CN112143749B

CN112143749B - Long-acting recombinant canine interferon product, and preparation method and application thereof

Info

Publication number: CN112143749B
Application number: CN202010880537.7A
Authority: CN
Inventors: 李振义; 杜金玲; 白俊岩
Original assignee: Beijing Yinong Biotechnology Co ltd; Yantai Baoying Biotechnology Co ltd; Beijing Baoyi Biotechnology Co ltd
Current assignee: Beijing Baoyi Biotechnology Co ltd; Beijing Yinong Biotechnology Co ltd; Hebei Baoying Biotechnology Co ltd
Priority date: 2020-08-27
Filing date: 2020-08-27
Publication date: 2023-05-12
Anticipated expiration: 2040-08-27
Also published as: CN112143749A

Abstract

The invention discloses a long-acting recombinant canine interferon product and a preparation method and application thereof, and is characterized in that the method comprises the steps of connecting a canine alpha-interferon gene with a canine SETD2 gene through a linker to form a fusion gene for encoding CaIFN-alpha-SETD 2, and introducing the fusion gene of the CaIFN-alpha-SETD 2 into escherichia coli through enzyme digestion and connection to obtain recombinant expression bacteria, wherein the recombinant expression bacteria can induce the expression of the CaIFN-alpha-SETD 2 fusion protein. The test of the invention proves that: the long-acting recombinant canine interferon product prepared by the invention is a high-efficiency, long-acting and broad-spectrum canine virus resistant pharmaceutical product, which is prepared by fusion expression of canine interferon genes and SETD2 proteins, on one hand, the molecular weight of the interferon proteins is increased, the half life of the interferon product is prolonged, and simultaneously SETD2 in the fusion proteins plays a positive regulation role in the antiviral immune process of the interferon, so that the antiviral capacity of the interferon is enhanced.

Description

Long-acting recombinant canine interferon product, and preparation method and application thereof

Technical Field

The invention relates to the technical field of biological vaccine preparation, in particular to a long-acting recombinant canine interferon product, a preparation method and application thereof.

Background

Interferon (IFN) is a cytokine discovered by the uk and switzerland scientists in 1957 when studying influenza interference phenomenon using chick embryo chorioallantoic membranes and is named according to its ability to interfere with viral replication. The interferon family is largely divided into three subfamilies: i.e., type I interferon (IFN-I), type II interferon (IFN-II), type III interferon (IFN-III). Among them, type I interferon is an important effector cytokine involved in antiviral immunity, and is produced and secreted by host natural immune cells after recognizing viruses, including various types such as IFN-alpha (13 subtypes), IFN beta, IFN epsilon, IFN tau, IFN kappa, IFN omega, IFN delta and IFN zeta.

Type I IFN- α/β is produced by fibroblasts, lymphocytes and plasmacytoid dendritic cells mainly under the induction of viruses, double stranded RNA, polypeptides, bacterial lipopolysaccharides and cytokines. Its antiviral function is mainly achieved by inducing intracellular JAK-STAT signal activation and activating interferon inducible gene (ISG) expression. IFN activates the intracellular tyrosine kinase JAK family primarily by binding to the corresponding receptor (IFNAR) on the cell membrane, first catalyzing the phosphorylation of JAK1 and TYK 2; JAK1 and TYK2 are kinases that bind to the intracellular segment of IFNAR, which in turn phosphorylate IFN receptor tyrosine residues. IFN-alpha/beta adheres to STAT1-STAT2 dimer and interferon regulatory factor 9 to form interferon stimulatory gene factor 3 (ISGF 3), translocates into the nucleus and binds to the interferon stimulatory response element (interferon-stimulated response element) cis-acting element present in the IFN-alpha/beta inducible gene promoter or enhancer, regulating expression of the associated gene. Finally, the antiviral immune response is realized. The induction factors of different kinds of IFNs are different, and the kind of the bound receptor and its detailed signal transduction pathway are also different. IFN induces hundreds of ISG products to inhibit many different families of RNA and DNA viruses. Some of these products have antiviral activity directly, and some are involved in the regulation of ISG, an active antiviral activity-related moiety, and ISG-encoded proteins exert antiviral functions at different stages of viral infection in a host.

Histone methyltransferase SETD2, consisting of 2564 amino acids, has a molecular weight of about 300kDa. Mature SETD2 proteins consist essentially of 6 subunits: (1) AWS domain (2) SET domain (3) PostSET domain (4) Asp-B-Hydro_N domain (5) C-terminal WW domain (6) SRI domain. Of the 6 subunits, the functionally related domains are the WW and SRI domains located at the C-terminus and the SET domain in between. SETD2 is a key positive regulator in IFN- α mediated antiviral immunization. SETD2 mediates the regulation and control of an IFN signal path through two mechanisms of posttranslational modification and epigenetic modification, SETD2 promotes the 525 th lysine of the downstream STAT1 of IFN-alpha to carry out single methylation modification through a SET domain with methyltransferase activity, so as to promote the interaction between JAK1 and STAT1, enhance the JAK 1-mediated phosphorylation modification of STAT1, promote the phosphorylation activation of STAT1, enhance the binding capacity with DNA and up-regulate the expression of antiviral genes ISGs. Meanwhile, SETD2 is also directly involved in regulating and controlling the modification of H3K36me3 with transcriptional activation markers in the region far from the ISGs gene promoter, and further promoting and maintaining the transcription of genes, thereby promoting the antiviral immune response of IFN. In summary, there is a need to develop a long-acting recombinant canine interferon product, and a preparation method and application thereof.

Disclosure of Invention

Therefore, the invention provides a long-acting recombinant canine interferon product, a preparation method and application thereof.

In order to achieve the above object, the present invention provides the following technical solutions:

a preparation method of long-acting recombinant canine interferon comprises the steps of connecting canine alpha-interferon genes with canine SETD2 genes through a linker to form fusion genes encoding CaIFN-alpha-SETD 2, carrying out enzyme digestion and connection on the fusion genes of the CaIFN-alpha-SETD 2, and introducing the fusion genes into escherichia coli to obtain recombinant expression bacteria, wherein the recombinant expression bacteria can be used for inducible expression of the CaIFN-alpha-SETD 2 fusion proteins.

