CN112159822A - PS transposase and CRISPR/dCpf1 fusion protein expression vector and mediated site-directed integration method thereof - Google Patents

Abstract

The invention belongs to the technical field of gene editing, and particularly relates to a fusion protein expression vector of PS transposase and CRISPR/dCpf1 and a mediated site-specific integration method thereof.

Description

PS transposase and CRISPR/dCpf1 fusion protein expression vector and mediated site-directed integration method thereof

Technical Field

The invention belongs to the technical field of gene editing, and particularly relates to a fusion protein expression vector of PS transposase and CRISPR/dCpf1 and a mediated site-specific integration method thereof.

Background

The background art refers to the documents that are most closely related (e.g., usage, function, structure, etc.) to the present invention. In describing the background art, the contents (such as objects, constitutions, effects) thereof are specifically introduced, problems and disadvantages thereof are pointed out, and the reasons therefor are explained where possible.

The CRISPR/Cas9 system has attracted wide attention as a gene editing tool, and is mainly based on the modification of an acquired immune system, namely a tandem regulatory spacer repeat (CRISPR), of bacteria, and a report of the Cong et al scholars on the international top-grade journal SCIENCE in 2013. The CRISPR/Cas9 system consists of three components, a Cas9 protein, tracrRNA and crRNA. The Cas9 protein has endonuclease activity and can be combined with tracrRNA and a crRNA compound, the protein contains two unique active sites, namely RuvC positioned at the amino terminal and HNH in the middle of the protein, and the two sites play important roles in the maturation of the crRNA and the shearing process of double-stranded DNA.

To date, the CRISPR/Cas9 technology has been successfully applied to the editing of endogenous genes of bacteria, yeast, arabidopsis thaliana, corn, rice and wheat, nematodes, drosophila, zebrafish, mouse, rat, pig, cow, sheep, human and various species cell lines (including iPS cells), including the knockout of large gene fragments, the knock-in of genes, the precise modification of genes, and the CRISPR/Cas9 gene editing transgenic animals of large livestock such as pig, cow, sheep, and the like have been successfully obtained.

The Cpf1 protein is a new member discovered in CRISPR system research, compared with the CRISPR/Cas9 system, the CRISPR/Cpf1 has similar functions to the CRISPR/Cas 3526 system, but is possibly simpler and more accurate, can overcome some limitations in the application of the original CRISPR/Cas9 system, and has better application prospect in genome editing. The CRISPR/Cpf1 system differs from the CRISPR/Cas9 system mainly by (1) the native CRISPR/Cpf1 system is simpler in composition, contains only one 42nt crRNA, and in addition the Cpf1 protein is smaller than the Cas9 protein, making it easier to design and deliver into cells; (2) the CRISPR/Cpf1 system cleaves target DNA in a different manner. The blunt end | left after the CRISPR/Cas9 system cleaves the target DNA double strand is susceptible to mutation at repair, so strictly speaking, the CRISPR/Cas9 system performs disruption rather than editing on the target gene, and the CRISPR/Cpf1 system leaves the cohesive end | after cleaving the target DNA, which may contribute to precise integration of the foreign DNA fragment, thereby achieving true genome editing; (3) similar to the CRISPR/Cas9 system, recognition of the target DNA by the CRISPR/Cpf1 system is also dependent on the presence of the PAM sequence, although the Cas9 system recognizes the NGG PAM sequence at the 3 'end of the pre-spacer, while the Cpf1 system recognizes the TTN PAM sequence at the 5' end of the pre-spacer; (4) the CRISPR/Cpf1 system cleaves at a distance from the recognition site, providing researchers with more editing sites. Meanwhile, the off-target rate of the CRISPR/Cpf1 system is proved to be far lower than that of the CRISPR/Cas9 system by research. Gene-editing transgenic animals and plants (rice, mice, zebrafish) have also been obtained using CRISPR/Cpf1 technology.

The CRISPR technology has higher efficiency of site-directed mutagenesis on small gene fragments and has obvious advantages compared with other technologies, but the CRISPR technology needs to rely on an endogenous homologous recombination system for site-directed integration on large gene fragments, the efficiency is lower, in addition, the off-target effect is another main defect of the CRISPR technology, and off-target sites are easy to appear in a huge genome of an organism, so that unexpected mutagenesis is introduced.

The Transposon (Transposon) is a DNA sequence that can move or jump freely in the host genome, and the process of Transposon movement or jumping is called Transposition (Transposition). The transposon was first discovered in the 40 th 20 th century by the American scientist Barbara McClintock at the time of genetic studies in maize and was named the-Ac/Ds II element. Then, the bacteria, fungi and insects are found in various organisms. Transposons can be divided into two main groups according to different transposition mechanisms: class I transposons transpose via RNA, called RNA transposons; class II transposons transpose through DNA and are called DNA transposons. DNA transposons can in turn be divided into three major subclasses: shear-and-paste "mechanism DNA transposons, rolling circle replication mechanism DNA transposons (Helitrons), and self replication mechanism DNA transposons (Polintons shear-and-paste type transposon family are widely distributed and are classified into Tc1/Mariner, hAT, PiggyBac (PB) and other superfamilies according to transposase similarity and structural features of inverted terminal repeats.

