CN112175970A

CN112175970A - Gene Rf5 for restoring C-type cytoplasmic fertility of corn and application thereof

Info

Publication number: CN112175970A
Application number: CN202011155575.2A
Authority: CN
Inventors: 汤继华; 薛亚东; 林亚楠; 丁冬; 刘宗华
Original assignee: Henan Agricultural University
Current assignee: Henan Agricultural University
Priority date: 2020-10-26
Filing date: 2020-10-26
Publication date: 2021-01-05

Abstract

The invention discloses a gene Rf5 for restoring C-type cytoplasmic fertility of corn and application thereof, wherein the gene Rf5 is an isolated polynucleotide comprising a nucleotide sequence selected from the following group of nucleotide sequences: SEQ ID NOs: any one of the nucleotide sequences shown, a nucleotide sequence that hybridizes to the complement of the nucleotide sequence under moderately stringent conditions, preferably high stringent hybridization conditions; a nucleotide sequence which encodes a protein of the same amino acid sequence as the nucleotide sequence but which differs in sequence due to the degeneracy of the genetic code; consists of SEQ ID NOs: 4. 5 other nucleotide sequences different from SEQ ID NOs 4, 5 by selective cleavage, selection of different transcription start sites or transcription termination sites; the invention determines the nucleotide and amino acid sequence of the maize C-type cytoplasmic sterile nuclear restorer gene Rf 5. The sequence of the invention can facilitate the creation of three-line matching materials of corn hybrid, shorten the breeding period, reduce the breeding cost and improve the seed production efficiency.

Description

Gene Rf5 for restoring C-type cytoplasmic fertility of corn and application thereof

Technical Field

The invention relates to the technical field of genes, in particular to a gene Rf5 for restoring C-type cytoplasmic fertility of corn and application thereof.

Background

Corn plays an immeasurable role in the development of the world's economy as an important food and feed crop. Corn is also the earliest crop utilizing heterosis, and plays a vital role in solving the food safety problem in China. In the process of seed production, tassels need to be removed manually or mechanically and the like, so that seed mixing is avoided, the production cost of hybrid seeds is increased to a certain extent, and the international competitiveness of seed enterprises in China is restricted. The results of random sampling detection of hybrid seeds produced by each main corn production base in China in 1994 and 1995 by the seed variety quality monitoring center of Ministry of agriculture in China for two consecutive years show that all the hybrid seed samples screened in 1994 can not reach the national seed quality standard, and the number of the samples reaching the national standard in 1995 is only 1.2%. The main reason that the seeds are unqualified is that the female parent emasculation quality is poor, and a considerable amount of inbred lines are mixed in the hybrid seeds, so that the exertion of the heterosis yield-increasing potential is directly influenced. Under the current production condition, the production technology of the three-line matched seeds by using cytoplasmic male sterility still has great utilization potential.

The male sterility has the hereditary characteristics of pollen abortion and normal female gamete, and can be divided into two types of cytoplasmic male sterility and nuclear male sterility according to the hereditary characteristics. The meiosis period of the abortion of the nucleus male sterility has the characteristics of thorough abortion, stable sterility and the like, the endosperm color gene or yellow-green seedling gene linked with the nuclear sterility gene is required to be used for early identification in the seed production by using the sterile line, and larger application risks exist due to the linked tightness degree and the deviation of artificial identification. In order to utilize the nuclear sterile gene, pioneer in the United states constructs a vector containing gamete lethal, color display and other genes through ingenious design, and introduces the vector into a female parent through genetic transformation to form an SPT (seed Production technology) inbred line. The SPT inbred line is inbred to generate two filial generations of a non-transgenic sterile line and an SPT fertile line in a ratio of 1:1, and the propagation problem of the sterile line is solved and the diffusion of transgenic pollen is effectively avoided through fluorescent screening. Subsequently, the rice develops a corresponding SPT technology, and the technology has wide application prospect in future crossbreeding. In corn, universal element and the like have designs to invent a multi-control sterile system for seed production. However, expensive large-scale sorting equipment remains a significant investment for many small and medium-sized seed businesses.

