CN1121498C - Hay bacillus expression element of giant bacillus penicillin G amidase - Google Patents
Hay bacillus expression element of giant bacillus penicillin G amidase Download PDFInfo
- Publication number
- CN1121498C CN1121498C CN 99113885 CN99113885A CN1121498C CN 1121498 C CN1121498 C CN 1121498C CN 99113885 CN99113885 CN 99113885 CN 99113885 A CN99113885 A CN 99113885A CN 1121498 C CN1121498 C CN 1121498C
- Authority
- CN
- China
- Prior art keywords
- penicillin
- bacillus
- subtilis
- acylase
- expression element
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The present invention relates to a bacillus subtilis expression element of bacillus megatherium penicillin G acylase, which contains a bacillus subtilis promotor, a ribosome binding site of bacillus megatherium source penicillin G acylase and a structure gene of the ribosome binding site. The expression element is transferred into a bacillus subtilis parasitifer to obtain a bacillus subtilis gene engineering strain of the bacillus megatherium penicillin G acylase stably expressed, and the expression amount of the bacillus megatherium penicillin G acylase in bacillus subtilis is enhanced. The expression element has the advantages of high enzyme production speed, no need of induction, stable passage, simplified production technology and shortened production period, and is suitable for industrial production and application.
Description
Technical field
The present invention relates to the subtilis expression system, be specifically related to the subtilis Expression element of bacillus megaterium penicillin G acylase gene.
Background technology
Penicillin G acylase (Penicillin G acylase EC3.5.1.11; be called for short PGA) can catalysis β-Nei Xiananleikangshengsu generation deacylation and produce 6-amino-penicillanic acid (6-APA); 6-APA has extensive use in semisynthetic penicillin, thereby PGA is more and more important in industrial production.PGA extensively is present in the various microorganisms, all uses intestinal bacteria excretory PGA at present, but bacillus megaterium can secrete PGA to born of the same parents, and is more favourable on industry is extracted.But the natural bacterial strain defectiveness of bacillus megaterium: in the bacterium culturing process, need the frequent toluylic acid inducible enzyme that adds to produce, and need temperature-variable fermentation, promptly cultivated 2 days, cultivate the generation with inducible enzyme in 1 day at 25 ℃ again at 28 ℃, fermentation period is longer, and these all are disadvantageous for large scale fermentation.Utilize gene engineering method to make up the zymogenic bacteria of high yield and secretor type, will promote it in industrial application.
Bibliographical information [Zhang Lanfang etc., biotechnology journal, 1991,7 (1), 47-53; Martin L et al, FEMS Microbiology Letters, 1995,125:287-92] be cloned into bacillus megaterium pga respectively, and in intestinal bacteria, done expression.The bacillus megaterium penicillin G acylase gene that Martin etc. screen is expressed in E.coli HB101 and is not needed inducing of toluylic acid, but expression amount is very faint, and detects less than enzymic activity outside born of the same parents.Zhang Lanfang etc. are cloned into bacillus megaterium penicillin G acylase gene (comprising structure gene and regulatory gene), express in E.coli MC1061, and expression can only be carried out at 28 ℃.In addition, toluylic acid to induce producing enzyme be necessary.
Subtilis has following advantage as expression system: (1) can be the protein direct secretion that function is arranged outside born of the same parents; (2) non-virulent; (3) there is not tangible preference codon.Compare with subtilis, the Colibacter Gram-negative bacteria, since far away with the bacillus megaterium sibship, post-treatment may not correctly be finished.The protein of many gram-positive microorganisms can be expressed subtilis under the control of himself expression signal.When the growth conditions that produces certain proteic original bacterium was comparatively harsh, in its gene clone to one multiple copied plasmid, expression level can improve usually.Find in addition some in subtilis expressed proteins than original bacterium lay eggs white have better thermostability or wideer pH scope.And the possible deleterious protein secreting that subtilis can will constantly produce is in external substratum.Avoided the murder by poisoning of pair cell, so may obtain highly active penicillin G acylase.Kang etc. once expressed the bacillus megaterium penicillin acylase in subtilis, but expression amount lower [Kang J H etal, Journal of Biotechnology, 1991,17 (2): 99-108].Our laboratory to PGA the expression in subtilis done and goed deep into extensive studies, also once delivered article [yellow bright red etc., Chinese biological chemistry and molecular biosciences journal, 1999,15 (1): 169-71], in intestinal bacteria and subtilis, all done expression, but enzyme running water is flat lower, in the LB substratum＜0.8U/ml.
