CN112159812A

CN112159812A - Silencing mitochondrial gene expression in cells using mitochondrial RNAi

Info

Publication number: CN112159812A
Application number: CN202011093634.8A
Authority: CN
Inventors: 张晓荣; 程满
Original assignee: Institute of Biophysics of CAS
Current assignee: Institute of Biophysics of CAS
Priority date: 2020-08-10
Filing date: 2020-10-14
Publication date: 2021-01-01
Anticipated expiration: 2040-10-14
Also published as: CN112159812B

Abstract

The present application provides methods, uses and corresponding medicaments for silencing mitochondrial gene expression in cells or for clearing mitochondrial gene expression products in cells using RNAi technology, in particular using siRNA. The experimental result shows that the corresponding siRNA can effectively knock down all gene expressions in mitochondria and recover the function loss or damage caused by the mutated mitochondrial gene.

Description

Silencing mitochondrial gene expression in cells using mitochondrial RNAi

Technical Field

The present application belongs to the fields of molecular biology and gene therapy, and in particular provides applications, methods and medicaments for eliminating mutated mitochondrial gene expression products in cells using mitochondrial RNAi to treat related diseases.

Background

Many human genetic diseases are related to mitochondrial gene mutations, such as Leber Hereditary Optic Neuropathy (LHON), mitochondrial encephalomyopathy, lactic acidosis and stroke-like onset syndrome (mitogenic encephalopathy, and stroke-like diabetes, MELAS), human neuromuscular weakness, and the like. These mutated mitochondrial genes have genetic heterogeneity that, as mutations accumulate, gradually cause mitochondrial dysfunction, ultimately leading to disease. With the development of RNA interference technology, more and more cases of treating different diseases by using RNAI begin to go to clinic, which shows that RNA therapy has wide prospect, however, all the cases at present aim at diseases caused by nuclear genes, and are not good for disease restraint caused by mitochondrial gene mutation.

The difficulty in treating diseases caused by mitochondrial gene mutations is determined by the structure of mitochondria and the number of mitochondrial genomes. Mitochondria are organelles consisting of inner and outer bilayer membranes, and have high selectivity for the entry and exit of different molecules in cells. Furthermore, the expression system of mitochondrial genes is not known, which makes it difficult to modify the expression of mitochondrial genes using exogenous molecules. Furthermore, there are multiple copies of each mitochondrial genome, and it is very difficult to change all mutated mitochondrial genomes per cell.

Although RNAi has been widely used in eukaryotic nuclear genes, the use of RNAi to eliminate mitochondrial transcripts has not been reported to date.

Disclosure of Invention

On the basis, the inventor tries to provide a technology for silencing mitochondrial gene/clearing mutant mitochondrial gene transcript in cells by using RNAi, particularly siRNA, and provides a possible scheme for related scientific research and treatment of mitochondrial diseases. We have therefore designed sirnas that specifically target mutated mitochondrial genes, and in mutated cell lines, can reduce the transcript of the mutated gene. Because the mutant cell line is a chimera, wild-type transcripts will become dominant and mitochondrial complex function will continue to increase as mutant transcripts are reduced.

In one aspect, the invention provides the use of an RNAi agent in the preparation of an agent for silencing mitochondrial gene expression in a cell.

Further, the silencing mitochondrial gene expression in the cell is clearing mitochondrial gene expression products in the cell.

Further, the mitochondrial gene is a mutated mitochondrial gene.

Further, the RNAi agent is an agent comprising miRNA, piRNA or siRNA.

Further, the RNAi agent is an agent comprising an siRNA.

In another aspect, the invention provides methods for silencing mitochondrial gene expression in cells using RNAi technology for non-diagnostic and non-therapeutic purposes.

Further, the mitochondrial gene is a mutated mitochondrial gene.

Further, RNAi is performed using miRNA, piRNA or siRNA.

Further, RNAi was performed using siRNA.