Corn is a crop which firstly utilizes cytoplasmic male sterile line to produce hybrid seeds, and male sterile cytoplasm from different sources is divided into T, C, S groups according to the restoration specificity of nuclear genes to the cytoplasmic gene sterility. The restoration of CMS-T fertility needs the combined action of two dominant genes of Rfl and Rf2, the two pairs of genes show dominant complementary action, namely, the restoration of sterility needs the combined action of the two dominant genes, one is not available, the fertility can be restored when the two pairs of dominant genes are in a homozygous or heterozygous state, and the restoration of the fertility is shown as male sterility when any one pair of genes is in a recessive homozygous state. The researchers located Rf1 at the short arm end of chromosome 3 and Rf2 at the region of chromosome 9 near the Wx locus. The male sterility type of the S group is the group with the largest number among the 3 male sterility types, the fertility restorer gene is dominant gene Rf3 and is positioned on the long arm of chromosome 2, and besides Rf3, researchers also find restorer genes influencing CMS-S fertility on chromosomes 1, 3, 6 and 8. At least 3 pairs of restorer genes were studied in relation to restoration of sterility in group C, Rf4, Rf5, Rf6, respectively, and it was demonstrated that restoration of fertility of C, RB, ES, Bb type cytoplasm in group C is controlled by dominant monogene Rf4 and that Rf4 was first localized on chromosome 8. Fertility restoration of the C-type sterile line is controlled by two pairs of genes Rf4 and Rf5 with overlapping effect, and fertility can be restored only by one gene in the two pairs of genes being dominant. Wherein the restorer gene Rf5 also has a dominant suppressor gene Rf-I, which is designated on chromosome 7. In the aspect of the application of the corn sterile seed production technology, on the basis of deeply analyzing the C-type cytoplasmic male sterility and recovery mechanism of corn, Henan university of agriculture establishes a complete corn sterile seed production technical system, completes the three-line matching technology of excellent corn hybrid seeds such as Yunong 704, Yuyu 22, Aoyu 3301, Shudan 20 and the like in sequence, and obtains large-area utilization in the production of the hybrid seeds.

The transformation of the traditional sterile line and the restorer line is mainly identified according to the field phenotype of the corn plant in the pollen scattering period, and can be completed only by 6-8 generations of transformation, and the timeliness of selection is limited to a certain extent. With the development of modern molecular biology, the cloning of related genes provides a powerful tool for crop breeding, can effectively make up for the defects of low accuracy and poor timeliness of the traditional selection technology, and accelerates the breeding process. The Henan university of agriculture has carried out a great deal of research on the genetic mechanism of the corn C-type cytoplasmic male sterility from the last 70 th century, clones the corn C-type cytoplasmic male sterility restoring gene Rf4, and has certain influence on the distribution of the restoring line due to relatively less naturally-existing restoring materials. The C-type cytoplasm has an overlapped restorer gene Rf5, so that more restorer line materials can be screened compared with a single restorer gene and interaction effect restorer materials, and the screening of restorer lines in different regions is facilitated. The clone of the restorer gene Rf5 provides a basic support for the application of the sterile seed production technology.

Corn is the first large grain crop in China, the annual sowing area is about 5 hundred million mu, the annual seed demand is about 10 hundred million kilograms, and the annual seed production area is maintained at about 250 thousand mu. Because the local population is few and the labor shortage in the castration season becomes a limiting factor for further development of corn seed production, the cloned restoring gene is utilized to quickly realize the breeding of the corn restoring line, the seed production by the corn three-line method is positively promoted, and the corn hybrid seed production provides powerful technical support and guarantee.

Disclosure of Invention

The invention aims to provide a gene Rf5 for restoring the C-type cytoplasmic fertility of corn and application thereof, and determines the nucleotide and amino acid sequence of a C-type cytoplasmic sterile nuclear restoring gene Rf5 of the corn. The sequence of the invention can facilitate the creation of three-line matching materials of corn hybrid, shorten the breeding period, reduce the breeding cost, improve the seed production efficiency and solve the problems provided by the background technology.