In one embodiment of the invention, the fusion gene of CaIFN-alpha-SETD 2 is a 1) or a 2) or a 3) as follows:

a1 As shown in SEQ ID NO:2, a sequence shown in seq id no;

a2 A DNA molecule which hybridizes under stringent conditions to the DNA molecule defined in a 1) and which codes for said CaIFN- α -SETD2 fusion protein;

a3 A DNA molecule having more than 90% identity to the DNA molecule defined in a 1) or a 2) and encoding said CaIFN-alpha-SETD 2 fusion protein.

In one embodiment of the invention, the CaIFN-alpha-SETD 2 fusion gene is introduced into the escherichia coli through a recombinant expression vector pET-CaIFN-alpha-SETD 2;

the recombinant expression vector pET-CaIFN-alpha-SETD 2 is a vector obtained by replacing a small fragment between XhoI and Nde I restriction sites with a DNA molecule of the CaIFN-alpha-SETD 2 fusion gene.

In one embodiment of the invention, the nucleotide sequence of the linker is shown in SEQ ID.3.

In one embodiment of the invention, the E.coli is BL21.

In one embodiment of the invention, the recombinant expression bacteria are inoculated into LB culture medium containing 30 mug/ml kanamycin, and shake-cultured at 37 ℃ for 200r/min overnight;

inoculating the bacterial liquid cultured overnight into a sterilization fermentation tank according to 2% of the amount of a culture medium, carrying out aeration culture at 37 ℃, controlling the stirring speed of the fermentation tank to be 500-700 r/min, controlling the dissolved oxygen to be 60-90%, and controlling the pH value to be 7.0;

and (3) after the recombinant expression bacteria grow to the mid-logarithmic growth phase, adding IPTG with the final concentration of 1mmol/L, inducing for 5 hours at 37 ℃, and purifying the fermentation product to obtain the CaIFN-alpha-SETD 2 fusion protein.

The invention also provides a long-acting recombinant canine interferon product, which comprises a stabilizer, methylcellulose and the CaIFN-alpha-SETD 2 fusion protein prepared by the method.

The long-acting recombinant canine interferon prepared by the method is applied to b 1), b 2), b 3) or b 4) as follows, and b 1) is used for preparing a canine parvovirus disease resistant product; b2 Preparing a product for resisting canine distemper virus disease; b3 Preparing a product for resisting canine parainfluenza virus disease; b4 For preparing the anti-canine adenovirus products, and also belong to the protection scope of the invention.

The invention has the following advantages:

the test of the invention proves that: the long-acting recombinant canine interferon product prepared by the invention is a high-efficiency, long-acting and broad-spectrum canine virus resistant pharmaceutical product, which is prepared by fusion expression of canine interferon genes and SETD2 proteins, on one hand, the molecular weight of the interferon proteins is increased, the half life of the interferon product is prolonged, and simultaneously SETD2 in the fusion proteins plays a positive regulation role in the antiviral immune process of the interferon, so that the antiviral capacity of the interferon is enhanced.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below. It will be apparent to those of ordinary skill in the art that the drawings in the following description are exemplary only and that other implementations can be obtained from the extensions of the drawings provided without inventive effort.

FIG. 1 is an agarose gel electrophoresis chart of a fusion gene recombinant plasmid of CaIFN-alpha-SETD 2 provided by the embodiment of the invention after digestion, wherein M: DL5000marker;1, enzyme cutting; 2: water control;

FIG. 2 is a western-blot identification chart of recombinant expression protein CaIFN-alpha-SETD 2 fusion protein provided by the embodiment of the invention, wherein M: protein markers; 1: recombinant bacteria; 7: non-induced expression of the cells;

FIG. 3 is a schematic illustration of a 96-well cell culture plate according to an embodiment of the present invention;

FIG. 4 is a graph showing the concentration change of the CaIFN-. Alpha. -SETD2 fusion protein of the present invention in blood according to an embodiment of the present invention.

Detailed Description

Other advantages and advantages of the present invention will become apparent to those skilled in the art from the following detailed description, which, by way of illustration, is to be read in connection with certain specific embodiments, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Example 1 design and Synthesis of CaIFN-. Alpha. -SETD2 fusion Gene

1. According to the canine alpha-interferon gene sequence published by GenBank (Genbank: NP-001006655.1) and canine SETD2 gene sequence (Genbank: XP-864158.1), two genes were concatenated at linker GGGGSGGGGS (GGCGGCGGCGGCAGCGGCGGCGGCGGCAGC), codon optimization was performed with reference to E.coli preference, ndeI cleavage sites CATATG and XhoI cleavage sites CTCGAG were added at the 5 'and 3' ends, respectively, and fusion genes encoding CaIFN-alpha-SETD 2 were synthesized artificially. The fusion gene sequence of the synthesized CaIFN-alpha-SETD 2 is shown as SEQ ID NO. 2. The amino acid sequence of the fusion protein of CaIFN-alpha-SETD 2 is shown as SEQ ID NO. 1.

2. Construction of pET-CaIFN-alpha-SETD 2 fusion expression vector

(1) Target gene enzyme digestion: the synthesized CaIFN-. Alpha. -SETD2 gene was double digested with restriction enzymes Nde I and Xho I, enzyme digestion system (20. Mu.l): 1. Mu.l of interferon gene, 1. Mu.l of Nde I, 1. Mu.l of Xho I, 2. Mu.l of 10 XBuffer, and ddH ₂ O15. Mu.l, and the mixture was digested with ice at 37℃for 2 hours. The enzyme section is separated by agarose gel electrophoresis, and recovered and purified by using a gel recovery kit.

(2) And (3) carrier enzyme cutting: vector pET30a (+) is selected, and is subjected to double digestion by restriction enzymes Nde I and Xho I, and a digestion system (20 μl):pET30a(+)1μl，Nde I 1μl，Xho I 1μl，10×Buffer 2μl，ddH ₂ o15. Mu.l, and the mixture was digested with ice at 37℃for 2 hours.

(3) Ligation of the target Gene with vector: ligation of the CaIFN-. Alpha. -SETD2 gene cleavage product and vector pET30a (+) cleavage product with T4 ligase, ligation System (10. Mu.l): 10 XBuffer 1. Mu.l, pET30a (+) cleavage product 2. Mu.l, interferon gene cleavage product 2. Mu.l, T4 DNA ligase 1. Mu.l, ddH ₂ O4. Mu.l, was run on ice and after mixing was allowed to join overnight at 16 ℃.

