coincidence rate than the primers SEQ ID NO.7-12 in the comparison example 1.

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Sequence listing

<110> university of agriculture in Hebei

Special primer for one-tube multiple fluorescence PCR detection of <120> viruses BVDV, BRV and BCV and application thereof

<130> 2020.9.2

<141> 2020-10-09

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 1

ggtcatagct ctcgacacca 20

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 2

gagcacgtat ctaccaccca 20

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence ()

<400> 3

agacaaagaa cgggtttcac a 21

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 4

agtcaaatcc agcgacctga 20

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 5

gcgtcctctg gaaatcgttc 20

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 6

agcagtttgc ttgggttgag 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 7

cttggtgcga agatgggaag 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 8

atcacatggg cagagtccaa 20

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 9

tcaggtcgct ggatttgact 20

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 10

gtaccatgta gtcgctccgt 20

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 11

gatctacttc acgcgcatcc 20

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 12

gtggcttagt ggcatccttg 20

Claims

1. The special primer for one-tube multiple fluorescence PCR detection of viruses BVDV, BRV and BCV is characterized in that the sequence of the special primer is shown as SEQ ID NO.1-6, wherein:

BVDV upstream primer SEQ ID NO. 1: 5'-GGTCATAGCTCTCGACACCA-3', respectively;

BVDV downstream primer SEQ ID NO. 2: 5'-GAGCACGTATCTACCACCCA-3', respectively;

BRV upstream primer SEQ ID NO. 3: 5'-AGACAAAGAACGGGTTTCACA-3', respectively;

BRV downstream primer SEQ ID NO. 4: 5'-AGTCAAATCCAGCGACCTGA-3', respectively;

BCV upstream primer SEQ ID NO. 5: 5'-GCGTCCTCTGGAAATCGTTC-3', respectively;

BCV downstream primer SEQ ID NO. 6: 5' -AGCAGTTTGCTTGGGTTGAG-3.

2. The special primer as claimed in claim 1, wherein the reaction system for performing one-tube multiplex fluorescence PCR with the special primer is 25 μ L: PerfectStartTM Green SuperMix 12.5. mu.L, BVDV, BRV, BCV upstream and downstream primers 0.5. mu.L respectively, test sample 1.0. mu.L, deionized water 3.5. mu.L.

3. The special primer as claimed in claim 2, wherein the reaction program of the one-tube multiplex PCR is 95 ℃ for 5min, 95 ℃ for 20s, 55 ℃ for 20s, 72 ℃ for 20s, and 45 cycles.

4. The primer set as claimed in claim 3, wherein the PCR is performed in a tube of multiplex PCR with a negative control of sterile water.

5. Use of the special primers according to any one of claims 1 to 4 for the preparation of products for detecting viruses BVDV, BRV and BCV.