In order to achieve the purpose, the invention provides the following technical scheme:

a gene that restores C-type cytoplasmic fertility in maize that is an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of:

(1) SEQ ID NOs: 1-5;

(2) a nucleotide sequence that hybridizes under moderately stringent conditions, preferably high stringent hybridization conditions, to the complement of the nucleotide sequence of (1);

(3) a nucleotide sequence having at least 80%, preferably at least 90%, more preferably at least 95% or 98% or 99% identity to the nucleotide sequence of (1);

(4) a nucleotide sequence which encodes a protein of the same amino acid sequence as the nucleotide sequence of (1) but differs in sequence due to the degeneracy of the genetic code;

(5) a nucleotide sequence encoding one of the following amino acid sequences: SEQ ID NOs: 9-11, or a sequence identical to the amino acid sequence set forth in any one of SEQ ID NOs: 9-11, or an amino acid sequence that differs from the amino acid sequence set forth in any one of SEQ ID NOs: 9-11, preferably at least 80%, more preferably at least 90%, especially at least 95% or 98% identity;

(6) an active fragment of the nucleotide sequence of any one of (1) to (5); or a nucleotide sequence complementary to any one of the nucleotide sequences (1) to (5);

(7) consists of SEQ ID NOs: 4. 5 other nucleotide sequences different from SEQ ID NOs 4, 5 by selective cleavage, selection of different transcription start or termination sites.

Further, the promoter sequence of Rf5, which comprises a nucleotide sequence selected from the group consisting of:

A. SEQ ID NOs: 6-8;

B. a nucleotide sequence that hybridizes under moderately stringent conditions, preferably high stringent hybridization conditions, to the complement of the nucleotide sequence of a;

C. a nucleotide sequence having at least 80%, preferably at least 90%, more preferably at least 95% or 98% or 99% identity to the nucleotide sequence of a;

D. an active fragment of the nucleotide sequence of any one of A-C; or a nucleotide sequence complementary to the nucleotide sequence of any one of A-D;

E. consists of SEQ ID NOs: 4. 5 different transcription initiation results in the expression of SEQ ID NOs: 6-8, respectively.

Further, a construct comprising said promoter sequence, and a cell comprising said construct, wherein said cell is a plant cell, preferably a maize cell.

Further, isolated polypeptides encoded by said Rf5 gene comprising an amino acid sequence selected from the group consisting of:

a. SEQ ID NOs: 9-11;

b. substitution, deletion and/or insertion due to one or more (e.g., 1-25, 1-20, 1-15, 1-5, 1-3) amino acid disabilities with SEQ ID NOs: 9-11, or a pharmaceutically acceptable salt thereof;

c. and SEQ ID NOs: 9-11, preferably at least 80%, more preferably at least 90%, especially at least 95% or 98% identity;

d. an active fragment of the amino acid sequence of a or b or c;

e. an amino acid sequence encoded by a polynucleotide molecule.

Further, a recombinant construct comprising the polynucleotide sequence of the gene Rf5 for restoring C-type cytoplasmic fertility to maize, wherein the vector used for the construct is a cloning vector or an expression vector for expressing the polynucleotide, is also included.

Further, a recombinant host cell comprising said recombinant construct or having integrated in its genome the polynucleotide sequence of said gene Rf5 for restoring C-type cytoplasmic fertility in maize is also included, which may be selected from a plant cell or a microbial cell, preferably a plant cell, most preferably a maize cell, which may be isolated, ex vivo, cultured or part of a plant.

Further, the restoring action of the polynucleotide or polypeptide or recombinant construct or recombinant host cell in the C-type cytoplasmic sterile material.

A gene Rf5 for restoring corn C-type cytoplasmic fertility and its application, regenerating transgenic plants from recombinant plant cells containing the gene Rf5 for restoring corn C-type cytoplasmic fertility and allelic variation thereof, or crossing plants containing the gene Rf5 for restoring corn C-type cytoplasmic fertility and allelic variation thereof with another plant, or transfecting crop plants with a recombinant Agrobacterium cell containing Rf5 to obtain transgenic crop plants, the characters include generating or knocking out the restoring performance of the crops to C-type cytoplasmic sterility, wherein the plants are preferably plants with shapes not affected by negative direction except restoring function, and the crop plants are preferably crops.

Further, transfecting a crop plant with a recombinant agrobacterium cell comprising Rf5 to obtain a transgenic crop plant, or adjusting the expression level of Rf5 gene in the crop plant in a suitable amount, or changing the biological activity of Rf5 protein in a suitable amount, or crossing a plant recovering the gene with another plant; wherein the plant is preferably a plant which is not negatively affected in shape except for restored function, wherein the crop plant is preferably a crop plant.