Summary of the invention
For this reason; the object of the invention provides improved bacillus megaterium penicillin G acylase Expression element; comprise ribosome bind site and the structure gene thereof of subtilis promotor and bacillus megaterium source PGA, the ribosome bind site sequence in the Expression element is GGAGGTGGAAATGTA.
As promoter sequence, can use any promotor that is suitable in subtilis, expressing desired protein, select for use and can start the overlapping promotor better effects if of expressing at different time.With promotor, ribosome bind site and PGA structure gene with recombinant DNA technology according to the subtilis Expression element that obtains PGA that is connected shown in Figure 1.With the T4 dna ligase Expression element is connected with expression vector (expression plasmid or chromosomal integration vector), is transformed among the subtilis host, acquisition comprises the bacillus subtilis genetic engineering bacterial strain of the expression PGA of above-mentioned Expression element.
Bacillus megaterium penicillin G acylase gene and ribosome bind site thereof derive from bacillus megaterium (as Bacillus megaterium CA4098, ATCC14945 etc.) genome.The present invention is according to reporting sequences Design two ends primer, directly with PCR method increase structure gene and ribosome bind site.Also can be according to the upstream and downstream sequence of the bacillus megaterium penicillin G acylase gene of having reported, set up secondary library with restriction enzyme and from genomic dna, obtain in conjunction with the method (needing synthetic one section oligonucleotide probe) of bacterium colony in situ hybridization.
As promoter sequence, can use any promotor that is suitable in subtilis, expressing desired protein, for example: P43, HpaII, veg, rrnT2 etc.Overlapping promotor P43 best results, this promotor can subtilis vegetative period and stationary phase respectively promotor gene transcribe.Expression vector can be subtilis plasmid or subtilis chromosomal integration vector, for improving expression amount, adopts plasmid vector to have more advantage.The factor that the construction expression plasmid should at first be considered in the subtilis is the stability of plasmid.Expression plasmid generally adopts the plasmid of deriving (pPZW103 in the embodiment of the invention promptly be the pUB110 that comprises the P43 promotor derive plasmid) of stable p UB110 or pUB110.Select suitable restriction enzyme site, bacillus megaterium penicillin G acylase gene and ribosome bind site sequence thereof are connected in the T4 dna ligase after the promotor of expression vector, promptly obtain to comprise the subtilis expression plasmid of PGA Expression element.
At last, (other is as BR151 with SP method or protoplasm body or electrotransformation etc. expression plasmid to be imported subtilis host cell Bacillus subtilis 168, BCL1050, DB104 or WB600 etc. all can), obtain to express the bacillus subtilis genetic engineering bacterial strain pga-SIBAS205 (be deposited in Beijing China Committee for Culture Collection of Microorganisms common micro-organisms center on June 7th, 1999, deposit number is CGMCC No.0398) of PGA.Expressing temperature is 37 ℃ of the bests.Cultivated 24 hours in the LB substratum, supernatant records PGA vigor 3-6U/ml, need not inducing of toluylic acid.Enzyme activity determination adopts NIPAB method [Shanghai No. 3 Pharmaceutical Factory etc., medicine industry, 1978,7:22-4].Under the condition that does not contain antibiotic selective pressure, through the experiment of going down to posterity in continuous 10 days, yield of enzyme did not have obvious decline (see figure 3), and it is stable to have proved that pga-SIBAS205 goes down to posterity.
Advantage: PGA Expression element provided by the invention replaces the original promotor of PGA in bacillus megaterium by preferred subtilis promotor, start respectively in vegetative period of subtilis and stationary phase and to transcribe, improve transcriptional level, and avoided temperature-variable fermentation and toluylic acid is induced (regulation and control of toluylic acid occur in transcriptional level); Guarantee translation initiation efficient by continuing to use the original ribosome bind site of bacillus megaterium; Improved the expression amount of PGA in subtilis greatly, product enzyme speed is fast, need not induce, and it is stable to go down to posterity, and production technique is simplified, and the production cycle shortens dramatically, and is suitable for suitability for industrialized production and application.