The high-efficiency transposition characteristic of the transposon enables the transposon to show great application potential in the fields of transgenosis, gene therapy, gene function research and the like. One of the important applications of transposon technology is the efficient mediation of transgenesis in somatic and germ cells. Transposon mediated transgenic technology is widely applied to gene transfer of various cells. In addition, the transposon mediated transgenic technology greatly improves the preparation efficiency of transgenic animals based on microinjection technology, and the transgenic efficiency of model animals (mice, zebrafish, frogs and the like) mediated by transposons is usually over 30 percent, thereby greatly promoting the research progress of the model animals. At present, the application of transposon mediated transgene technology in large mammals (such as cattle, pigs, sheep, etc.) and birds is also becoming more and more extensive. In recent years, a plurality of standard preparation technical processes of transposon-mediated transgenic animals such as transgenic pigs, rabbits, rats and the like are continuously reported in the international authority technical journal Nature Protocol, which indicates that the technology is mature day by day and is an important platform for future transgenic research.

The transposon mediated transgene technology has the advantages of high integration rate, large bearing capacity, capability of simultaneously carrying a plurality of genes, single-copy integration of transgenes, stable expression of the transgenes, easy determination of integration sites and the like. The main deficiency of transposon mediated transgenic technology is that the integration site of transposition is random and may insert into the functional gene of host to affect the gene expression.

By integrating with different gene editing systems, the site-specific function of other artificial nucleases (such as CRISPR, ZNF, TALEN and the like) is utilized, and the high-efficiency transposition integration characteristic of a transposon system is fully utilized to perform the fusion of transposase and other nuclease molecules, so that the construction of a novel, high-efficiency and safe composite gene editing technology is an important research direction in the future.

Disclosure of Invention

The invention fuses Cpf1 protein in a CRISPR/Cpf1 system and PS transposase together to construct a high-efficiency gRNA-mediated fixed-point transposition of the PS transposase system. The invention aims to provide a method for high-efficiency site-directed transposition mediated by a fusion system of PS transposase and CRISPR/Cpf1, which can overcome the problems of low HDR efficiency in a CRISPR system and random integration of a transposon system and provides a high-efficiency site-directed gene transfer method.

The purpose of the invention is realized by the following technical scheme:

the invention provides a plasmid fusion transposase vector, and the nucleic acid sequence of the vector is shown as SEQ ID NO. 1.

The invention also provides an expression vector of the fusion protein of the PS transposase and the CRISPR/dCpf1, wherein the fusion expression vector contains a double-stranded circular plasmid of dCpf1-PS fusion transposase, and the plasmid sequence of the pCAG-dCpf1-PS comprises a CAG promoter, a Kozak sequence, 2 SV40 NLS sequences, a dCpf1 sequence, a linker sequence and a PS transposase sequence.

The sequence of the CAG promoter is the base of 5 th to 1654 th sites from the 5' end in SEQ ID NO. 1;

the Kozak sequence is 1773 to 1782 th bases from the 5' end in SEQ ID NO 1;

the 2 SV40 NSL sequences are respectively upstream and downstream of a dCpf1 sequence;

the SV40 NSL sequence is 2400-2420 th base and 6114-6134 th base from the 5' end in SEQ ID NO 1;

the sequence of dCpf1 is base 2427-6107 from 5' end in SEQ ID NO 1;

the linker sequence comprises 15 amino acid residues;

the linker sequence is the 6135-6179 th base from the 5' end in SEQ ID NO 1;

the PS transposase sequence is 6180-7451 th base from 5' end in SEQ ID NO 1;

the nucleic acid sequence of the fusion transposase expression vector pCAG-dCpf1-PS is shown in SEQ ID NO. 1.

The invention also provides application of the plasmid fusion transposase vector or the PS transposase and CRISPR/dCpf1 fusion protein expression vector in transposon mediated site-directed integration.

The invention also provides a method for the pCAG-dCpf1-PS to mediate site-directed integration in the genome of an organism; the method comprises the following steps:

(1) designing a gRNA sequence of a target gene;

(2) constructing cpf1 gRNA expression vector;

(3) co-transfecting an expression vector with a target gene gRNA, the pCAG-dCpf1-PS plasmid and a transposon donor plasmid to a host cell, and performing site-specific transposition on a transposon donor sequence to integrate the transposon donor sequence into the target gene;

(4) screening to obtain positive monoclonal cells inserted with a reporter gene by using a resistance screening gene, but not limited to the resistance screening gene;

(5) and (3) counting the number of positive cell clones by giemsa staining, selecting positive monoclonal cells, and carrying out fluorescent quantitative detection on the expression condition of the target gene.

Further, primer sequences used for designing a gRNA sequence targeting a target gene are as follows:

HPRT1-gRNA-F:GTAGATTGTCCCCTGTTGACTGGTCATTC；

HPRT1-gRNA-R:AATTGAATGACCAGTCAACAGGGGACA。

furthermore, a pSQT14 vector is used as a gRNA expression vector as a framework, and the pSQT14 vector contains the following sequences: AATTTCTACTAAGTGTAGAT are provided.

Further, the sequence of the pSQT14 vector is shown as SEQ ID NO. 2.

Furthermore, the sequence of the expression vector with the target gene gRNA is shown in SEQ ID NO. 3.

Compared with the prior art, the technology has the following advantages and effects:

the invention can mediate the fixed point integration of the transposon to the target gene, and the method has simple, high-efficiency and quick process and greatly reduces the low-efficiency defect of gene editing.