(4) Conversion: 10. Mu.l of the ligation product was added to a centrifuge tube containing 100. Mu.l of E.coli DH 5. Alpha. Competent cells, mixed well, ice-bathed for 30min, heat-shocked in a constant temperature water bath at 42℃for 90s, immediately ice-bathed for 2min after removal, 500. Mu.l of LB liquid medium was added to each centrifuge tube, incubated at 37℃for 1h at 200r/min, 100. Mu.l of plates coated with kanamycin were taken, and incubated overnight at 37℃in an inverted state.

(5) Plasmid extraction: single colonies on the plates were picked up, inoculated into LB liquid medium containing kanamycin, cultured at 37℃for 12h at 200r/min, plasmids were extracted according to the plasmid extraction kit instructions, recombinant plasmids were digested with Nde I and Xho I, and approximately 5kb pET30a (+) vector strips and 3717bp exogenous fragments were generated by agarose electrophoresis, the size of which completely met the expectations, and the electrophoresis results were shown in FIG. 1. The recombinant plasmid was designated pET-CaIFN-alpha-SETD 2.

3. Fermentation culture: transforming pET-CaIFN-alpha-SETD 2 plasmid into BL21 (DE 3), picking single colony, inoculating into LB culture medium containing 30 mug/ml kanamycin, and shake culturing at 37deg.C and 200r/min overnight; inoculating the bacterial liquid into a sterilization fermentation tank according to 2% of the culture medium, carrying out aeration culture at 37 ℃, controlling the stirring speed of the fermentation tank to be 500-700 r/min, controlling the dissolved oxygen to be 60-90%, and controlling the pH value to be 7.0; and after the thalli grow to the mid-logarithmic growth phase, adding IPTG with the final concentration of 1mmol/L, and inducing for 5h at 37 ℃.

4. Cell disruption

After the cultivation is finished, the bacterial precipitate is collected by centrifugation, PBS is used for washing for 2 times, 10 percent PBS suspension is prepared, bacteria are crushed by a high-pressure refiner at the temperature of 2-8 ℃, and the crushed bacterial solution is centrifuged for 15 minutes at 8000r/min to collect inclusion bodies.

5. Purification of recombinant proteins

The inclusion bodies were washed with a buffer containing 2M urea, with a magnetic stirrer for 30 minutes, centrifuged at 8000r/min for 10 minutes at 4℃and the supernatant removed and the washing repeated. Adding 8mol/L urea to dissolve and wash inclusion bodies, ultrasonically cleaning for 30 minutes in ice bath, centrifuging for 20 minutes at 8000r/min to remove sediment, taking supernatant to obtain inclusion body solution, standing overnight at 4 ℃, carrying out renaturation on the solution on ultrafiltration renaturation equipment, changing the solution according to 5-10 volumes, centrifuging for removing sediment after renaturation is finished, collecting supernatant to obtain a required protein solution, adding the protein solution into a chromatographic column at a speed of 0.3ml/min, carrying out linear gradient elution at a speed of 1ml/min by using pH 7.0 phosphate buffer, detecting at a wavelength of 280nm by using an ultraviolet detector, collecting a target elution peak, and filtering and sterilizing by using a filter membrane of 0.22 mu m. And (3) measuring the protein content to be more than or equal to 3.8mg/ml by adopting an ultraviolet spectrophotometry method.

6. Western-blot identification of recombinant proteins

After SDS-PAGE electrophoresis of the recombinant protein, transferring to PVDF membrane by 100V for 70min, washing the membrane for 2 times by TBST, washing the membrane by TBST 3 times after blocking 1% BSA blocking solution for 1.5h at 37 ℃, adding rabbit-derived interferon monoclonal antibody as primary antibody into 1:1000 diluent, incubating overnight at 4 ℃, adding goat anti-rabbit IgG-HRP secondary antibody diluted by 1:4000 after washing the membrane by TBST 3 times, detecting by using DAB chromogenic kit after washing the membrane by TBS 3 times, and inducing the recombinant protein in recombinant bacteria to be 137kd and consistent with the size of CaIFN-alpha-SETD 2 fusion protein, as shown in figure 2.

Example 2 preparation of Long-acting recombinant canine Interferon preparation

In this example, the CaIFN- α -SETD2 fusion protein prepared in example 1 was diluted with phosphate buffer (0.01 mol/L, pH 7.0), and the stabilizer was added at a total volume ratio of 1:10, while methylcellulose was added, and the mixture was stirred well to give a final product of not less than 0.01mg of CaIFN- α -SETD2 fusion protein per ml and a final product of 0.5mg of methylcellulose per ml.

Test example 1, biological Activity assay of rCaIFN-alpha-SETD 2 Long-acting recombinant canine Interferon preparation

1. rCaIFN-alpha-SETD 2 fusion protein preparation dilution

The rCaIFN-. Alpha. -SETD2 fusion protein preparation prepared was diluted to 1000IU per 1ml with assay medium under aseptic conditions, serial dilutions were made 4-fold in 96-well cell culture plates for 10 dilutions, each dilution being made 4 wells.

2. Dilution of reference interferon preparations for control

After dissolving the reference interferon preparation in the indicated amounts under sterile conditions, the assay medium was diluted to 1000IU per 1ml, and 4-fold serial dilutions were made in 96-well cell culture plates for 10 dilutions, each dilution being 2 wells.

3. Measurement method MDCK cells are grown in a culture medium in an adherence way, and the measurement method is carried out 3 times per week, three times and five times, and 1:5 passages and growth with complete medium. Taking cultured cells, discarding culture solution, washing with PBS for 2 times, digesting and collecting cells, and preparing into a solution containing 2.5X10 per ml ⁵ ～3.5×10 ⁵ Cell suspensions of individual cells were seeded in 96-well cell culture plates as shown in FIG. 3, and were prepared by: reference interferon products are used as reference substances, and B1-B10 are the repetition of A1-A10; C1-C10: the tested interferon products, D1-D10, E1-E10 and F1-F10 are the repetition of C1-C10; a11 to E11; MDCK cell control wells; a12 to E12: VSV virus control wells. 100 μl per well, 5% CO at 37deg.C ₂ Incubating for 4-6 h, transferring diluted interferon product to be tested and reference interferon product solution of reference interferon product into culture plate inoculated with MDCK cell, 100 μl each hole, and heating at 37deg.C and 5% CO ₂ Incubating for 24h, discarding supernatant in cell culture plate, diluting preserved vesicular stomatitis virus (VSV, preserved at-70deg.C) with virus eliminating culture solution to 1000TCID ₅₀ Per ml, 100. Mu.l per well, at 37℃in 5% CO ₂ Incubation is carried out for 24 hours (microscopic examination of 50% lesion sites of interferon preparation solution at IU/ml), then supernatant in the cell culture plate is discarded, after each well is added with staining solution and left at room temperature for 30 minutes, the staining solution is carefully flushed with running water, and residual moisture is sucked dry.

4. Observation of dyeing results

And (3) inverting the culture in the incubator for 24 hours under a microscope for observation, firstly observing that 75-100% of obvious lesions appear on cells in the cell control hole and the virus control hole, and when all cells in the normal cell control hole grow well without lesions, indicating that the experimental control system is qualified, otherwise, discarding the rework.

When the CPE in the interferon protection space does not progress any more, the result can be observed, the cell plate cover is opened, the liquid in each hole is discarded in the disinfectant, crystal violet is added for dyeing 1-2 drops/hole, after 3-5 minutes, the residual dyeing liquid in the hole is washed by thin water flow, and the result can be recorded after drying: ++ + + and representing all cytopathy; ++ + representing 75% cytopathy; ++ represents 50% cytopathy; + represents 25% cytopathy. The antiviral activity of interferon was calculated according to the Reed-Muench method.

Experimental example 2, rCaIFN-alpha-SETD 2 preparation in vivo half-life assay in dogs

The rCaIFN-alpha-SETD 2 fusion protein product prepared in the embodiment 1 and the rCaIFN-alpha product without SETD2 are subjected to half-life detection simultaneously, 10 healthy susceptible beagle dogs 50-60 days old are selected and randomly divided into 2 groups, 5 rCaIFN-alpha-SETD 2 and rCaIFN-alpha products are respectively and intramuscularly injected into each group, the injection dosage is 10 ten thousand units per kg body weight, 3 days are used for the same time, 1h, 2h, 4h, 6h, 8h, 12h, 18h, 24h, 30h, 36h, 48h, 60h, 72h and 96h are used for blood sampling after the last injection, and the concentration of recombinant interferon in blood is measured by HPLC (ng/ml) as shown in the table 1.

TABLE 1

Note that: the arithmetic mean of 5 dogs for interferon concentrations is shown in the table.

As shown in fig. 4, the experimental result shows that the concentration of the rCaIFN-alpha-SETD 2 fusion protein product prepared by the invention in the blood of dogs is significantly higher than that of the rCaIFN-alpha product injected at the same time, and the half-life of the rCaIFN-alpha-SETD 2 in vivo is significantly prolonged.

Experimental example 3, rCaIFN-alpha-SETD 2 fusion protein preparation and application thereof in preventing canine viral diseases

Referring to the half-life condition of rCaIFN-alpha-SETD 2 in dogs in test example 2, the rCaIFN-alpha-SETD 2 fusion protein product prepared by the invention and the rCaIFN-alpha product without SETD2 are simultaneously used for preventing canine viral diseases, and the specific test is as follows:

1. canine parvovirus disease prevention test

30 healthy and susceptible beagle dogs of 50-60 days old are selected and divided into 3 groups, 10 beagle dogs are respectively used as an interferon prevention group, rCaIFN-alpha and rCaIFN-alpha-SETD 2 products are respectively and intramuscularly injected, the injection dose is 10 ten thousand units per kg body weight, the injection dose is once daily for 3 days, the 3 rd group is a challenge control group (not prevented), 5 beagle dogs are respectively taken from 4h and 48h after the last interferon prevention injection to carry out a challenge test, and CPV/BJ/19 strains (10 ^6.0 TCID ₅₀ Per ml) of the oral virus solution, 3.0ml of each oral virus solution, and the groups were fed separately under the same conditions, and the clinical symptoms were observed and scored according to the symptom scoring criteria of the enteritis canine parvovirus disease, as shown in table 2.

Results when the rCaIFN-alpha-SETD 2 fusion protein is injected into group dogs for 4 hours to attack viruses, the average score of 5 dogs parvoviruses is 0.8 score; when the virus is attacked for 48 hours, the average score of 5 canine parvoviruses is 2.8 points; when rCaIFN-alpha injection group dogs attack the viruses for 4 hours, the average score of 5 canine parvoviruses is 1.2 points; when the virus is attacked for 48 hours, the average score of 5 canine parvoviruses is 4.4 points; whereas the score of 5 dogs in the challenge control group was 4.6 and 4.4 points, respectively. The test results are shown in Table 3, and the enteritis type canine parvovirus disease is prevented and treated.

The test result shows that the rCaIFN-alpha-SETD 2 fusion protein has better resistance to canine parvovirus, and meanwhile, the half-life of rCaIFN-alpha-SETD 2 in vivo is obviously prolonged.

TABLE 2

TABLE 3 Table 3

Note that: "/" indicates that this is not done.

2. Canine distemper virus disease prevention test

30 healthy susceptible beagle dogs of 50-60 days old are selected and divided into 3 groups, 10 beagle dogs are respectively used, the 1 st group and the 2 nd group are interferon preventive groups, rCaIFN-alpha and rCaIFN-SETD 2 products prepared in the embodiment 1 of the invention are respectively and intramuscularly injected, the injection doses are 10 ten thousand units per kg body weight, the injection dose is used for 3 days every day, the 3 rd group is a virus-attacking control group (not preventive), 5 dogs are respectively taken for carrying out virus-attacking tests 4h and 48h after the last interferon preventive injection, the virulent CDV/BJ/14 strain of canine distemper virus is respectively used for attacking, 2.0ml is inoculated on each nasal drip, and 2.0ml (containing 100 ID) is simultaneously and intramuscular injection is carried out ₅₀ ) The groups were kept separately under the same conditions, clinical symptoms were observed, and the canine distemper virus virulent challenge symptom scoring standard was used for scoring, as shown in table 4, and the canine distemper virus virulent challenge canine symptom scoring table was used.

Results when the rCaIFN-alpha-SETD 2 injection group dogs attack the viruses for 4 hours, the average score of 5 canine distemper viruses is 0.4 score; when the virulence is attacked for 48 hours, the average score of 5 canine distemper viruses is 2.6 points; when rCaIFN-alpha injection group dogs attack the viruses for 4 hours, the average score of 5 canine distemper viruses is 0.6 score; when the virulence is attacked for 48 hours, the average score of 5 canine distemper viruses is 4.6 points; whereas the score of 5 dogs in the challenge control group was 4.6 and 4.8, respectively.

The test result shows that the rCaIFN-alpha-SETD 2 has better resistance to the canine distemper virus, and meanwhile, the half-life of the rCaIFN-alpha-SETD 2 in vivo is obviously prolonged, as shown in Table 5, so that the canine distemper virus can be prevented and treated.

TABLE 4 Table 4

TABLE 5

Note that: "/" indicates that this is not done.

3. Prevention test for canine parainfluenza virus disease

30 healthy and susceptible beagle dogs of 50-60 days old are selected and divided into 3 groups, 10 beagle dogs are selected from each group, the 1 st group and the 2 nd group are interferon preventive groups, the recombinant rCaIFN-alpha of the dogs and the rCaIFN-alpha-SETD 2 product prepared in the embodiment 1 of the invention are respectively intramuscular injected, the injection dose is 10 ten thousand units per kg body weight, 3 days are used for a day, the 3 rd group is a challenge control group (not prevented), 5 beagle dogs are taken from each group 4h and 48h after the last interferon preventive injection to carry out a challenge test, CPIV/QD/16 strain is used for challenge, 1.0ml is inoculated on each nasal drip, and 3.0ml (containing 100 ID) is simultaneously tracheal injected ₅₀ ) The groups were kept separately under the same conditions, clinical symptoms were observed, and the groups were scored according to the canine parainfluenza virulent challenge symptom scoring criteria, as shown in table 6, and the canine parainfluenza virulent challenge canine symptom scoring table.

Results when the rCaIFN-alpha-SETD 2 injection group dogs attack the viruses for 4 hours, the average score of parainfluenza viruses of 5 dogs is 0.8 score; when the virus is attacked for 48 hours, the average score of the parainfluenza viruses of 5 dogs is 2.8 points; when the rCaIFN-alpha injection group dogs attack the viruses for 4 hours, the average score of parainfluenza viruses of 5 dogs is 1.0 score; when the virus is attacked for 48 hours, the average score of the parainfluenza viruses of 5 dogs is 4.6; whereas the score of 5 dogs in the challenge control group was 4.8 and 4.6, respectively.

The test result shows that the recombinant rCaIFN-alpha-SETD 2 has better resistance to canine parainfluenza virus, and meanwhile, the half-life of the rCaIFN-alpha-SETD 2 in vivo is obviously prolonged, as shown in Table 7, so that canine parainfluenza virus diseases can be prevented and treated.

TABLE 6

TABLE 7

Note that: "/" indicates that this is not done.

4. Canine adenovirus 2 prevention test

30 healthy susceptible beagle dogs of 50-60 days old are selected and divided into 3 groups, 10 beagle dogs are selected from each group, the 1 st group and the 2 nd group are interferon preventive groups, the intramuscular injection of gene recombinant canine rCaIFN-alpha and rCaIFN-alpha-SETD 2 products prepared in the embodiment 1 of the invention is carried out, the injection dose is 10 ten thousand units per kg body weight, 3 days are used continuously, the 3 rd group is a challenge control group (not preventive), 5 beagle dogs are taken from each group 4h and 48h after the last interferon preventive injection respectively for carrying out a challenge test, the CAV2/BJ/13 strain is used for challenge, each nasal drip is inoculated with 2.0ml, and 2.0ml of the intramuscular injection is carried out simultaneously (containing 100 ID) ₅₀ ) The groups were kept separately under the same conditions, clinical symptoms were observed, and the canine adenovirus type 2 virulent challenge symptom scoring standard was followed, as shown in table 8, and canine adenovirus type 2 virulent challenge canine symptom scoring table.

Results rCaIFN-alpha-SETD 2 injection group dogs were challenged for 4 hours with an average score of 0.6 for 5 canine adenovirus type 2; at 48h of challenge, 5 canine adenoviruses had an average type 2 score of 2.6 points; when the rCaIFN-alpha injection group dogs attack the viruses for 4 hours, the average score of the adenovirus type 2 of 5 dogs is 0.8 score; at 48h challenge, 5 canine adenoviruses had an average score of 4.4; and the score of 5 dogs in the challenge control group is 4.6 points.

The test result shows that the recombinant rCaIFN-alpha-SETD 2 has better resistance to canine adenovirus type 2, and meanwhile, the half life of rCaIFN-alpha-SETD 2 in vivo is obviously prolonged, as shown in Table 9, the recombinant protein has resistance to canine adenovirus type 2.

TABLE 8

TABLE 9

Note that: "/" indicates that this is not done.

While the invention has been described in detail in the foregoing general description and specific examples, it will be apparent to those skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.

SEQUENCE LISTING

<110> Beijing Bao Yi biotechnology Co., ltd., yi Ji Tai Bao Ying biotechnology Co., ltd., beijing Yi nong biotechnology Co., ltd

<120> a long-acting recombinant canine interferon product, and preparation method and application thereof

<130> GG20803822A

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 1238

<212> PRT

<213> Artificial Sequence

<220>

<223> 00

<400> 1

Met Cys Tyr Leu Ala Asp Thr His Gly Gln Cys Asn Trp Arg Val Leu

1 5 10 15

Thr Leu Leu Gly Gln Met Arg Arg Leu Ser Ala Gly Ser Cys Asp His

20 25 30

Phe Thr Asn Asp Phe Ala Phe Pro Asn Glu Leu Phe Asp Gly Glu Arg

35 40 45

Leu Gln Glu Ala Gln Ala Leu Ser Val Val His Val Met Thr Gln Lys

50 55 60

Val Phe His Leu Phe Cys Pro Asp Thr Ser Ser Ala Pro Trp Asn Met

65 70 75 80

Thr Leu Leu Asp Glu Leu Cys Ser Gly Leu Ser Glu Gln Leu Asp Asp

85 90 95

Leu Glu Ala Cys Pro Leu Gln Glu Ala Gly Gln Ala Glu Thr Pro Leu

100 105 110

Met His Glu Asp Ser Thr Leu Arg Thr Tyr Phe Gln Arg Ile Ser Leu

115 120 125

Asp Leu Gln Asp Arg Asn His Ser Pro Cys Ala Trp Glu Met Val Arg

130 135 140

Ala Glu Ile Gly Arg Ser Tyr Phe Ser Ser Thr Ile Leu Gln Glu Arg

145 150 155 160

Ile Arg Arg Arg Lys Thr Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

165 170 175

Lys Arg Met Gln Cys Glu Cys Thr Pro Leu Ser Lys Asp Glu Arg Ala

180 185 190

Gln Gly Glu Ile Ala Cys Gly Glu Asp Cys Leu Asn Arg Leu Leu Met

195 200 205

Ile Glu Cys Ser Ser Arg Cys Pro Asn Gly Asp Tyr Cys Ser Asn Arg

210 215 220

Arg Phe Gln Arg Lys Gln His Ala Asp Val Glu Val Ile Leu Thr Glu

225 230 235 240

Lys Lys Gly Trp Gly Leu Arg Ala Ala Lys Asp Leu Pro Ser Asn Thr

245 250 255

Phe Val Leu Glu Tyr Cys Gly Glu Val Leu Asp His Lys Glu Phe Lys

260 265 270

Ala Arg Val Lys Glu Tyr Ala Arg Asn Lys Asn Ile His Tyr Tyr Phe

275 280 285

Met Ala Leu Lys Asn Asp Glu Ile Ile Asp Ala Thr Gln Lys Gly Asn

290 295 300

Cys Ser Arg Phe Met Asn His Ser Cys Glu Pro Asn Cys Glu Thr Gln

305 310 315 320

Lys Trp Thr Val Asn Gly Gln Leu Arg Val Gly Phe Phe Thr Thr Lys

325 330 335

Leu Val Pro Ser Gly Ser Glu Leu Thr Phe Asp Tyr Gln Phe Gln Arg

340 345 350

Tyr Gly Lys Glu Ala Gln Lys Cys Phe Cys Gly Ser Ala Asn Cys Arg

355 360 365

Gly Tyr Leu Gly Gly Glu Asn Arg Val Ser Ile Arg Ala Ala Gly Gly

370 375 380

Lys Met Lys Lys Glu Arg Ser Arg Lys Lys Asp Ser Val Asp Gly Glu

385 390 395 400

Leu Glu Ala Leu Met Glu Asn Gly Glu Gly Leu Ser Asp Lys Asn Gln

405 410 415

Val Leu Ser Leu Ser Arg Leu Met Val Arg Ile Glu Thr Leu Glu Gln

420 425 430

Lys Leu Thr Cys Leu Glu Leu Ile Gln Asn Thr His Ser Gln Ser Cys

435 440 445

Leu Lys Ser Phe Leu Glu Arg His Gly Leu Ser Leu Leu Trp Ile Trp

450 455 460

Met Ala Glu Leu Gly Asp Gly Arg Glu Ser Asn Gln Lys Leu Gln Glu

465 470 475 480

Glu Ile Ile Lys Thr Leu Glu His Leu Pro Ile Pro Thr Lys Asn Met

485 490 495

Leu Glu Glu Ser Lys Val Leu Pro Ile Ile Gln Arg Trp Ser Gln Thr

500 505 510

Lys Thr Ala Ile Pro Gln Leu Ser Glu Gly Asp Gly Tyr Ser Ser Glu

515 520 525

Asn Thr Ser Arg Ala His Thr Pro Leu Asn Thr Pro Asp Pro Ser Thr

530 535 540

Lys Leu Ser Thr Glu Ala Asp Thr Asp Thr Pro Lys Lys Leu Met Phe

545 550 555 560

Arg Arg Leu Lys Ile Ile Ser Glu Asn Ser Met Asp Ser Ala Ile Ser

565 570 575

Asp Ala Thr Ser Glu Leu Glu Gly Lys Asp Gly Lys Glu Asp Leu Asp

580 585 590

Gln Leu Glu Asn Val Pro Ile Glu Glu Glu Glu Glu Leu Gln Ser Gln

595 600 605

Gln Leu Leu Thr Gln Gln Leu Pro Glu Ser Lys Val Glu Ser Glu Ile

610 615 620

Thr Val Glu Ala Ser Lys Leu Pro Thr Thr Glu Pro Glu Ala Asp Thr

625 630 635 640

Glu Ile Glu Pro Lys Glu Gly Asn Gly Thr Lys Leu Glu Glu Thr Ile

645 650 655

Ala Glu Glu Thr Pro Ser Gln Asp Glu Glu Glu Gly Val Ser Asp Val

660 665 670

Glu Ser Glu Arg Ser Gln Glu Gln Pro Asp Lys Thr Val Asp Ile Ser

675 680 685

Asp Leu Ala Thr Lys Leu Leu Asp Ser Trp Lys Asp Leu Lys Glu Val

690 695 700

Tyr Arg Ile Pro Lys Lys Ser Gln Thr Glu Lys Glu Asn Thr Ile Thr

705 710 715 720

Glu Arg Gly Arg Asp Ala Val Gly Phe Arg Asp Gln Thr Ala Ala Pro

725 730 735

Lys Thr Pro Asn Arg Ser Arg Glu Arg Asp Pro Asp Lys Gln Thr Gln

740 745 750

Asn Lys Glu Lys Arg Lys Arg Arg Gly Ser Leu Ser Pro Pro Ser Ser

755 760 765

Ala Tyr Glu Arg Gly Thr Lys Arg Pro Asp Asp Arg Tyr Asp Thr Pro

770 775 780

Thr Ser Lys Lys Lys Val Arg Ile Lys Asp Arg Asn Lys Leu Ser Thr

785 790 795 800

Glu Glu Arg Arg Lys Leu Phe Glu Gln Glu Val Ala Gln Arg Glu Ala

805 810 815

Gln Lys Gln Gln Gln Gln Met Gln Thr Leu Gly Met Thr Ser Pro Leu

820 825 830

Pro Tyr Asp Ser Leu Gly Tyr Asn Ala Pro His His Pro Phe Ala Gly

835 840 845

Tyr Pro Pro Gly Tyr Pro Met Gln Ala Tyr Val Asp Pro Ser Asn Pro

850 855 860