In another aspect, the present invention provides a medicament for treating diseases caused by mutant mitochondria, which is characterized by comprising an RNAi agent.

Further, the RNAi agent is an agent comprising miRNA, piRNA or siRNA.

Further, the RNAi agent is an agent comprising an siRNA.

Further, the mutated mitochondrial gene is the m8993T > G mutation of the ATP6 gene.

Further, the antisense siRNA sequence of the siRNA is GCGUACGGCCCGGGCUAUUGGTT.

Further, the sense siRNA sequence of the siRNA is CCAAUAGCCCGGGCCGUACGCTT.

Further, the disease caused by the mutant mitochondria is mitochondrial encephalomyopathy.

RNAi as used herein refers to RNA interference (RNA interference), a phenomenon of gene silencing mediated by certain small RNA molecules. The small RNA molecules used in RNAi described herein can be miRNA, piRNA, siRNA, similar or other small RNA molecules currently available or under investigation that do not exclude other similar mechanisms. The RNAi agent described in the present application is an agent comprising the above-mentioned small RNA, and may further comprise an agent for storing and transfecting the above-mentioned small RNA, which is well known in the field of molecular biology or may be provided by the manufacturer of the relevant agent (see, molecular cloning, SammBruke, et al, related works)

Diseases that can be caused by mutant mitochondria described in this application include, but are not limited to, Leber Hereditary Optic Neuropathy (LHON), mitochondrial encephalomyopathy, lactic acidosis and stroke-like onset syndrome (mitochondrial encephalyopathy, lacaciosis, and stroke-like diabetes, MELAS), human neuromuscular debilitation, and diseases associated with mutant mitochondria for which no known or definite etiology is currently available.

The pharmaceutical composition of the present application may comprise pharmaceutically acceptable excipients including, but not limited to, excipients used in various oral, injection and other dosage forms, such as coating materials, solvents, solubilizers, binders, stabilizers, antioxidants, pH modifiers, flavors, and the like. The agents of the present application may contain or be used in combination with other agents for the treatment of the relevant diseases.

Drawings

FIG. 1: sirnas directed to wild-type and mutant ATP6 genes reduced the effect of ATP6mRNA in wild-type and mutant cells;

FIG. 2: results of knocking down 13 mitochondrial genes using siRNA technology.

Detailed Description

Example 1 design of siRNA

siRNA sequences directed against mutations in the ATP6 gene (m8993T > G) and siRNA specific for the wild-type ATP6 gene were designed and synthesis was mandated:

siATP6 m siRNA sense：CCAAUAGCCCGGGCCGUACGCTT(SEQ ID NO.1)；

siATP6 m siRNA antisense：GCGUACGGCCCGGGCUAUUGGTT(SEQ ID NO.2)；

siATP6 w siRNA sense：CCAAUAGCCCUGGCCGUACGCTT(SEQ ID NO.3)；

siATP6 w siRNA antisense：GCGUACGGCCAGGGCUAUUGGTT(SEQ ID NO.4)。

example 2 transfection and mRNA detection

The siRNA specifically directed to the wild-type ATP6 gene prepared in example 1 and the siRNA specifically designed to the ATP6 gene (m8993T > G) mutation were transfected into 143B wild-type and 143B (m8993T > G) mutant cell lines, respectively, according to lipofectamine RNAimax instructions.

After further culturing for 48 hours, cellular RNA was extracted using TRIZOL and the level of ATP6mRNA was determined by reverse transcription quantitative PCR.

The primer of quantitative PCR ATP6 is

ATP6 FP：AAGGCACACCTACACCCCTT(SEQ ID NO.5)；

ATP RP：GGCCTGCAGTAATGTTAGCG(SEQ ID NO.6)；

16S FP：GGTGCAGCCGCTATTAAAGG(SEQ ID NO.7)；

16S RP：ATCATTTACGGGGGAAGGCG(SEQ ID NO.8)；

The results are shown in FIG. 1: in mutant cells, sirnas specifically targeting mutated ATP6 reduced ATP6mRNA efficiency over sirnas of wild-type ATP 6. In contrast, in wild-type cells, sirnas specifically targeting wild-type ATP6 reduced ATP6mRNA more efficiently than sirnas of mutant ATP.