The invention prepares a fusion expression system of transposase and cutting defect Cas enzyme (dCpf1) by DNA recombination technology, the fusion protein expressed by the system is specifically combined with a target site under the guide of crRNA with the complex formed by transposon mediated gene fragment and crRNA, and the target site is integrated at fixed point, thereby realizing the high-efficiency fixed-point integration of gene large fragment, and simultaneously, the technology avoids the generation of off-target effect because the gene cutting function of CRISPR system is removed.

The invention fully utilizes the high-efficiency guide function of the CRISPR/Cas system and the high-efficiency integration function of the transposon system, obviously improves the specificity of gene editing and obviously reduces the off-target efficiency of the gene editing. The invention can be used as a tool for high-efficiency gene editing, can be used for preparing transgenic animal and plant products by various species, and provides a novel high-efficiency technology for the development of transgenic industry. The system can play a great application potential in the fields of transgenosis, gene therapy, gene function research and the like.

Drawings

FIG. 1: frame pSQT1601 was cut back into the electropherogram;

FIG. 2: pLB-dCpf1 plasmid restriction electrophoresis picture;

FIG. 3: pLB-PSase plasmid restriction electrophoretogram;

FIG. 4: pCAG-dCpf1-PS plasmid electrophoretogram;

FIG. 5: electrophoresis picture of pCAG-dCpf1-PS plasmid digestion product;

FIG. 6: pCAG-dCpf1-PS plasmid map;

FIG. 7: plasmid pSQT14 electrophoretogram;

FIG. 8: plasmid map of pSQT 14;

FIG. 9: the pSQT14 frame was excised back into the electropherogram;

FIG. 10: pSQT14-HPRT1-gRNA plasmid electrophoretogram;

FIG. 11: pSQT14-HPRT1-gRNA plasmid map;

FIG. 12: the activity of pCAG-dCpf1-PS on HepG2 cells is identified;

FIG. 13: pCAG-dCpf1-PS positive monoclonal cell fluorescence quantitative identification map.

Detailed Description

The present invention will be described in more detail with reference to the following examples and accompanying drawings, but the present invention is not limited thereto.

The structure diagram of the pCAG-dCpf1-PS plasmid vector described in the examples of the present invention is shown in FIG. 3.

Example one

pCAG-dCpf1-PS fusion transposase complete system vector construction.

Construction of pCAG-dCpf1-PS plasmid fusion transposase vector

(1) Linker sequence (ggatccggtggatccggtggatccggtggatccggaacctcc) was ligated to PS 5' by PCR, and dCpf1 and PSase fragments were cloned into PLB vector to construct pLB-dCpf1 and pLB-PSase vectors.

(2) ACC65I, NotI restriction endonuclease, pSQT1601 vector 2h, were double-cut at 37 ℃, and pSQT 4781bp fragment (see FIG. 1) was recovered by cutting; ACC65I, BsmBI 37 ℃ 1h, 55 ℃ 1h cutting double enzyme PLB-dCpf1, gel cutting recovery dCpf 13732 bp fragment (figure 2), BsmBI, NotI 37 ℃ 1h, 55 ℃ 1h cutting double enzyme pLB-PSase, gel cutting recovery PSase 1397bp fragment (figure 3).

(3) T7 ligase pSQT, dCpf1 and PSase, wherein the ligation system is shown in the table 1, the ligation is carried out for 1h at 25 ℃, 10 mu l of ligation product is used for transforming competent cells Top10, a single colony is picked to be cultured in a liquid medium LA, the upgraded grains are subjected to electrophoretic identification, the electrophoretogram of the plasmid is shown in a figure 4, the correct clone is named as pCAG-dCpf1-PS, and the enzyme digestion identification is carried out as shown in a figure 5. The plasmid map is shown in FIG. 6.

TABLE 1 connection System

Components	Dosage of
		pSQT	65ng
dCpf1	152ng
		PSase	57ng
2X T7 ligase Buffer	10μl
		T7 enzyme	1μl
ddH2O	Make up to 20. mu.l
		Total volume	20μl

Construction of pSQT14-HPRT1-gRNA expression vector

(1) The online website (https:// www.crisprscan.org /) designed gRNA sequences targeting the HPRT1 gene and primers, synthesized by the company, whose sequences are as follows:

HPRT1-gRNA-F:GTAGATTGTCCCCTGTTGACTGGTCATTC；

HPRT1-gRNA-R:AATTGAATGACCAGTCAACAGGGGACA；

the primers were diluted to 100. mu.M, the upstream and downstream primers were annealed to form a double-stranded oligo and phosphorylated using T4 PNK, and the reaction system is shown in Table 2.

TABLE 2gRNA primer annealing and phosphorylation system

Components	Dosage of
		HPRT1-gRNA-F	2μl
HPRT1-gRNA-R	2μl
		T4 PNK enzyme	1μl
2X T7 ligase buffer (containing ATP)	5μl
		Total volume	10μl

The reaction program was 37 ℃ for 30min, 95 ℃ for 5min, ramp down to 25 ℃. After the reaction was completed, the annealed product was diluted 200-fold.