Compared with the prior art, the invention has the beneficial effects that:

the present invention identifies a fertility restorer gene Rf5 for maize type C cytoplasm, which is located at the end of the long arm of chromosome 2. Besides the difference of coding regions, the gene promoter region has difference due to different transcription starts, and the sequence of the invention can facilitate the creation of three-line matching materials of corn hybrid, shorten the breeding period, reduce the breeding cost and improve the seed production efficiency.

Drawings

FIG. 1 is a diagram showing the fine localization of restorer gene Rf5 of the present invention;

FIG. 2 is a schematic diagram of the p3300U-Rf5 vector of the present invention;

FIG. 3 shows the test cross result of the p3300U-Rf5 vector transformed positive plant and sterile line;

FIG. 4 is a schematic diagram of the pBLUE411-Rf5 vector of the present invention;

FIG. 5 shows the result of testing editing sites of the test cross sterile plants transformed by CRISPR/Cas 9;

FIG. 6 is a diagram of the effect of the CRISPR/Cas9 vector transformation on the test cross sterile phenotype.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

(1) SEQ ID NOs: 1-5;

(5) a nucleotide sequence encoding one of the following amino acid sequences: SEQ ID NOs: 9-11, or, alternatively, a sequence identical to the amino acid sequence set forth in any one of SEQ ID NOs: 9-11, or an amino acid sequence that differs from the amino acid sequence set forth in any one of SEQ ID NOs: 9-11, preferably at least 80%, more preferably at least 90%, especially at least 95% or 98% identity;

Wherein, one cDNA sequence of Rf5 and Rf5 is shown in SEQ ID NOs: 1-3, the nucleotide sequence of the related promoter is shown as SEQ ID NOs: 6-8, and the amino acid sequence of the encoded protein is shown as SEQ ID NOs: 9-11. See table 1 below for details.

Table 1. SEQ ID NOs: 1-11 and their sources

SEQ ID NO：	Name (R)	Source
			1	Rf5cDNA sequence	6233
2	rf5cDNA sequence	Mo17
			3	rf5cDNA sequence	C01
4	Rf5 gDNA sequence	6233
			5	rf5 gDNA sequence	Mo17
6	Rf5 promoter sequence	6233
			7	rf5 promoter sequence	Mo17
8	rf5 promoter sequence	C01
			9	Rf5 protein	6233
10	rf5 protein	Mo17
			11	rf5 protein	C01

The gene Rf5 capable of recovering the C-type cytoplasmic fertility of the corn is shown as SEQ ID NOs: 1 is shown.

The present invention also relates to a promoter sequence of Rf5, comprising a nucleotide sequence selected from the group consisting of:

A. SEQ ID NOs: 6-8;

D. an active fragment of the nucleotide sequence of any one of A-C; or

E. A nucleotide sequence complementary to the nucleotide sequence of any one of A-D;

F. consists of SEQ ID NOs: 4. 5 different transcription initiation results in the expression of SEQ ID NOs: 6-8, respectively.

The invention also relates to a construct comprising the promoter sequence, and a cell comprising the construct, wherein the cell is a plant cell, preferably a maize cell.

The present invention relates to isolated polypeptides (also referred to as proteins) encoded by the Rf5 gene, having a PPR conserved domain comprising an amino acid sequence selected from the group consisting of:

a. SEQ ID NOs: 9-11;

d. an active fragment of the amino acid sequence of a or b or c;

e. an amino acid sequence encoded by a polynucleotide molecule of the invention.

Wherein the amino acid sequence of the RF5 protein sequence and the variant protein thereof consists of SEQ ID NOs: 9-11, see table 1 for details.

The invention also relates to a recombinant construct containing the polynucleotide sequence of the gene Rf5 for restoring the C-type cytoplasmic fertility of corn. Wherein the vector used for the construct is a cloning vector or an expression vector for expressing the polynucleotide.

The present invention also relates to a recombinant host cell comprising the recombinant construct of the present invention, or having integrated in its genome the polynucleotide sequence of the gene Rf5 of the present invention that restores maize C-type cytoplasmic fertility. The host cell may be selected from plant cells or microbial cells, such as e.coli cells or agrobacterium cells, preferably plant cells, most preferably corn cells. The cell may be isolated, ex vivo, cultured or part of a plant.

The present invention relates to the restoration of a polynucleotide (i.e., gene Rf5 restoring maize C-type cytoplasmic fertility) or a polypeptide of the invention or a recombinant construct of the invention or a recombinant host cell of the invention in C-type cytoplasmic sterile material.