Asn Ala Gly Lys Val Leu Leu Pro Thr Pro Ser Met Asp Pro Val Cys

865 870 875 880

Ser Pro Ala Pro Tyr Asp His Ser Gln Pro Leu Val Gly His Ser Thr

885 890 895

Glu Pro Leu Ala Ala Pro Pro Pro Val Pro Val Val Pro His Val Ala

900 905 910

Ala Pro Val Glu Val Ser Ser Ser Gln Tyr Val Ala Gln Asn Asp Gly

915 920 925

Val Val His Gln Asp Ser Ser Val Thr Val Leu Pro Val Pro Ala Pro

930 935 940

Gly Pro Val Gln Gly Gln Asn Tyr Gly Val Trp Asp Ser Asn Gln Gln

945 950 955 960

Ser Val Ser Val Gln Gln Gln Tyr Ser Pro Ala Gln Ser Gln Ala Thr

965 970 975

Ile Tyr Tyr Gln Gly Gln Thr Cys Pro Thr Val Tyr Gly Val Thr Ser

980 985 990

Pro Tyr Ser Gln Thr Thr Pro Pro Ile Val Gln Ser Tyr Ala Gln Pro

995 1000 1005

Ser Leu Gln Tyr Ile Gln Gly Gln Gln Ile Phe Thr Ala His Pro

1010 1015 1020

Gln Gly Val Val Val Gln Pro Ala Thr Ala Val Thr Thr Ile Val

1025 1030 1035

Ala Pro Gly Gln Pro Gln Pro Leu Gln Pro Pro Glu Met Val Val

1040 1045 1050

Thr Asn Asn Leu Leu Asp Leu Pro Pro Pro Ser Pro Pro Lys Pro

1055 1060 1065

Lys Thr Ile Val Leu Pro Pro Asn Trp Lys Thr Ala Arg Asp Pro

1070 1075 1080

Glu Gly Lys Ile Tyr Tyr Tyr His Val Ile Thr Arg Gln Thr Gln

1085 1090 1095

Trp Asp Pro Pro Thr Trp Glu Ser Pro Gly Asp Asp Ala Ser Leu

1100 1105 1110

Glu His Glu Ala Glu Met Asp Leu Gly Thr Pro Thr Tyr Asp Glu

1115 1120 1125

Asn Pro Met Lys Thr Ser Lys Lys Pro Lys Thr Ala Glu Ala Asp

1130 1135 1140

Thr Ser Ser Glu Leu Ala Lys Lys Ser Lys Glu Val Phe Arg Lys

1145 1150 1155

Glu Met Ser Gln Phe Ile Val Gln Cys Leu Asn Pro Tyr Arg Lys

1160 1165 1170

Pro Asp Cys Lys Val Gly Arg Ile Thr Thr Thr Glu Asp Phe Lys

1175 1180 1185

His Leu Ala Arg Lys Leu Thr His Gly Val Met Asn Lys Glu Leu

1190 1195 1200

Lys Tyr Cys Lys Asn Pro Glu Asp Leu Glu Cys Asn Glu Asn Val

1205 1210 1215

Lys His Lys Thr Lys Glu Tyr Ile Lys Lys Tyr Met Gln Lys Phe

1220 1225 1230

Gly Ala Val Tyr Lys

1235

<210> 2

<211> 3717

<212> DNA

<213> Artificial Sequence

<220>

<223> 00

<400> 2

atgtgctacc tggcggacac ccacggtcag tgtaactggc gtgttctgac cctgctgggt 60

cagatgcgtc gtctgtctgc tggttcttgc gaccacttca ccaacgactt cgctttcccg 120

aatgaactgt tcgacggtga gcgtctgcag gaagctcagg ctctgtctgt tgttcacgtt 180

atgacccaga aagttttcca cctgttctgc ccggacacct cttctgctcc gtggaacatg 240

accctgctgg atgaactgtg ctctggtctg tctgaacagc tggacgacct ggaagcttgc 300

ccgctgcagg aagctggtca ggctgaaacc ccgctgatgc acgaagactc taccctgcgt 360

acctacttcc agcgtatctc tctggacctg caggaccgta accactctcc gtgcgcttgg 420

gaaatggttc gtgctgaaat cggtcgttct tacttctctt ctaccatcct gcaggaacgt 480

atccgtcgtc gtaaaacggg cggcggcggc agcggcggcg gcggcagcat gaaacgtatg 540

cagtgcgaat gcaccccgct gtctaaagac gaacgtgctc agggtgaaat cgcttgcggt 600

gaagactgcc tgaaccgtct gctgatgatc gaatgctctt ctcgttgccc gaacggtgac 660

tactgctcta accgtcgttt ccagcgtaaa cagcacgctg acgttgaagt tatcctgacc 720

gaaaaaaaag gttggggtct gcgtgctgct aaagacctgc cgtctaacac cttcgttctg 780

gaatactgcg gtgaagttct ggaccacaaa gaattcaaag ctcgtgttaa agaatacgct 840

cgtaacaaaa acatccacta ctacttcatg gctctgaaaa acgacgaaat catcgacgct 900

acccagaaag gtaactgctc tcgtttcatg aaccactctt gcgaaccgaa ctgcgaaacc 960

cagaaatgga ccgttaacgg tcagctgcgt gttggtttct tcaccaccaa actggttccg 1020

tctggttctg aactgacctt cgactaccag ttccagcgtt acggtaaaga agctcagaaa 1080

tgcttctgcg gttctgctaa ctgccgtggt tacctgggtg gtgaaaaccg tgtttctatc 1140

cgtgctgctg gtggtaaaat gaaaaaagaa cgttctcgta aaaaagactc tgttgacggt 1200

gaactggaag ctctgatgga aaacggtgaa ggtctgtctg acaaaaacca ggttctgtct 1260

ctgtctcgtc tgatggttcg tatcgaaacc ctggaacaga aactgacctg cctggaactg 1320

atccagaaca cccactctca gtcttgcctg aaatctttcc tggaacgtca cggtctgtct 1380

ctgctgtgga tctggatggc tgaactgggt gacggtcgtg aatctaacca gaaactgcag 1440

gaagaaatca tcaaaaccct ggaacacctg ccgatcccga ccaaaaacat gctggaagaa 1500

tctaaagttc tgccgatcat ccagcgttgg tctcagacca aaaccgctat cccgcagctg 1560

tctgaaggtg acggttactc ttctgaaaac acctctcgtg ctcacacccc gctgaacacc 1620

ccggacccgt ctaccaaact gtctaccgaa gctgacaccg acaccccgaa aaaactgatg 1680

ttccgtcgtc tgaaaatcat ctctgaaaac tctatggact ctgctatctc tgacgctacc 1740

tctgaactgg aaggtaaaga cggtaaagaa gacctggacc agctggaaaa cgttccgatc 1800

gaagaagaag aagaactgca gtctcagcag ctgctgaccc agcagctgcc ggaatctaaa 1860

gttgaatctg aaatcaccgt tgaagcttct aaactgccga ccaccgaacc ggaagctgac 1920

accgaaatcg aaccgaaaga aggtaacggt accaaactgg aagaaaccat cgctgaagaa 1980

accccgtctc aggacgaaga agaaggtgtt tctgacgttg aatctgaacg ttctcaggaa 2040