Description of drawings
Fig. 1: the subtilis Expression element synoptic diagram of bacillus megaterium penicillin acylase
Fig. 2: the structure synoptic diagram of penicillin G acylase expression plasmid pEES102
Fig. 3: PGA Expression element beta stability line figure
Embodiment
The present invention further sets forth by following examples, but does not limit the scope of the invention.
The clone of embodiment 1 bacillus megaterium penicillin G acylase gene
1. the genomic extracting of bacillus megaterium
Select to cultivate 14 hours bacillus megaterium CA4098 extracting genome.Get 3ml bacterium liquid, centrifugal 5 minutes of 6000r/min gets 400 μ l TE (pH8.0,10mmol/L Tris, 1mmol/L EDTA) the suspension thalline, add N,O-Diacetylmuramidase to final concentration 7mg/ml bacterium liquid, 37 ℃ digestion 1 hour, the phenol extracting once, phenol/chloroform extracting secondary, at last once by the chloroform extracting, draw supernatant, 2 times of volume ethanol precipitations, 12, centrifugal 5 minutes of 000rpm, precipitation is with 70% washing with alcohol one time, and 12,000rpm is centrifugal, abandon supernatant, the precipitation seasoning is dissolved in the 100 μ l TE solution, adds 2 μ l 10mg/ml RNA enzyme A, room temperature is placed half an hour, the check of 0.7%Agarose electrophoresis.
2. design of primers and PCR reaction
According to the sequence of the bacillus megaterium penicillin acylase gene of bibliographical information (Martin L etal, FEMS Microbiology Letters, 1995,125:287-92), designed two sections primers and carried out the PCR reaction, the PCR primer is synthetic by Sangon:
Primer 15, GCC
GAATTCGGAGGTGGAAATGTAAT3 '
Primer 25 ' AT
GGATCCTTACTTACTCATATTTAA3 '
At design gene 5, end primer (primer 1) has comprised ribosome bind site, has introduced an EcoRI restriction enzyme site simultaneously.Gene 3 ' end primer (primer 2) has comprised near the sequence the terminator codon TAG, and introduces a BamHI restriction enzyme site.
With the bacillus megaterium chromosomal DNA is template, add a certain amount of primer 1, primer 2, TaqDNA polysaccharase and dNTP mixture, in 92 ℃ of sex change 7 minutes, follow these steps to carry out 30 circulations then: 92 ℃ of sex change 1 minute, annealed 1 minute for 50 ℃, 72 ℃ were extended 3 minutes, circulated in 72 ℃ for the last time and extended 10 minutes.Product is through PCR purification kit purifying, and the 0.7%Agarose electrophoresis is checked.
3.PCR the clone of product
The PCR product reclaims DNA with phenol/chloroform extrct Deproteinization, alcohol precipitation, dissolves with 10 μ l TE again after draining; PBluescript SK (+) 1 μ g is complete with EcoRI and BamHI digestion, enzyme is cut liquid carry out the 0.7%Agarose electrophoresis, reclaims the 2.96kb fragment.By 4: 1 mixed, 16 ℃ of connections were spent the night, Transformed E .coli XL1-Blue with above two kinds of fragments.The plasmid that makes up is called pPGA (Fig. 2).
The structure (Fig. 2) of embodiment 2 penicillin acylase gene expression plasmid pEES102
The pPGA plasmid 5 μ g that are connected with the penicillin acylase gene are complete with EcoRI digestion, add 2 μ l dNTP mixtures and 2U Klenow enzyme, room temperature reaction 30 minutes.With phenol/chloroform extrct Deproteinization, alcohol precipitation reclaims DNA, again with 20 μ l TE dissolving, uses the BamHI complete degestion again after draining, and enzyme is cut liquid carry out the 0.7%Agarose electrophoresis, reclaims the 2.6kb fragment.Cut expression vector pPZW103 (by providing of the Wang Pei of biology department of Chinese University of Science and Technology) 2 μ g with SmaI and BamHI enzyme simultaneously, by 4: 1 mixed, 16 ℃ of connections were spent the night with above two kinds of fragments, transformed subtilis Bacillus subtilis168.