(2) The pSQT14 vector is used as a gRNA expression vector as a framework, and contains a Cpf1 scaffold sequence (AATTTCTACTAAGTGTAGAT), and the electrophoretogram of the plasmid is shown in figure 7, and the plasmid map is shown in figure 8. The pSQT14 plasmid was digested with BsmBI restriction enzyme, the frame recovered by cutting the gel, and the electrophoretogram is shown in FIG. 9.

(3) Connecting the HPRT1-gRNA annealing product with a pSQT14 glue recovery framework, reacting for 30min at 25 ℃ by using T7 ligase, transforming into TOP10 cells, picking a single clone, and sequencing and identifying by a company. The correct vector was designated pSQT14-HPRT1-gRNA, and its plasmid electrophoretogram was shown in FIG. 10, and plasmid map of pSQT14-HPRT1-gRNA was shown in FIG. 11.

Example two

In this example, HPRT1 was used as the target gene, and the human hepatoma cell line HepG2 was used as a model to successfully mediate transposon site-directed integration into the target gene and interfere with gene expression.

1. HepG2 cells with good growth status were selected and inoculated into 6-well plates containing 3X105 cells per well, and after 24 hours, cell density was observed, and at 70-80% cell density, cell transfection was performed by co-transfecting pCAG-dCpf1-PS and pSQT14-HPRT1-gRNA and transposon donor plasmid PS-DPA-PGK-Neo with FugeneHD.

2. After 24h of transfection, pancreatin is used for digestion and cell collection, the cells are inoculated into a cell culture dish with the concentration of 10-10 cm, after the cells are attached to the wall stably, after 24h of transfer, a culture medium with the final concentration of 800 mu G/ml G418 is used for screening positive cell clones, and the positive cell clones can be obtained after 14 days of screening.

3. Giemsa staining identifies the number of positive cell clones, and monoclonal cells are selected for fluorescent quantitative identification, the results are shown in figures 12 and 13, the fluorescent quantitative results show that dCpf1-PS mediated site-specific integration efficiency is as high as 86.36% (19/22), and target gene expression of 19 positive clones in 22 positive cell clones is efficiently inhibited. .

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> Yangzhou university

<120> expression vector of fusion protein of PS transposase and CRISPR/dCpf1 and mediated site-directed integration method thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 10591

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ggtcgacatt gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat 60

