CN112125968B

CN112125968B - Japanese frog skin antioxidant peptide anti-NV and gene and application thereof

Info

Publication number: CN112125968B
Application number: CN202010799720.4A
Authority: CN
Inventors: 木丽仙; 武静; 杨海龙; 冯贵珠; 石洁; 刘瑾; 米鍇; 沈艳
Original assignee: Kunming Medical University
Current assignee: Kunming Medical University
Priority date: 2020-08-11
Filing date: 2020-08-11
Publication date: 2023-05-12
Anticipated expiration: 2040-08-11
Also published as: CN112125968A

Abstract

The invention relates to an anti-oxidation peptide anti-NV of rana ventricosa (Nanorana ventripunctata) skin and a gene and application thereof, belonging to the field of biomedicine. The skin antioxidant peptide anti-NV is a polypeptide coded by a quasipaa ventricosa defending peptide gene of a special species of Chinese amphibian, has a molecular weight of 1963.7 daltons, an isoelectric point of 9.31, and an amino acid sequence of the polypeptide is shown as SEQ ID NO. 1. The gene for encoding the bullfrog skin antioxidant peptide anti-NV precursor consists of 299 nucleotide sequences, and the nucleotide sequences are shown in SEQ ID NO. 2; wherein the 156 th to 216 th nucleotide is the coding gene of mature bullfrog skin antioxidant peptide anti-NV. The application of the bullfrog skin antioxidant peptide anti-NV in preparing the anti-skin photoaging therapeutic drug. The beneficial effects are that: has strong skin photoaging resistance and can obviously inhibit the occurrence of skin photoaging.

Description

Japanese frog skin antioxidant peptide anti-NV and gene and application thereof

Technical Field

The invention relates to a bullfrog (Nanorana ventripunctata) skin antioxidant peptide anti-NV and a gene and application thereof, belonging to the field of biomedicine. .

Background

Skin photoaging (Skin photoaging) refers to a characteristic change in Skin structure and function due to repeated exposure of the Skin to ultraviolet light, characterized by premature aging of the Skin, multiple wrinkles, rough leather-like, pigmentation, telangiectasia, accompanying precancerous lesions and malignant tumors. The photo-aging not only seriously affects the appearance of the skin of a patient and greatly reduces the life quality of the patient, but also can induce malignant tumors of the skin (such as malignant melanoma, basal cell carcinoma, squamous carcinoma and the like) [1], in recent years, the incidence rate of the photo-aging of the skin is sharply increased due to the fact that the ultraviolet rays radiated to the surface of the earth are gradually increased due to the destruction of an atmospheric ozone layer, and the huge medical cost of global treatment of severe photo-aging of the skin and the skin cancer induced thereby amounts to over 291 hundred million dollars each year in 2015, wherein the U.S. is up to 114 hundred million dollars [1], so that how to effectively prevent and treat the photo-aging of the skin caused by the ultraviolet rays is sought, and the problem to be solved is that a novel high-efficiency antioxidant drug which is safe, low in the prevention and treatment of the photo-aging process is sought.

Amphibious animals are the most important resources in the development of bioactive polypeptide resources, the skin of the amphibious animals is exposed, and the amphibious animals can secrete various bioactive polypeptides with novel molecular structures and complex and diverse functions in order to resist various severe environments in the environment. The active polypeptide is widely involved in various physiological activities of organisms, and has various pharmacological activities such as antimicrobial, antitumor, antioxidant, immunoregulatory, wound repair, analgesic and the like. At present, screening of certain pharmacologically active monomeric compounds from amphibian skin is a hotspot of new drug inventions. According to the reports of domestic and foreign documents, different active polypeptides have been isolated from various biological sources, and some have entered a clinical stage. The rana spinosa has a very harsh living environment compared with other frog animals, and has long-time continuous sunlight irradiation, strong ultraviolet radiation, and climatic characteristics of cold plateau, hypoxia at low pressure, dryness and strong wind. This specific harsh ecological environment makes them subject to internal and external stress factors and external microbial attack different from other amphibians. The special Gao Yuanjiang uv environment necessarily gives this species special substances to accommodate this harsh environment. The rana ventricosa (Nanorana ventripunctata) is an amphibian of rana genus of Ranidae of Americaceae of America of class of amphibian, is a special species of China, is a special species of Qinghai-Tibet plateau, and has no report on the effect of antioxidant peptide in skin secretion to resist skin photoaging.