The conversion of embodiment 3 expression plasmids in subtilis
Getting one first day afternoon completely encircles subtilis Bacillus subtilis 168 glycerol stocks and draws flat board, 37 ℃ of incubator overnight incubation.(the SPI substratum: it is 50% (W/V) glucose solution that SP salt adds 1% volumetric concentration, 1% volume, 100 * CAYE solution to 1ml SPI substratum to choose single bacterium colony in second day; SP salts solution: 0.2% (NH
4)
2SO
4, 1.4%K
2HPO
4, 0.6%KH
2PO
4, 0.02%MgSO
47H
2O, 0.1% Trisodium Citrate), 37 ℃, 250rpm cultivated 3 hours.Get the 0.1ml nutrient solution to 5ml SPI substratum, similarity condition was cultivated 4 hours.Shift wherein that (the SPII substratum: the SPI substratum adds 1% volume 50mmolL in 1.2ml to the 12ml SPII substratum
-1CaCl
2Solution, 1% volume 250mmolL
-1MgCl
2Solution), 37 ℃, 100rpm cultivated 90 minutes.Be distributed into the every pipe of 0.5ml, each adds 5 μ l10mmol/L EGTA, and again in 37 ℃, 100rpm cultivated 10 minutes.Add 5 μ l and connect liquid, again in 37 ℃, 240rpm cultivated 90 minutes, got bacterium liquid coating kantlex (50mg/L) LB flat board, and getting transformant promptly is bacillus subtilis genetic engineering bacterial strain pga-SIBAS205.
Embodiment 4 bacillus megaterium penicillin G acylases are expressed
Connect the single bacterium colony of SIBAS205 in the LB liquid nutrient medium from the LB flat board that contains kantlex 60 μ g/ml (LB substratum: peptone 1%, yeast extract paste 0.5%, NaCl 1%, flat board adds 1.5%Agar), in 37 ℃, 250r/min cultivated 24 hours.Centrifuging and taking 20 μ l supernatants.Add in the 980 μ l phosphoric acid buffers, 37 ℃ of temperature are bathed.0.9mg/ml NIPAB (6-nitro-3-(phenylacetylamino) phenylformic acid) solution that adds 2ml37 ℃ of preheating again.Reacted 4 minutes, and took out adding 2ml95% ethanol termination reaction.Blank adds 2ml95% ethanol earlier, the enzyme-added liquid in back.Measure absorbancy in 405nm.Enzyme activity is defined as: to produce the amount of the required penicillin acylase of 6-nitro 3-amino-phenylformic acid of 1 μ mol be 1 unit in hydrolysis in 1 minute.
The PGA vigor of fermented liquid supernatant is 3-6u/ml.
The detection of embodiment 5 pEES102 plasmid stabilities
Connect the single bacterium colony of pga-SIBAS205 in 3ml LB substratum from containing kantlex 60 μ g/ml LB flat boards, in 37 ℃, 250rpm cultivated 24 hours.Bacterium liquid centrifuging and taking supernatant is measured vigor.Get 30 μ l bacterium liquid simultaneously and be forwarded in the 3ml LB substratum as kind of a daughter bacteria, similarity condition goes down to posterity and vitality test.
Under the condition that does not contain antibiotic selective pressure, through the experiment of going down to posterity in continuous 10 days, yield of enzyme did not have obvious decline as seen from Figure 3.
Claims (3)
1. the subtilis Expression element of a bacillus megaterium penicillin G acylase; it is characterized in that this Expression element comprises the ribosome bind site and the structure gene thereof of subtilis promotor and bacillus megaterium source penicillin G acylase, the sequence of the ribosome bind site of this bacillus megaterium penicillin G acylase is GGAGGTGGAAATGTA.
2. Expression element according to claim 1 is characterized in that described promotor is the overlapping promotor P43 of subtilis.