agcccatata tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg 120

cccaacgacc cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata 180

gggactttcc attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta 240

catcaagtgt atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc 300

gcctggcatt atgcccagta catgacctta tgggactttc ctacttggca gtacatctac 360

gtattagtca tcgctattac catggtcgag gtgagcccca cgttctgctt cactctcccc 420

atctcccccc cctccccacc cccaattttg tatttattta ttttttaatt attttgtgca 480

gcgatggggg cggggggggg gggggggcga ggggcggggc ggggcgaggc ggagaggtgc 540

ggcggcagcc aatcagagcg gcgcgctccg aaagtttcct tttatggcga ggcggcggcg 600

gcggcggccc tataaaaagc gaagcgcgcg gcgggcggga gtcgctgcgc gctgccttcg 660

ccccgtgccc cgctccgccg ccgcctcgcg ccgcccgccc cggctctgac tgaccgcgtt 720

actcccacag gtgagcgggc gggacggccc ttctcctccg ggctgtaatt agcgcttggt 780

ttaatgacgg cttgtttctt ttctgtggct gcgtgaaagc cttgaggggc tccgggaggg 840

ccctttgtgc ggggggagcg gctcgggggg tgcgtgcgtg tgtgtgtgcg tggggagcgc 900

cgcgtgcggc tccgcgctgc ccggcggctg tgagcgctgc gggcgcggcg cggggctttg 960

tgcgctccgc agtgtgcgcg aggggagcgc ggccgggggc ggtgccccgc ggtgcggggg 1020

gggctgcgag gggaacaaag gctgcgtgcg gggtgtgtgc gtgggggggt gagcaggggg 1080

tgtgggcgcg tcggtcgggc tgcaaccccc cctgcacccc cctccccgag ttgctgagca 1140

cggcccggct tcgggtgcgg ggctccgtac ggggcgtggc gcggggctcg ccgtgccggg 1200

cggggggtgg cggcaggtgg gggtgccggg cggggcgggg ccgcctcggg ccggggaggg 1260

ctcgggggag gggcgcggcg gcccccggag cgccggcggc tgtcgaggcg cggcgagccg 1320

cagccattgc cttttatggt aatcgtgcga gagggcgcag ggacttcctt tgtcccaaat 1380

ctgtgcggag ccgaaatctg ggaggcgccg ccgcaccccc tctagcgggc gcggggcgaa 1440

gcggtgcggc gccggcagga aggaaatggg cggggagggc cttcgtgcgt cgccgcgccg 1500

ccgtcccctt ctccctctcc agcctcgggg ctgtccgcgg ggggacggct gccttcgggg 1560

gggacggggc agggcggggt tcggcttctg gcgtgtgacc ggcggctcta gagcctctgc 1620

taaccatgtt catgccttct tctttttcct acagctcctg ggcaacgtgc tggttattgt 1680

gctgtctcat cattttggca aagaattctg cagtcgacgg tacctaatac gactcactat 1740

agggcttaag gcgggcccgg gatccaccgg tcgccaccat gggtgatcat tatctggata 1800

ttcggctgag gcctgatcca gagttcccac ctgcgcagct gatgtctgtc ctttttggca 1860

aacttcatca ggccctggtt gcccagggcg gagatcggat aggggtaagc tttccagacc 1920

tcgacgaaag ccggagccgc ctgggagaac gcctgcggat ccacgcttct gccgacgatc 1980

tgagagcctt gctggcaagg ccatggcttg aggggctccg ggatcacctg cagtttggcg 2040

aacccgccgt tgttccccac ccaacccctt atcggcaggt gtctagagtg caggccaaat 2100

ctaatccaga acggctgcga cggcgactca tgcggcgaca tgatcttagc gaggaagagg 2160

cccgaaaaag aatccctgat accgtggccc gcgcccttga cttgcctttt gtcacactgc 2220

ggtcccagag tacggggcag catttcagac ttttcattcg acacgggcca ctgcaagtta 2280

ccgccgaaga aggaggcttt acttgttatg gactctccaa gggaggtttc gtgccctggt 2340

ttgagggcag aggaagtctg ttaacatgcg gtgacgtcga ggagaatcct ggcccaatgc 2400

ctaagaagaa gcggaaggtg agcagcagca agctggagaa gtttacaaac tgctactccc 2460

tgtctaagac cctgaggttc aaggccatcc ctgtgggcaa gacccaggag aacatcgaca 2520

ataagcggct gctggtggag gacgagaaga gagccgagga ttataagggc gtgaagaagc 2580

tgctggatcg ctactatctg tcttttatca acgacgtgct gcacagcatc aagctgaaga 2640

atctgaacaa ttacatcagc ctgttccgga agaaaaccag aaccgagaag gagaataagg 2700

agctggagaa cctggagatc aatctgcgga aggagatcgc caaggccttc aagggcaacg 2760

agggctacaa gtccctgttt aagaaggata tcatcgagac aatcctgcca gagttcctgg 2820

acgataagga cgagatcgcc ctggtgaaca gcttcaatgg ctttaccaca gccttcaccg 2880

gcttctttga taacagagag aatatgtttt ccgaggaggc caagagcaca tccatcgcct 2940

tcaggtgtat caacgagaat ctgacccgct acatctctaa tatggacatc ttcgagaagg 3000

tggacgccat ctttgataag cacgaggtgc aggagatcaa ggagaagatc ctgaacagcg 3060

actatgatgt ggaggatttc tttgagggcg agttctttaa ctttgtgctg acacaggagg 3120

gcatcgacgt gtataacgcc atcatcggcg gcttcgtgac cgagagcggc gagaagatca 3180

agggcctgaa cgagtacatc aacctgtata atcagaaaac caagcagaag ctgcctaagt 3240

ttaagccact gtataagcag gtgctgagcg atcgggagtc tctgagcttc tacggcgagg 3300

gctatacatc cgatgaggag gtgctggagg tgtttagaaa caccctgaac aagaacagcg 3360

agatcttcag ctccatcaag aagctggaga agctgttcaa gaattttgac gagtactcta 3420

gcgccggcat ctttgtgaag aacggccccg ccatcagcac aatctccaag gatatcttcg 3480

gcgagtggaa cgtgatccgg gacaagtgga atgccgagta tgacgatatc cacctgaaga 3540

agaaggccgt ggtgaccgag aagtacgagg acgatcggag aaagtccttc aagaagatcg 3600

gctccttttc tctggagcag ctgcaggagt acgccgacgc cgatctgtct gtggtggaga 3660

agctgaagga gatcatcatc cagaaggtgg atgagatcta caaggtgtat ggctcctctg 3720

agaagctgtt cgacgccgat tttgtgctgg agaagagcct gaagaagaac gacgccgtgg 3780

tggccatcat gaaggacctg ctggattctg tgaagagctt cgagaattac atcaaggcct 3840

tctttggcga gggcaaggag acaaacaggg acgagtcctt ctatggcgat tttgtgctgg 3900

cctacgacat cctgctgaag gtggaccaca tctacgatgc catccgcaat tatgtgaccc 3960

agaagcccta ctctaaggat aagttcaagc tgtattttca gaaccctcag ttcatgggcg 4020

gctgggacaa ggataaggag acagactatc gggccaccat cctgagatac ggctccaagt 4080

actatctggc catcatggat aagaagtacg ccaagtgcct gcagaagatc gacaaggacg 4140

atgtgaacgg caattacgag aagatcaact ataagctgct gcccggccct aataagatgc 4200

tgccaaaggt gttcttttct aagaagtgga tggcctacta taaccccagc gaggacatcc 4260

agaagatcta caagaatggc acattcaaga agggcgatat gtttaacctg aatgactgtc 4320

acaagctgat cgacttcttt aaggatagca tctcccggta tccaaagtgg tccaatgcct 4380

acgatttcaa cttttctgag acagagaagt ataaggacat cgccggcttt tacagagagg 4440

tggaggagca gggctataag gtgagcttcg agtctgccag caagaaggag gtggataagc 4500

tggtggagga gggcaagctg tatatgttcc agatctataa caaggacttt tccgataagt 4560

ctcacggcac acccaatctg cacaccatgt acttcaagct gctgtttgac gagaacaatc 4620

acggacagat caggctgagc ggaggagcag agctgttcat gaggcgcgcc tccctgaaga 4680

aggaggagct ggtggtgcac ccagccaact cccctatcgc caacaagaat ccagataatc 4740

ccaagaaaac cacaaccctg tcctacgacg tgtataagga taagaggttt tctgaggacc 4800

agtacgagct gcacatccca atcgccatca ataagtgccc caagaacatc ttcaagatca 4860

atacagaggt gcgcgtgctg ctgaagcacg acgataaccc ctatgtgatc ggcatcgcga 4920

ggggcgagcg caatctgctg tatatcgtgg tggtggacgg caagggcaac atcgtggagc 4980

agtattccct gaacgagatc atcaacaact tcaacggcat caggatcaag acagattacc 5040

actctctgct ggacaagaag gagaaggaga ggttcgaggc ccgccagaac tggacctcca 5100

tcgagaatat caaggagctg aaggccggct atatctctca ggtggtgcac aagatctgcg 5160

agctggtgga gaagtacgat gccgtgatcg ccctggagga cctgaactct ggctttaaga 5220

atagccgcgt gaaggtggag aagcaggtgt atcagaagtt cgagaagatg ctgatcgata 5280

agctgaacta catggtggac aagaagtcta atccttgtgc aacaggcggc gccctgaagg 5340

gctatcagat caccaataag ttcgagagct ttaagtccat gtctacccag aacggcttca 5400

tcttttacat ccctgcctgg ctgacatcca agatcgatcc atctaccggc tttgtgaacc 5460

tgctgaaaac caagtatacc agcatcgccg attccaagaa gttcatcagc tcctttgaca 5520

ggatcatgta cgtgcccgag gaggatctgt tcgagtttgc cctggactat aagaacttct 5580

ctcgcacaga cgccgattac atcaagaagt ggaagctgta ctcctacggc aaccggatca 5640

gaatcttccg gaatcctaag aagaacaacg tgttcgactg ggaggaggtg tgcctgacca 5700

gcgcctataa ggagctgttc aacaagtacg gcatcaatta tcagcagggc gatatcagag 5760

ccctgctgtg cgagcagtcc gacaaggcct tctactctag ctttatggcc ctgatgagcc 5820

tgatgctgca gatgcggaac agcatcacag gccgcaccga cgtggatttt ctgatcagcc 5880

ctgtgaagaa ctccgacggc atcttctacg atagccggaa ctatgaggcc caggagaatg 5940

ccatcctgcc aaagaacgcc gacgccaatg gcgcctataa catcgccaga aaggtgctgt 6000

gggccatcgg ccagttcaag aaggccgagg acgagaagct ggataaggtg aagatcgcca 6060

tctctaacaa ggagtggctg gagtacgccc agaccagcgt gaagcacgga tcccccaaga 6120

agaagaggaa agtcggtgga tccggtggat ccggtggatc cggtggatcc ggaacctccg 6180

ctcctaccaa aagacacgcg tacaacgctg agtttaaact caaggcgata agccacgcac 6240

aagaacacgg caatagagca gcagcgagag aatttaatat caatgaatca atggtgagga 6300

agtggaggaa gtatgaggat gagctccgcc aagtaaagaa gacaacacag agtttccgcg 6360

ggaacaaagc gagatggcca cagttagagg acaaagttga acagtgggtt gctgaacaaa 6420

gagcagcaag cagaagtgtt agtacagtca caattcgtat gaaggcaata gcgctagctc 6480

gcgaacataa catcagtgaa ttcagaggcg gtccttcttg gtgcttccgt tttatgaaac 6540

gacgtcatct ctccatccgt acgcgcacta ctgtgtcaca acaactacca gctgattatc 6600

aggaaaagtt ggccactttc cgcacatact gcagaaacaa gataactgaa aaaaagatcc 6660

agccagagca tatcatcaat atggacgagg ttccactcac cttcgatatc cctgtaaacc 6720

gcactgtgga taaaacagga gcacgtacgg tgaatattcg caccacaggg aatgagaaaa 6780

cgtccttcac tgtagttctc gcctgccagg ctaatggcca caaacttcca cccatggtta 6840

ttttcaagag gaagaccttg ccgaaagaaa actttccagc tggcattgtc ataaaagcta 6900

actcgaaggg atggatggat gaagaaaaga tgagtgagtg gttgagagaa atttatgtga 6960

agagaccggg tggttttttt cacacagctc cgtccctatt gatctatgac tccatgcgcg 7020

cacatatcac cgagcatgtc aaaaaacaag tgaagcacac taattcagtg ctcgccgtca 7080

ttccgggtgg attaacaaaa gaactccagc cgctcgatgt tggcgtcaac agagcattca 7140

aagctcgact gcgaactgcg tgggagcagt ggatgaccga aggcgaacac acgttcacca 7200

agacggggag acagcgccgg acgacatatg ctaatatctg caagtggata gtaaatgcct 7260

gggctggtat atcagtcaca actgtggtcc gagcttttag gaaggcagga attgtcaccg 7320

aactgccaga caacagcagc gacactgact cggttaatga tgactttgat aagacggagc 7380

caggcgtttt ggatgccgca atagcccagc tgttcaattc ggacacggaa gaagaagttt 7440

tcgagggatt ttcgagcgac tacaaagacc atgacggtga ttataaagat catgacatcg 7500

attacaagga tgacgatgac aagtgaagcg gccgcactcc tcaggtgcag gctgcctatc 7560

agaaggtggt ggctggtgtg gccaatgccc tggctcacaa ataccactga gatctttttc 7620

cctctgccaa aaattatggg gacatcatga agccccttga gcatctgact tctggctaat 7680

aaaggaaatt tattttcatt gcaatagtgt gttggaattt tttgtgtctc tcactcggaa 7740

ggacatatgg gagggcaaat catttaaaac atcagaatga gtatttggtt tagagtttgg 7800

caacatatgc ccatatgctg gctgccatga acaaaggttg gctataaaga ggtcatcagt 7860

atatgaaaca gccccctgct gtccattcct tattccatag aaaagccttg acttgaggtt 7920

agattttttt tatattttgt tttgtgttat ttttttcttt aacatcccta aaattttcct 7980

tacatgtttt actagccaga tttttcctcc tctcctgact actcccagtc atagctgtcc 8040

ctcttctctt atggagatcc ctcgacctgc agcccaagct tggcgtaatc atggtcatag 8100

ctgtttcctg tgtgaaattg ttatccgctc acaattccac acaacatacg agccggaagc 8160

ataaagtgta aagcctgggg tgcctaatga gtgagctaac tcacattaat tgcgttgcgc 8220

tcactgcccg ctttccagtc gggaaacctg tcgtgccagc ggatccgcat ctcaattagt 8280

cagcaaccat agtcccgccc ctaactccgc ccatcccgcc cctaactccg cccagttccg 8340

cccattctcc gccccatggc tgactaattt tttttattta tgcagaggcc gaggccgcct 8400

cggcctctga gctattccag aagtagtgag gaggcttttt tggaggccta ggcttttgca 8460

aaaagctaac ttgtttattg cagcttataa tggttacaaa taaagcaata gcatcacaaa 8520

tttcacaaat aaagcatttt tttcactgca ttctagttgt ggtttgtcca aactcatcaa 8580