Disclosure of Invention

The invention aims to provide a novel bullfrog (Nanorana ventripunctata) skin antioxidant peptide anti-NV with a strong skin photoaging resisting effect, and a gene and application thereof.

The skin antioxidant peptide anti-NV is a polypeptide coded by a rana ventricosa defending peptide gene of a special species of Chinese amphibian, has a molecular weight of 1963.7 daltons, an isoelectric point of 9.31, and a full-sequence primary structure (amino acid sequence SEQ ID NO: 1) of the polypeptide is as follows:

the encoding gene of the skin antioxidant peptide precursor consists of 299 nucleotides (SEQ ID NO: 2), and the sequence from the 5 'end to the 3' end is as follows:

wherein, the 156 th to 216 th nucleotide is the coding gene of mature skin antioxidant peptide anti-NV.

The application of the skin antioxidant peptide anti-NV in preparing the anti-skin photoaging therapeutic drug is provided.

The invention has the beneficial effects that: the bullfrog skin antioxidant peptide has the advantages of obvious skin photoaging resistance, capability of obviously inhibiting the occurrence of skin photoaging, and capability of being applied to preparation of skin photoaging resistance therapeutic drugs.

Drawings

FIG. 1 shows the purification of bullfrog skin secretions using reverse phase high pressure liquid phase separation, with arrows indicating components with anti-skin photoaging properties.

FIG. 2 shows the further purification of this fraction using a reversed phase high pressure liquid phase, with the arrow indicating the purified skin antioxidant peptide, anti-NV.

FIG. 3 shows that the bullfrog skin antioxidant peptide anti-NV has extremely strong skin photoaging resistance.

Detailed Description

The present invention will be described in detail with reference to the accompanying drawings.

1. Preparation and amino acid sequence determination of bullfrog skin antioxidant peptide anti-NV

1. Collecting skin secretion of bullfrog

The live bullfrog is cleaned by water and placed in a cylinder sample bottle with the diameter of 10 cm and the height of 10 cm. After 2 minutes of ether stimulation, the frog-back foam liquid was rinsed with 10ml of 0.1M Phosphate Buffer Solution (PBS) pH 6.0. The secretion was centrifuged at 12000rpm at 4℃for 15 minutes, and the supernatant was stored at-80 ℃.

2. Isolation and purification of the antioxidant peptide anti-NV from the skin of the bullfrog

The collected supernatant is used as a raw material, the rana ventricosa skin antioxidant peptide, namely the antioxidant peptide-NV, is purified according to the following procedure, and each component which is separated and purified is subjected to antioxidant and skin photoaging resistance detection, and the specific method is as follows:

(a) By Millipore Co., USA

The ultrafiltration tube removes substances with a molecular weight of more than 10kDa from the supernatant. Adding the supernatant into->

The first centrifugation (3000 Xg, 40 min) was performed in a ultrafiltration tube (10 kDa,15 ml), the filtrate was collected, the second centrifugation (3000 Xg, 10 min) was performed, the filtrate was collected, the third centrifugation (3000 Xg, 5 min) was performed, and the remaining filtrate was collected and stored at-20 ℃.