The present invention also relates to a method of improving a trait (e.g., generating or knocking out the restorer of a crop plant for type C cytoplasmic sterility) comprising preparing a crop plant comprising a polynucleotide sequence of the gene Rf5 of the invention or a construct of the invention that can restore type C cytoplasmic fertility in maize, for example, the method can comprise: regenerating a transgenic plant from a recombinant plant cell containing the gene Rf5 capable of restoring the corn C-type cytoplasmic fertility and the allelic variation thereof, or crossing a plant containing the gene Rf5 capable of restoring the corn C-type cytoplasmic fertility and the allelic variation thereof with another plant, or transfecting a crop plant with a recombinant Agrobacterium cell containing Rf5 to obtain a transgenic crop plant. The trait includes the production or knockout of a plant for restoration of type C cytoplasmic sterility. Wherein the plant is preferably a plant which is not negatively affected in shape except for restored function, wherein the crop plant is preferably a crop plant, such as maize.

The present invention relates to a method of improving crops. The method comprises the following steps: transfecting a crop plant with a recombinant agrobacterium cell containing Rf5 to obtain a transgenic crop plant, or adjusting the expression level of Rf5 gene in the crop plant in a proper amount, or changing the biological activity of Rf5 protein in a proper amount, or crossing the plant of the restoring gene of the invention with another plant; wherein the plant is preferably a plant which is not negatively affected in shape except for restored function, wherein the crop plant is preferably a crop plant, such as maize.

The method for breeding a maize inbred line having restored maize type C cytoplasmic fertility can be carried out by: crossing a maize plant comprising the Rf5 gene and allelic variation thereof with another maize plant and continuously backcrossing to obtain a maize inbred line plant comprising the Rf5 gene; or transfecting a maize plant with a recombinant host cell (e.g., an agrobacterium cell) comprising the Rf5 gene to obtain a transgenic maize plant comprising the Rf5 gene.

The present inventors have determined, through intensive studies, a fertility restorer gene Rf5 of maize C-type cytoplasm, which is located at the end of the long arm of chromosome 2. In addition to differences in coding regions, the promoter regions of the genes differ from transcription initiation to transcription initiation, and thus the expression levels of the genes may have other functions not yet known in growth and development, in addition to affecting fertility restoration. Embodiments of the invention are based on their ability to restore maize type C cytoplasm.

Plant transformation

In a particularly preferred embodiment, at least one protein of the invention that restores maize type C cytoplasmic fertility is expressed in a higher organism, such as a plant. The nucleotide sequence of the restorer gene Rf5 of the present invention may be inserted into an expression cassette, which is then preferably stably integrated into the plant genome. In another preferred embodiment, the nucleotide sequence of the restorer gene Rf5 is comprised in a non-pathogenic self-replicating virus. Plants transformed according to the present invention may be monocotyledonous or dicotyledonous plants including, but not limited to, maize, wheat, barley, rye, sweet potato, beans, peas, chicory, lettuce, cabbage, cauliflower, onion, garlic, squash, apple, pear, strawberry, pineapple, tomato, sorghum, sunflower, rapeseed rape, carrot, rice, eggplant, cucumber, arabidopsis. Particularly preferred are corn, rice, wheat, barley.

Once the desired nucleotide sequence has been transformed into a particular plant species, it may be propagated in that species or transferred into other varieties of the same species, including particularly commercial varieties, using conventional breeding techniques.

The nucleotide sequences according to the invention are expressed in transgenic plants, which result in the biosynthesis of the corresponding functionally restored protein in the transgenic plants. In this way, transgenic plants with restored function can be produced. In order to express the nucleotide sequence of the present invention in transgenic plants, the nucleotide sequence of the present invention may need to be modified and optimized. All organisms have a particular codon usage preference, which is known in the art, and the codons can be changed to conform to plant preferences while maintaining the amino acids encoded by the nucleotide sequences of the present invention. Moreover, high levels of expression in plants can best be achieved from coding sequences having at least about 35%, preferably more than about 45%, more preferably more than 50%, and most preferably more than about 60% GC content.

It should be noted that, unless otherwise specified, the reagents, enzymes and the like used in the following examples are those commercially available from reagent companies as analytical grade reagents or enzymes.

Example 1: acquisition of maize C-type cytoplasmic restorer gene Rf5 sequence

The restorer gene Rf5 from Fengcao 1 is subjected to 5-generation continuous backcross and then selfed, and finally the Rf5 gene is introduced into the background of an inbred line Mo17 to obtain the restorer, which is named 6233 and is marked as Cms-6233. And (3) constructing a BC1 segregation population of the Rf5 by using the sterile line Cms-CMo17 (Rf 4Rf4Rf5Rf 5) and the restorer line Cms-C6233 (Rf 4Rf4Rf5Rf 5) as experimental materials. Based on the primary positioning of the restorer gene Rf5 by 1500 isolates, the size of the isolates is enlarged to 32,000, molecular markers such as SSR, Indel and the like are developed by means of genome information of B73, the restorer gene Rf5 is finely positioned (figure 1), the restorer gene Rf5 is positioned between the molecular markers chr2.09-36 and chr2.09-6+1, and the physical distance is 82,284 bp. Bioinformatics analysis of DNA sequences within the candidate gene region predicted 6 possible candidate genes in total within the target region, 2 of which were PPR structural genes, 1 transcription factor-encoding gene, 2 signaling-related genes, and 1 unknown functional gene (table 2). Re-analysis after the B73 reference genome update to version 4 and release of the Mo17 genomic sequence revealed that the localization interval had only one PPR gene, and the first of the two original PPR genes (gene No. 3 in table 2). The PPR gene was identified as a candidate Rf5 gene.

TABLE 2 prediction List of candidate genes for localization interval

Gene_ID	ENZYME_ID	KO_ID	Gene On tology	P-value
					1	EC:3.1.3.16	K14497	Putative protein phosphatase 2C	7.10E-55
2	0	K09338	Homeobox-leucine zipper protein HAT22	2.00E-07
					3	0	K03457	Pentatricopeptide repeat-containing protein	6.70E-30
4			no
					5	0	K03457	Pentatricopeptide repeat-containing protein	2.30E-38
6	0	0	Protein kinase	3.70E-07

FIG. 1. detection results in primer BC1F1 population crossover individuals, the rightmost two samples are R and R parental banding patterns, respectively.

TABLE 3 primer PCR reaction System

TABLE 4 PCR reaction procedure

Labeling the primer sequence:

chr2.09-36F 5' TATTTGTTCTGGTTGTACGTTGG 3'

chr2.09-36R 5' GTTTAGTCGGAATAGTCCACCAG 3'

chr2.09-6+1F 5' TAGACCTTACGACCTGTGTTTGAC 3'

chr2.09-6+1R 5' TATGGGCGTTGCGACTTG 3'。

example 2: rf5 corn transgenic experiment and transgenic material fertility analysis

In this example, the restorer Cms-6233Rf5Rf5 tetrad anther was used as a material, and the full-length cDNA of Rf5 gene was obtained by reverse transcription and amplification.

(1) Construction and transformation of Rf5 overexpression transgenic vector

Primers related to the cDNA sequence of Rf5 Gene:

p3300U-BamH1-F: 5’-cgcggatccATGCCGTCATGTGCCCGCAT-3’

p3300U-Sacl-R:5’-cgagctcTCACGGACTGGCCTCTGCAA-3’

the full-length cDNA of Rf5 gene is used as a template to amplify a full-length Rf5 sequence, and a PCR product is subjected to double enzyme digestion by BamHI and SacI to recover a target fragment and is connected to a p3300U vector recovered by double enzyme digestion by the same two enzymes to construct an overexpression vector p3300U-Rf5 (figure 2). The vector is introduced into a maize transformation receptor inbred line C01 by an agrobacterium-mediated transformation method. The transgenic positive plants are subjected to test crossing with a Cms-Mo17rf5rf5 sterile line, and the result shows that the transgenic positive plants containing the construct can restore the fertility of the maize C-type cytoplasm sterile line (figure 3).

(2) Construction and transformation of Rf5 editing vectors

The functional domain PPR motif of Rf5 gene is predicted from the amino acid sequence corresponding to CDS sequence of Rf5 gene. Therefore, aiming at the nucleotide sequence corresponding to the PPR motif, the following target sequences are involved according to the requirements of constructing the CRISPR vector:

PPR1:5‘-TACCATACACTACATCGTCTGG-3’

PPR2:5‘-GCGTACCCGTTGAGCATAATGG-3’

synthesizing corresponding oligonucleotide primer sequence according to the target sequence and carrying out PCR amplification on the oligonucleotide primer sequence and the criprpr vector, purifying and recovering the amplification product, and establishing a BsaI-T4Ligase enzyme digestion link system as shown in the following table 5.