tgtatcttat catgtctgga tccgctgcat taatgaatcg gccaacgcgc ggggagaggc 8640

ggtttgcgta ttgggcgctc ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt 8700

cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc cacagaatca 8760

ggggataacg caggaaagaa catgtgagca aaaggccagc aaaaggccag gaaccgtaaa 8820

aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat 8880

cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc 8940

cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc 9000

gcctttctcc cttcgggaag cgtggcgctt tctcatagct cacgctgtag gtatctcagt 9060

tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac 9120

cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg 9180

ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca 9240

gagttcttga agtggtggcc taactacggc tacactagaa gaacagtatt tggtatctgc 9300

gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc cggcaaacaa 9360

accaccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa 9420

ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaaac 9480

tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta 9540

aattaaaaat gaagttttaa atcaatctaa agtatatatg agtaaacttg gtctgacagt 9600

taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg ttcatccata 9660

gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc atctggcccc 9720

agtgctgcaa tgataccgcg agacccacgc tcaccggctc cagatttatc agcaataaac 9780

cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag 9840

tctattaatt gttgccggga agctagagta agtagttcgc cagttaatag tttgcgcaac 9900

gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc 9960

agctccggtt cccaacgatc aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg 10020

gttagctcct tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt gttatcactc 10080

atggttatgg cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct 10140

gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc 10200

tcttgcccgg cgtcaatacg ggataatacc gcgccacata gcagaacttt aaaagtgctc 10260

atcattggaa aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc 10320

agttcgatgt aacccactcg tgcacccaac tgatcttcag catcttttac tttcaccagc 10380

gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca 10440

cggaaatgtt gaatactcat actcttcctt tttcaatatt attgaagcat ttatcagggt 10500

tattgtctca tgagcggata catatttgaa tgtatttaga aaaataaaca aataggggtt 10560

ccgcgcacat ttccccgaaa agtgccacct g 10591

<210> 2

<211> 2249

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gacgtcgcta gctgtacaaa aaagcaggct ttaaaggaac caattcagtc gactggatcc 60

ggtaccaagg tcgggcagga agagggccta tttcccatga ttccttcata tttgcatata 120

cgatacaagg ctgttagaga gataattaga attaatttga ctgtaaacac aaagatatta 180

gtacaaaata cgtgacgtag aaagtaataa tttcttgggt agtttgcagt tttaaaatta 240

tgttttaaaa tggactatca tatgcttacc gtaacttgaa agtatttcga tttcttggct 300

ttatatatct tgtggaaagg acgaaacacc gttcactgcc gtataggcag aatttctact 360

aagtgtagat tgagacgcgt ctcaaatttc tactaagtgt agatagcttg ggccgctcga 420

ggtacctctc tacatatgac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa 480

aggccgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc 540

gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc 600

ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg 660

cctttctccc ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg tatctcagtt 720

cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc 780

gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc 840

cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag 900

agttcttgaa gtggtggcct aactacggct acactagaag aacagtattt ggtatctgcg 960

ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa 1020

ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag 1080

gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg aacgaaaact 1140

cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag atccttttaa 1200

attaaaaatg aagttttaaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt 1260

accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt tcatccatag 1320

ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca 1380

gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc 1440

agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt 1500

ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg 1560

ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg gcttcattca 1620

gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtgc aaaaaagcgg 1680

ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg ttatcactca 1740

tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga tgcttttctg 1800

tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct 1860

cttgcccggc gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca 1920

tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca 1980

gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg 2040

tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata agggcgacac 2100

ggaaatgttg aatactcata ctcttccttt ttcaatatta ttgaagcatt tatcagggtt 2160

attgtctcat gagcggatac atatttgaat gtatttagaa aaataaacaa ataggggttc 2220

cgcgcacatt tccccgaaaa gtgccacct 2249

<210> 3

<211> 2261

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gacgtcgcta gctgtacaaa aaagcaggct ttaaaggaac caattcagtc gactggatcc 60

ggtaccaagg tcgggcagga agagggccta tttcccatga ttccttcata tttgcatata 120

cgatacaagg ctgttagaga gataattaga attaatttga ctgtaaacac aaagatatta 180

gtacaaaata cgtgacgtag aaagtaataa tttcttgggt agtttgcagt tttaaaatta 240

tgttttaaaa tggactatca tatgcttacc gtaacttgaa agtatttcga tttcttggct 300

ttatatatct tgtggaaagg acgaaacacc gttcactgcc gtataggcag ggtaatttct 360

actaagtgta gattgtcccc tgttgactgg tcattcaatt tctactaagt gtagatagct 420

tgggccgctc gaggtacctc tctacatatg acatgtgagc aaaaggccag caaaaggcca 480

ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc 540

atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc 600

aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg 660

gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta 720

ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg 780

ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac 840

acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag 900

gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga agaacagtat 960

ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat 1020

ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc 1080

gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt 1140

ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct 1200

agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt 1260

ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc 1320

gttcatccat agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac 1380

catctggccc cagtgctgca atgataccgc gagacccacg ctcaccggct ccagatttat 1440

cagcaataaa ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg 1500

cctccatcca gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata 1560

gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt gtcacgctcg tcgtttggta 1620

tggcttcatt cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt 1680

gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag 1740

tgttatcact catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa 1800

gatgcttttc tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc 1860

gaccgagttg ctcttgcccg gcgtcaatac gggataatac cgcgccacat agcagaactt 1920

taaaagtgct catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc 1980

tgttgagatc cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta 2040

ctttcaccag cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa 2100

taagggcgac acggaaatgt tgaatactca tactcttcct ttttcaatat tattgaagca 2160

tttatcaggg ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac 2220

aaataggggt tccgcgcaca tttccccgaa aagtgccacc t 2261

Claims (10)

1. A plasmid fusion transposase vector is characterized in that the nucleic acid sequence of the vector is shown as SEQ ID NO. 1.

2. An expression vector of fusion protein of PS transposase and CRISPR/dCpf1, which is characterized in that the vector comprises a CAG promoter, a Kozak sequence, 2 SV40 NLS sequences, a dCpf1 sequence, a linker sequence and a PS transposase sequence;

the sequence of the CAG promoter is the base of 5 th to 1654 th sites from the 5' end in SEQ ID NO. 1;

the Kozak sequence is 1773 to 1782 th bases from the 5' end in SEQ ID NO 1;

the 2 SV40 NSL sequences are respectively upstream and downstream of a dCpf1 sequence;

the sequence of dCpf1 is 2427 th-6107 th base from 5' end in SEQ ID NO 1, wherein the sequence is mutant and is DNA shearing activity deletion type protein;

the linker sequence is the 6135-6179 th base from the 5' end in SEQ ID NO 1;

the PS transposase sequence is 6180-7451 th base from 5' end in SEQ ID NO. 1.

3. The PS transposase and CRISPR/dCpf1 fusion protein expression vector of claim 2, wherein the linker sequence comprises 15 amino acid residues.

4. The expression vector of the PS transposase and CRISPR/dCpf1 fusion protein as claimed in claim 2, wherein the 2 SV40 NSL sequences are 2400-2420 th base and 6114-6134 th base from 5' end in SEQ ID NO 1.

5. Use of a plasmid fusion transposase vector as claimed in claim 1 or a PS transposase and CRISPR/dCpf1 fusion protein expression vector as claimed in any one of claims 2 to 8 for transposon mediated site directed integration.

6. A method of fusion transposase mediated transposon site directed integration, comprising the steps of:

designing a gRNA sequence of a target gene;

constructing cpf1 gRNA expression vector;

co-transfecting a host cell with an expression vector carrying a target gene gRNA, the plasmid fusion transposase vector of claim 1 and a transposon donor plasmid, and performing site-specific transposition of the transposon donor sequence into the target gene;

screening by using a resistance screening gene to obtain a positive monoclonal cell inserted with a report gene;

and (3) counting the number of positive cell clones by giemsa staining, selecting positive monoclonal cells, and carrying out fluorescent quantitative detection on the expression condition of the target gene.

7. The method of claim 6 in which primer sequences for designing gRNA sequences targeting a gene of interest are as follows:

HPRT1-gRNA-F:GTAGATTGTCCCCTGTTGACTGGTCATTC；

HPRT1-gRNA-R:AATTGAATGACCAGTCAACAGGGGACA。

8. the method of fusion transposase mediated transposon site-directed integration according to claim 6, wherein the pSQT14 vector is used as a gRNA expression vector as a framework, and the pSQT14 vector contains the following sequences: AATTTCTACTAAGTGTAGAT are provided.

9. The method of claim 6 in which the pSQT14 vector has the sequence shown in SEQ ID NO. 2.

10. The method of claim 6, wherein the expression vector with the gRNA of the target gene has the sequence as shown in SEQ ID NO. 3.

Images