(b) The filtrate is reversed phase high pressure liquid phase (RP-HPLC) C ₁₈ Purifying with chromatographic column by eluting with linear gradient of 0-80% acetonitrile (0.7 ml/min) in 2795 quaternary gradient high performance liquid chromatograph (Waters Co., USA)The eluted components were pooled as shown in FIG. 1, and the antioxidant and anti-skin photoaging activities were measured. The fractions with antioxidant and anti-skin photoaging activity, indicated by the arrows in FIG. 1, were lyophilized and continued to be used with RP-HPLC C ₁₈ Further purification by chromatography column gave purified bullfrog skin antioxidant peptide anti-NV as shown by arrow in FIG. 2.

3. Amino acid determination of the antioxidant peptide anti-NV of the skin of the Borana ventricosa

Purified bullfrog skin antioxidant peptide, anti-NV, was sequenced by Edman degradation, a procedure which was carried out in Proscise from ABI, USA ^TM 491 protein sequencer. Sequencing results show that the full sequence primary structure of the bullfrog skin antioxidant peptide is as follows: GWANTLKNVAGGLCKMTGAA.

2. Cloning of the antioxidant peptide anti-NV Gene of the Borana ventricosa skin

1. Extraction of total RNA from skin of bullfrog

The live bullfrog is washed with water, put into liquid nitrogen for quick freezing for 10 hours, 300mg of skin tissue is taken, 3ml of Trizol solution is added, and homogenized in a 20ml glass homogenizer for 30 minutes. An equal volume of phenol/chloroform solution was added, vigorously mixed, left at room temperature for 10 minutes, centrifuged at 12000rpm for 10 minutes at 4℃and the precipitate discarded. Adding isopropyl alcohol into the supernatant, standing at room temperature for 10 minutes, centrifuging at 12000rpm for 10 minutes at 4 ℃, washing the precipitate once with 75% ethanol, and airing to obtain the tube bottom precipitate, namely the total RNA of the bullfrog skin.

2. Purification of mRNA from skin of bullfrog

mRNA was isolated and purified by PROMEGA, inc. of America

mRNA Isolation Systems kit.

The extracted total RNA of the skin of Bungarus fasciatus was dissolved in 500. Mu.l of DEPC water, placed in a water bath at 65℃for 10 minutes, 3. Mu.l of Oligo (dT) probe and 13. Mu.l of 20 XSSC solution were added, and the mixture was left to stand at room temperature for cooling, thereby obtaining solution A. The beads (SA-PMP) were flicked and mixed until the beads were adsorbed on the magnetic rack for 30 seconds, the supernatant was discarded, 0.5 XSSC was added for 0.3m1 to the magnetic rack for 30 seconds, and finally 0.1ml of 0.5 XSSC was added for suspension, referred to as solution B. Adding solution A into solution B, standing at room temperature for 10 min until the solution A is adsorbed by a magnetic frame for 30 seconds, discarding the supernatant, washing with 0.1 XSSC for 4 times, discarding the supernatant, adding 0.1ml of DEPC water for suspension until the solution B is adsorbed by the magnetic frame for 30 seconds, transferring the supernatant to a new test tube, adding 0.15m of DEPC water for re-suspension until the solution B is adsorbed by the magnetic frame for 30 seconds, and transferring the supernatant to the test tube, wherein the supernatant is purified abdominal macula, frog skin mRNA. 1/10 volume of 3M sodium acetate, pH5.2, equal volume of isopropanol, was added, and the mixture was left at-70℃for 30 minutes, 4℃and 12000rpm for 10 minutes, the supernatant was discarded, and the precipitate was dissolved in 10. Mu.l of DEPC water.

3. Construction of cDNA library of bullfrog skin

By using a Creator from CLONTECH company ^TM SMART ^TM cDNA Library Construction Kit plasmid cDNA library construction kit.