cagccggaca aaaccgttga catctctgac ctggctacca aactgctgga ctcttggaaa 2100

gacctgaaag aagtttaccg tatcccgaaa aaatctcaga ccgaaaaaga aaacaccatc 2160

accgaacgtg gtcgtgacgc tgttggtttc cgtgaccaga ccgctgctcc gaaaaccccg 2220

aaccgttctc gtgaacgtga cccggacaaa cagacccaga acaaagaaaa acgtaaacgt 2280

cgtggttctc tgtctccgcc gtcttctgct tacgaacgtg gtaccaaacg tccggacgac 2340

cgttacgaca ccccgacctc taaaaaaaaa gttcgtatca aagaccgtaa caaactgtct 2400

accgaagaac gtcgtaaact gttcgaacag gaagttgctc agcgtgaagc tcagaaacag 2460

cagcagcaga tgcagaccct gggtatgacc tctccgctgc cgtacgactc tctgggttac 2520

aacgctccgc accacccgtt cgctggttac ccgccgggtt acccgatgca ggcttacgtt 2580

gacccgtcta acccgaacgc tggtaaagtt ctgctgccga ccccgtctat ggacccggtt 2640

tgctctccgg ctccgtacga ccactctcag ccgctggttg gtcactctac cgaaccgctg 2700

gctgctccgc cgccggttcc ggttgttccg cacgttgctg ctccggttga agtttcttct 2760

tctcagtacg ttgctcagaa cgacggtgtt gttcaccagg actcttctgt taccgttctg 2820

ccggttccgg ctccgggtcc ggttcagggt cagaactacg gtgtttggga ctctaaccag 2880

cagtctgttt ctgttcagca gcagtactct ccggctcagt ctcaggctac catctactac 2940

cagggtcaga cctgcccgac cgtttacggt gttacctctc cgtactctca gaccaccccg 3000

ccgatcgttc agtcttacgc tcagccgtct ctgcagtaca tccagggtca gcagatcttc 3060

accgctcacc cgcagggtgt tgttgttcag ccggctaccg ctgttaccac catcgttgct 3120

ccgggtcagc cgcagccgct gcagccgccg gaaatggttg ttaccaacaa cctgctggac 3180

ctgccgccgc cgtctccgcc gaaaccgaaa accatcgttc tgccgccgaa ctggaaaacc 3240

gctcgtgacc cggaaggtaa aatctactac taccacgtta tcacccgtca gacccagtgg 3300

gacccgccga cctgggaatc tccgggtgac gacgcttctc tggaacacga agctgaaatg 3360

gacctgggta ccccgaccta cgacgaaaac ccgatgaaaa cctctaaaaa accgaaaacc 3420

gctgaagctg acacctcttc tgaactggct aaaaaatcta aagaagtttt ccgtaaagaa 3480

atgtctcagt tcatcgttca gtgcctgaac ccgtaccgta aaccggactg caaagttggt 3540

cgtatcacca ccaccgaaga cttcaaacac ctggctcgta aactgaccca cggtgttatg 3600

aacaaagaac tgaaatactg caaaaacccg gaagacctgg aatgcaacga aaacgttaaa 3660

cacaaaacca aagaatacat caaaaaatac atgcagaaat tcggtgctgt ttacaaa 3717

<210> 3

<211> 40

<212> DNA

<213> Artificial Sequence

<220>

<223> 00

<400> 3

ggcggcggcg gcagcggcgg cggcggcagc 30

Claims

1. A preparation method of long-acting recombinant canine interferon is characterized by comprising the steps of connecting canine alpha-interferon genes with canine SETD2 genes through a linker to form fusion genes encoding CaIFN-alpha-SETD 2, and introducing the fusion genes of the CaIFN-alpha-SETD 2 into escherichia coli through enzyme digestion and connection to obtain recombinant expression bacteria, wherein the recombinant expression bacteria can induce expression of the CaIFN-alpha-SETD 2 fusion proteins.

2. The method for preparing long-acting recombinant canine interferon according to claim 1, wherein,

the fusion gene of the CaIFN-alpha-SETD 2 is shown as SEQ ID NO:2, and a sequence shown in seq id no.

3. The method for preparing long-acting recombinant canine interferon according to claim 1, wherein,

the CaIFN-alpha-SETD 2 fusion gene is introduced into the escherichia coli through a recombinant expression vector pET-CaIFN-alpha-SETD 2;

the recombinant expression vector pET-CaIFN-alpha-SETD 2 is a vector obtained by replacing a small fragment between XhoI and NdeI enzyme cutting sites with a DNA molecule of the CaIFN-alpha-SETD 2 fusion gene.

4. The method for preparing long-acting recombinant canine interferon according to claim 1, wherein,

the nucleotide sequence of the linker is shown as SEQ ID NO: 3.

5. The method for producing a long-acting recombinant canine interferon according to claim 3,

the escherichia coli is BL21.

6. The method for preparing long-acting recombinant canine interferon according to claim 1, wherein,

inoculating the recombinant expression bacteria into LB culture medium containing 30 mug/ml kanamycin, and performing shake culture at 37 ℃ for overnight at 200 r/min;

7. A long-acting recombinant canine interferon preparation comprising a stabilizer, methylcellulose, and the cain- α -SETD2 fusion protein prepared by the method of claims 1-5.

8. Use of a long-acting recombinant canine interferon prepared by the method of any one of claims 1-6 in the preparation of a product against canine viral disease, wherein the canine virus is canine parvovirus, canine distemper virus, canine parainfluenza virus or canine adenovirus disease.