The cells were further treated with siRNA for several days and the activity of complex V was determined by BN-PAGE. In mutant cells, specifically targeting mutant ATP6 can enhance the activity of complex V compared to siRNA that specifically targets wild-type ATP 6.

Example 3 knockdown of 13 mitochondrial genes Using siRNA technology

We designed siRNA specifically targeting 13 genes of mitochondria according to the vicinity of the binding peak position of Ago2 in the Ago2-CLIP seq data, after transfecting mouse cells with the siRNA for 48h by RNiMAX, extracting total RNA, and detecting the knockdown effect of each gene by RT-PCR respectively, the results are shown in FIG. 2: all genes in mitochondria can be efficiently knocked down by siRNA.

Sequence listing

<110> institute of biophysics of Chinese academy of sciences

<120> silencing mitochondrial Gene expression in cells Using mitochondrial RNAi

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> RNA

<213> Artificial sequence ()

<400> 1

ccaauagccc gggccguacg ctt 23

<210> 2

<211> 23

<212> RNA

<213> Artificial sequence ()

<400> 2

gcguacggcc cgggcuauug gtt 23

<210> 3

<211> 23

<212> RNA

<213> Artificial sequence ()

<400> 3

ccaauagccc uggccguacg ctt 23

<210> 4

<211> 23

<212> RNA

<213> Artificial sequence ()

<400> 4

gcguacggcc agggcuauug gtt 23

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 5

aaggcacacc tacacccctt 20

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 6

ggcctgcagt aatgttagcg 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 7

ggtgcagccg ctattaaagg 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 8

atcatttacg ggggaaggcg 20

Claims

Use of an RNAi agent in the preparation of an agent for silencing mitochondrial gene expression in a cell.
2. Use according to claim 1, wherein the silencing of mitochondrial gene expression in cells is the elimination of mitochondrial gene expression products in cells.
3. Use according to claim 1 or 2, wherein the mitochondrial gene is a mutated mitochondrial gene.
4. Use according to any of claims 1-3, wherein the RNAi agent is an agent comprising miRNA, piRNA or siRNA.
5. Use according to claim 4, wherein the RNAi agent is an agent comprising siRNA.
6. A method of silencing mitochondrial gene expression in cells using RNAi technology for non-diagnostic and non-therapeutic purposes.
7. Use according to claim 6, wherein the silencing of mitochondrial gene expression in cells is the elimination of mitochondrial gene expression products in cells.
8. Use according to claim 6 or 7, wherein the mitochondrial gene is a mutated mitochondrial gene.
9. Use according to any of claims 6-8, wherein RNAi is effected using miRNA, piRNA or siRNA.
10. Use according to claim 9, wherein RNAi is performed using siRNA.
11. A medicament for treating a disease caused by a mutant mitochondria, comprising an RNAi agent.
12. The medicament according to claim 11, wherein the RNAi agent is an agent comprising miRNA, piRNA or siRNA.
13. Use according to claim 12, wherein the RNAi agent is an agent comprising an siRNA.
14. Use according to claim 3 or medicament according to claim 11 wherein the mutated mitochondrial gene is the m8993T > G mutation of the ATP6 gene.
15. The use, method or medicament according to any one of claims 5, 9, 13, 14 wherein the antisense siRNA sequence of the siRNA is GCGUACGGCCCGGGCUAUUGGTT.
16. The use, method or medicament of claim 14, wherein the sense siRNA sequence of the siRNA is CCAAUAGCCCGGGCCGUACGCTT.
17. The use or medicament according to claim 14, wherein the disease caused by mutated mitochondria is a mitochondrial encephalomyopathy.