(a) First strand cDNA Synthesis (mRNA reverse transcription)

Mu.l of bullfrog skin mRNA, 1. Mu.l of SMART IV oligonucleotide, 1. Mu.l of CDS III/3' PCR primer and 2. Mu.l of deionized water were added to a 0.5ml sterile centrifuge tube to bring the total volume to 5. Mu.l. The reagents in the centrifuge tube were mixed and centrifuged at 12000rpm for 15 seconds and incubated at 72℃for 2 minutes. The tubes were incubated on ice for 2 minutes. Into the centrifuge tube were added 2.0. Mu.l of 5 Xfirst strand buffer, 1.0. Mu.l of 20mM dithiothreitol, 1.0. Mu.l of 10mM dNTP mix, 1.0. Mu.l of PowerScript reverse transcriptase. The reagents in the centrifuge tubes were mixed and centrifuged at 12000rpm for 15 seconds and incubated at 42℃for 1 hour. Place the centrifuge tube on ice to stop first strand synthesis. Mu.l of the first strand of cDNA synthesized was removed from the tube and used.

(b) Amplification of the second strand by Long terminal polymerase chain reaction (LD-PCR) method

The PCR instrument was pre-warmed at 95℃and 2. Mu.l of cDNA first strand (mRNA reverse transcribed), 80. Mu.l of deionized water, 10. Mu.l of 10 XAdvantage 2PCR buffer, 2. Mu.l of 50 XdNTP mix, 2. Mu.l of 5'PCR primer, 2. Mu.l of CDS III/3' PCR primer, and 2. Mu.l of E.coli polymerase centrifuge tube were reacted. Amplification in a PCR instrument was performed as follows: 95 ℃ for 20 seconds; 22 cycles (95 ℃,5 seconds; 68 ℃,6 minutes). After the cycle was completed, cDNA double strand synthesized in the centrifuge tube was recovered.

(c) PCR product recovery

By PROMEGA Co

SV Gel and PCR Clean-Up System kit is extracted and recovered, and the steps are as follows:

adding the cDNA double chain obtained by PCR into an equal volume of membrane binding buffer, mixing, transferring the mixed solution into a centrifugal purification column, standing for 5 minutes at room temperature, and making the DNA fully bind with the silica gel membrane. Centrifuge at 12000rpm for 30 seconds, pour the waste liquid from the collection tube. Mu.l of the eluate (containing ethanol) was added to the centrifugal purification column, and the column was centrifuged at 12000rpm for 30 seconds to discard the waste liquid in the collection tube. And (5) repeating the step 2. Centrifuge at 12000rpm for 5 minutes and place the spin purification column into a new centrifuge tube. 30. Mu.l of ultrapure water was added thereto, and the mixture was allowed to stand at room temperature for 5 minutes. Centrifuging at 12000rpm for 30 seconds, and obtaining the bottom solution which is the purified cDNA double strand.

(d) Preparation of E.coli DH 5. Alpha. Competent cells

Single DH5 alpha colonies are picked up, inoculated into 3ml of Luria-Bertani (LB) medium without ampicillin, cultured overnight at 37 ℃, the bacterial liquid is taken out the next day according to the proportion of 1:100, and then inoculated into 50ml of LB medium, and oscillated for 2 hours at 37 ℃. When OD is ₆₀₀ When the value reached 0.35, bacterial cultures were harvested. Bacteria were transferred to a sterile, single-use, 50m1 polypropylene tube pre-chilled with ice, and the culture was allowed to cool to 0 ℃ for 10 minutes above ice. Cells were recovered by centrifugation at 4100rpm for 10 minutes at 4 ℃. The broth was decanted and the tube inverted lmin to drain the last traces of broth. 0.1mol/LCaCl pre-chilled per 50ml initial broth and 30ml ₂ -MgCl ₂ Solution (80 mmol/L MgCl) ₂ ,20mmol/L CaCl ₂ ) Each cell pellet was resuspended. Cells were recovered by centrifugation at 4100rpm for 10 minutes at 4 ℃. The broth was decanted and the tube was inverted for l minutes to drain the last traces of broth. 0.1mol/L CaCl pre-chilled with ice with 2m1 per 50m1 initial culture ₂ And re-suspending each cell sediment, and sub-packaging for later use.

(e) Cleavage, ligation and conversion of ligation products

Mu.l of Takara pMD18-T vector, 4. Mu.l of double-stranded bullfrog cDNA solution were added to the microcentrifuge tube, and the total amount was 5. Mu.l. Mu.l (equal amount) of the ligase buffer mixture was added. The reaction was carried out at 16℃for 2 hours. A total of 10. Mu.l was added to 100. Mu.l DH 5. Alpha. Competent cells and left in ice for 30 minutes. After heating at 42℃for 90 seconds, the mixture was left in ice for 1 minute. 890. Mu.l of LB medium incubated at 37℃was added thereto, and the mixture was incubated with slow shaking at 37℃for 60 minutes. 200. Mu.l of the mixture was plated on LB medium containing X-Gal, IPTG, amp and cultured at 37℃for 16 hours to form single colonies. Each LB plate was washed with 5ml of LB liquid medium and frozen with 30% glycerol. The cDNA constructed approximately contained 1X 10 ⁶ Individual clones.

4. Clone screening of antioxidation peptide gene of bullfrog skin

The amplification primer sequence is 5 'AAGCAGTGGTATCACGCAGGAGT 3', and the PCR another amplification primer is SMART of CLONTECH company ^TM cDNA Library Construction Kit, the 3' PCR Primer has the sequence 5'ATTCTAGAGGCCGAGGCGGCCGACATG 3'. The PCR reaction was performed under the following conditions: 94℃for 30 seconds; 52 ℃,45 seconds; at 72℃for 2 minutes 30 seconds, for a total of 35 cycles. The constructed bacterial cDNA library was first titrated and then diluted to the appropriate bacterial concentration (approximately 5000 bacteria/ml, and 30 bacteria/ml for the second round of screening, respectively) with LB medium containing 100. Mu.g/ml ampicillin, plated in an 8X 8 matrix (total 64 wells, 100. Mu.l per well) on 96 well plates and incubated overnight at 37 ℃. Bacterial culture solutions are respectively combined according to rows and columns, 10 samples are subjected to PCR identification, and the bacterial samples with the crossed positive holes enter a second round of screening.

5. Determination of gene sequence of antioxidant peptide of rana ventricosa skin

Extracting plasmid DNA, determining nucleotide sequence by dideoxy method, using full-automatic nucleotide sequence determination instrument of U.S. Applied Biosystems373A, sequencing primer BcaBEST ^TM Sequencing Primer RV-M and BcaBEST ^TM Sequencing Primer M13-47，BcaBEST ^TM Sequencing Primer RV-M sequence: 5`GAGCGGATAACAATTTCAC ACAGG 3', bcaBEST ^TM Sequencing Primer M13-47：5’CGCCAGGGTTTTC CCAGTCACGAC 3’。

The gene sequencing result shows that the gene for encoding the rana ventricosa skin antioxidant peptide precursor consists of 299 nucleotides (SEQ ID NO: 2), and the sequence from the 5 'end to the 3' end is as follows:

wherein, the 156 th to 216 th nucleotide is the coding gene of the antioxidant peptide anti-NV of the skin of the mature bonbonito frog.

3. Application of rana ventricosa skin antioxidant peptide anti-NV in preparation of skin photoaging resisting therapeutic drugs

The hairless mice were randomly divided into normal control group (no uv UVB irradiation), UVB model group (uv UVB irradiation with PBS), anti-ioxidin-NV group (UVB irradiation + anti-ioxidin-NV group, uv UVB irradiation with anti-ioxidin-NV treatment), positive drug control group (UVB irradiation + vitamin C group, uv UVB irradiation with vitamin C treatment). The normal control group and UVB model group are coated on the back of hairless mice, PBS solution, an anti-oxidation dinv group and a positive drug control group are coated on the back of hairless mice respectively, 40 mu l of skin antioxidant peptide anti-oxidation dinv and vitamin C (the concentration is 200 mu g/ml) which are dissolved in the PBS solution are coated on the back of hairless mice respectively, then the hairless mice are placed at a position which is 50cm under a UVB light source, the rest groups are irradiated once a day except the normal control group for the first week, the total irradiation dose of the UVB is 100mJ/cm ² After week 2, the other groups were irradiated with UVB once every other day except the normal control group, each UVB irradiation dose was 200mJ/cm ² For a total of 12 weeks.

The results are shown in FIG. 3: after 12 weeks of UVB irradiation, the back irradiated area of the model group hairless mice was visually observed, and typical skin photoaging skin phenomena occurred: manifesting as progressive loss of elasticity, thickening and darkening of wrinkles, appearance of leather-like appearance, accompanied by photo-aging changes such as desquamation; the skin of the normal group has normal color and luster and good elasticity, and the photo-aging change of the skin after the skin antioxidant peptide anti-NV is given is obviously lighter than that of the model group, and the photo-aging resistance effect is even stronger than that of the vitamin C group. Further histologically observing pathological changes of the skin of the photo-aging model of the hairless mice, wherein the epidermis of the model group is obviously thickened, and the epidermis process and the dermal papilla disappear; dermal fibrosis, disorder of arrangement, maldistribution or rarefaction. The normal group of epidermis cells are orderly arranged, the dermis layer can be provided with wavy fiber tissue, the arrangement is orderly, the distribution is even, the density is low, and the cell component quantity is moderate. And after the antioxidant peptide of the skin, namely the antioxidant peptide-NV is given, the thickness of epidermis and collagen fibrosis are less than those of a model group and a vitamin C group.

The experimental results show that: the skin antioxidant peptide anti-NV has stronger effect of resisting skin photoaging, the effect of the skin photoaging resisting effect is better than that of vitamin C (see figure 3 for details).

SEQUENCE LISTING

<110> university of Kunming medical science

<120> frog skin antioxidant peptide anti-NV and gene and application thereof

<130> 2020-6-29

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 20

<212> PRT

<213> Nanorana N. ventripunctata

<400> 1

Gly Trp Ala Asn Thr Leu Lys Asn Val Ala Gly Gly Leu Cys Lys Met

1 5 10 15

Thr Gly Ala Ala

20

<210> 2

<211> 299

<212> DNA

<213> Nanorana N. ventripunctata

<400> 2

atgttcacct tgaagaagtc cctgttcctg gttttctttc tggggatggt ctccttatct 60

ctctgcaggt ctgagagcca cgcccatgaa gagtccagca ctgatcccac agaggaggaa 120

aatgcagccg aaaatgagga aagcgtagag aaaagaggct gggccaatac actaaagaac 180

gttgctggtg gattgtgtaa aatgactggg gctgcttgat tgcgaattgg aatcctaaac 240

agatgtctaa taaaacagca aaattaattc aaaaaaaaaa aaaaaaaaaa aaaaaaaaa 299

Claims

1. The bullfrog skin antioxidant peptide anti-NV is characterized in that the skin antioxidant peptide is a polypeptide coded by a bullfrog defensin peptide gene of a species special for Chinese amphibians, has a molecular weight of 1963.7 daltons, an isoelectric point of 9.31, and an amino acid sequence of the peptide is shown as SEQ ID NO. 1.

2. The coding gene of the bullfrog skin antioxidant peptide anti-NV according to claim 1, wherein the coding gene of the bullfrog skin antioxidant peptide anti-NV precursor consists of 299 nucleotides, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 2; wherein the 156 th to 216 th nucleotide is coding gene of mature bullfrog skin antioxidant peptide anti-NV.

3. Use of the bonito skin antioxidant peptide anti-NV according to claim 1 for the preparation of a medicament for the treatment of photoaging of skin.