TABLE 5 restriction enzyme ligation system

5ul of the ligation product was transformed into E.coli and screened on Kan plates. Positive clones were identified by colony PCR and confirmed by sequencing (fig. 4). The vector is introduced into a maize transformation receptor inbred line C01 by an agrobacterium-mediated transformation method. The transgenic positive plants are subjected to test crossing with Cms-6233Rf5Rf5 restorer line, positive sterile single plants are screened for PCR sequencing detection, and the result proves that the PPR region of the target gene Rf5 is edited (figure 5) to cause the Rf5 restoring function to be lost (figure 6).

The above examples show that the nucleotide sequence of the invention is the true sequence of Rf5 gene, and has the function of restoring fertility of C-type cytoplasmic sterility of maize.

The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art should be able to cover the technical solutions and the inventive concepts of the present invention within the technical scope of the present invention.

Claims

1. A gene for restoring C-type cytoplasmic fertility to maize which is an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of:

(1) SEQ ID NOs: 1-5;

2. The gene for restoring C-type cytoplasmic fertility to maize of claim 1, wherein said promoter sequence of Rf5 comprises a nucleotide sequence selected from the group consisting of:

A. SEQ ID NOs: 6-8;

D. an active fragment of the nucleotide sequence of any one of A-C; or

3. The gene for restoring C-type cytoplasmic fertility to maize of claim 1, wherein the construct comprising said promoter sequence, and the cell comprising said construct, wherein said cell is a plant cell, preferably a maize cell.

4. The gene for restoring C-type cytoplasmic fertility to maize of claim 1, further comprising an isolated polypeptide encoded by said Rf5 gene comprising an amino acid sequence selected from the group consisting of amino acid sequences set forth in seq id no:

a. SEQ ID NOs: 9-11;

d. an active fragment of the amino acid sequence of a or b or c;

5. The gene for restoring C-type cytoplasmic fertility to maize of claim 1, further comprising a recombinant construct comprising a polynucleotide sequence of said gene Rf5 for restoring C-type cytoplasmic fertility to maize, wherein the vector used for said construct is a cloning vector or an expression vector for expressing said polynucleotide.

6. The gene for restoring maize C-type cytoplasmic fertility according to claim 1, further comprising a recombinant host cell comprising said recombinant construct or having integrated in its genome the polynucleotide sequence of the gene Rf5 of the invention for restoring maize C-type cytoplasmic fertility, said host cell being selected from a plant cell or a microbial cell, such as an e.

7. The gene for restoring maize C-type cytoplasmic fertility of claim 1, wherein the polynucleotide or polypeptide or the recombinant construct of the invention or the recombinant host cell of the invention restores the effect in the C-type cytoplasmic sterile material.

8. The gene Rf5 for restoring maize C-cytoplasmic fertility according to claim 1, wherein a transgenic plant is regenerated from a recombinant plant cell containing the gene Rf5 for restoring maize C-cytoplasmic fertility and allelic variations thereof according to the invention or a plant containing the gene Rf5 for restoring maize C-cytoplasmic fertility and allelic variations thereof is crossed with another plant, or a transgenic crop plant is obtained by transfecting a crop plant with a recombinant Agrobacterium cell comprising Rf5, wherein the trait comprises causing or knocking out the restoring ability of the crop plant to C-cytoplasmic sterility, wherein the plant is preferably a plant whose shape is not negatively affected except for the restoring function, and wherein the crop plant is preferably a crop plant.

9. The gene Rf5 for restoring C-type cytoplasmic fertility to corn of claim 8, wherein the recombinant Agrobacterium cells containing Rf5 are used to transfect a crop plant to obtain a transgenic crop plant, or to modulate the expression level of Rf5 gene in a crop plant in an appropriate amount, or to alter the biological activity of RF5 protein in an appropriate amount, or to cross a plant of the restorer gene of the present invention with another plant; wherein the plant is preferably a plant which is not negatively affected in shape except for restored function, wherein the crop plant is preferably a crop plant.