3. a preservation registration number that comprises the described Expression element of claim 1 is the bacillus subtilis genetic engineering bacterial strain of the expression bacillus megaterium penicillin G acylase of CGMCC No.0398, it is characterized in that this bacterial strain is that described Expression element is transformed into the engineering strain pga-SIBAS205 that obtains in the subtilis 168.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 99113885 CN1121498C (en) | 1999-07-16 | 1999-07-16 | Hay bacillus expression element of giant bacillus penicillin G amidase |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 99113885 CN1121498C (en) | 1999-07-16 | 1999-07-16 | Hay bacillus expression element of giant bacillus penicillin G amidase |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1281049A CN1281049A (en) | 2001-01-24 |
| CN1121498C true CN1121498C (en) | 2003-09-17 |
Family
ID=5277028
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 99113885 Expired - Fee Related CN1121498C (en) | 1999-07-16 | 1999-07-16 | Hay bacillus expression element of giant bacillus penicillin G amidase |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1121498C (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113481121B (en) * | 2021-06-30 | 2023-02-28 | 江苏阿尔法药业股份有限公司 | Double-bacterium biocatalyst and application thereof in sitagliptin synthesis |
| CN115181691B (en) * | 2022-06-21 | 2024-04-19 | 中国科学院烟台海岸带研究所 | Bacillus DB-Q3 and application thereof |
-
1999
- 1999-07-16 CN CN 99113885 patent/CN1121498C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN1281049A (en) | 2001-01-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100415879C (en) | Acid-proof and high-temperature resistant alpha-amylase and production thereof | |
| JPS5835197A (en) | Plamid pcg 2 | |
| CN111621458B (en) | BVG90_11450 gene-deleted serratia marcescens engineering bacterium | |
| CN103525784A (en) | Partial glyceride lipase mutant, plasmids, recombination strains, preparation methods and applications | |
| KR20000060322A (en) | Gene Derived from Pseudomonas fluorescens Which Promotes the Secretion of Foreign Protein in Microorganism | |
| CN101463358A (en) | Nitrile hydratase gene cluster and use thereof | |
| FR2559781A1 (en) | NOVEL HYBRID PLASMIDIC VECTOR OF E. COLI PROVIDING THE POWER TO FERMENT SUCROSE AND ITS PREPARATION METHOD | |
| CN1121498C (en) | Hay bacillus expression element of giant bacillus penicillin G amidase | |
| CN111378673B (en) | Application of mutant of transcription regulatory factor TR2 in preparation of vitamin B12 | |
| US4464471A (en) | Biologically engineered plasmid coding for production of β-glucosidase, organisms modified by this plasmid and methods of use | |
| CN111057133B (en) | Response regulator and its mutant and its application in preparing vitamin B12In (1) | |
| HU194316B (en) | Process for preparing alpha-l human leukocyte interferone | |
| CN111117942A (en) | Genetic engineering bacterium for producing lincomycin and construction method and application thereof | |
| CN101475944B (en) | Promoter replacement method for improving Bacillus amyloliquefaciens yield | |
| CN111041020B (en) | Isocitrate lyase mutant, mutant gene and application thereof in preparation of vitamin B12In (1) | |
| CN112359007A (en) | Exogenous introduction edd gene bacillus licheniformis for producing bacitracin and application | |
| CN102268431B (en) | Orotidine-5'-phosphate decarboxylase promoter (pRtura3), application thereof, construct thereof and vector thereof | |
| CN104371964A (en) | Strain capable of improving performance of recombinant protein under aerobic condition | |
| CN115851632B (en) | Laccase mutant and application thereof | |
| CN105018452B (en) | Streptokinase QK genes and recombinant expression carrier, recombinant bacterium and application containing the gene | |
| CN101434930B (en) | Streptomyces clavuligerus, as well as preparation method and application | |
| CN112575023B (en) | Method for efficiently expressing phospholipase D in streptomyces and recombinant streptomyces | |
| RU1806191C (en) | Strain of bacterium micrococcus species - a producer of restrictase msp | |
| CN115927267A (en) | Bile acid complex enzyme preparation and application thereof in preparation of feed additive for improving digestibility of animal protein | |
| DK157562B (en) | PROCEDURE FOR PREPARING AT LEAST TWO DEOXYRIBONUCLEASES |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C56 | Change in the name or address of the patentee |
Owner name: SHANGHAI INST. OF LIFE SCIENCE, CAS Free format text: FORMER NAME OR ADDRESS: SHANGHAI INST. OF BIOCHEMISTRY, CHINESE ACADEMY OF SCIENCES |
|
| CP01 | Change in the name or title of a patent holder |
Address after: 200031 No. 320, Yueyang Road, Shanghai Patentee after: Shanghai Institute of life Sciences, Chinese Academy of Sciences Address before: 200031 No. 320, Yueyang Road, Shanghai Patentee before: Shanghai Research Institute of Biochemistry Chinese Academy of Sciences |
|
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |