CN110105442B

CN110105442B - Host factor hPRDX5 with anti-tumor effect, coding gene and application thereof

Info

Publication number: CN110105442B
Application number: CN201910434270.6A
Authority: CN
Inventors: 杨兆勇; 金媛媛; 邹森; 樊帅; 冯晓; 吕广新; 王终博; 张琦
Original assignee: Institute of Medicinal Biotechnology of CAMS
Current assignee: Institute of Medicinal Biotechnology of CAMS
Priority date: 2019-05-23
Filing date: 2019-05-23
Publication date: 2020-11-13
Anticipated expiration: 2039-05-23
Also published as: CN110105442A

Abstract

The invention provides a host factor hPRDX5 with an anti-tumor effect, a coding gene and application thereof, belonging to the technical field of cancer treatment. The host factor hPRDX5 is a single protein component, has the advantages of good preparation repeatability and controllable quality, does not generate immunogenicity when used by people, and has incomparable advantages compared with ACBPs. Meanwhile, the host factor hPRDX5 can obviously inhibit the growth of in-situ pancreatic cancer tumor, and the regulation and control effects of hPRDX5 on CD4, CD8, NKT and MDSCs cells in a pancreatic cancer mouse tumor immune microenvironment are researched, so that compared with a control group, the proportions of CD4+ T cells, CD8+ T cells and NKT cells in pancreatic tumor tissues after the treatment of hPRDX5 are obviously increased. Therefore, the application of the host factor hPRDX5 in preparing the antitumor drugs can effectively reduce the tumor load and prolong the survival time of the tumor.

Description

Host factor hPRDX5 with anti-tumor effect, coding gene and application thereof

Technical Field

The invention belongs to the technical field of cancer treatment, and particularly relates to a host factor hPRDX5 with an anti-tumor effect, an encoding gene and application thereof.

Background

Pancreatic cancer is the king of cancer, and worldwide statistics show that the incidence and mortality of pancreatic cancer tend to increase year by year. Early symptoms of pancreatic cancer are hidden, lack of specificity and difficult to diagnose due to the special anatomical parts of pancreas. Moreover, pancreatic cancer is highly malignant, progresses rapidly, and metastasizes early, so patients often have advanced to advanced stages of cancer when diagnosed. Pancreatic cancer patients have a 5-year survival rate of less than 5% and a poorer prognosis. In addition to surgical treatment, chemotherapy is the primary treatment for patients with unresectable intermediate and advanced pancreatic cancer. Traditional chemotherapy mostly adopts single or multi-drug combination therapy, however, the death rate of pancreatic cancer patients within six months after diagnosis is close to 100%, and thus, the treatment effect of chemotherapy on pancreatic cancer is not ideal. The failure of chemotherapy for pancreatic cancer is mainly due to multiple drug resistance and serious systemic adverse reactions, so that the discovery of new therapeutic drugs and their mechanisms will provide a more effective treatment for pancreatic cancer with fewer adverse reactions, and meanwhile, in order to improve the therapeutic effect of clinical pancreatic cancer, the immunotherapy for cancer is becoming a new focus of international cancer treatment and research.

The tumor microenvironment is a complex system containing non-tumorous supporting cells and extracellular matrix involved in tumor development and progression. Cellular components in the tumor microenvironment include endothelial cells and their precursors, smooth muscle cells, fibroblasts of various phenotypes, and cells associated with immune inflammation, such as lymphocytes, macrophages, dendritic cells, and the like. Immune cells in the tumor microenvironment play a crucial role in inhibiting or promoting the development of tumors. Tumor Infiltrating Lymphocytes (TILs) include several different subpopulations of lymphocytes, such as CD4+ T cells, CD8+ CTL cells, gamma T cells, NKT cells, and the like. The increase of infiltration and activation ratio of these cells in tumor tissues not only can inhibit the development of various cancers including pancreatic cancer, but also can play a role in the anti-tumor immune monitoring function of the body. On the other hand, a group of cells with immunosuppressive functions, such as Treg cells, myeloid-derived suppressor cells (MDSCs) and tumor-associated mononuclear macrophages (TAMs), exist in the tumor immune microenvironment, and they may promote tumor development by inhibiting immune cells with antitumor functions. In the study of pancreatic cancer, it was found that the composition of immune cells in pancreatic cancer tissues is about 50%, wherein immunosuppressive cells such as Treg cells and myeloid-derived suppressive cells predominate, while cytotoxic T cells do not significantly infiltrate into the tumor. Various cells and molecules within the tumor microenvironment can influence disease progression by altering the balance of suppressive and cytotoxic immune cells within the tumor. Therefore, if the antitumor immune response in the tumor microenvironment can be activated and maintained and the tumor promotion immune response can be effectively inhibited, the prognosis of clinical tumor patients can be greatly facilitated, and the tumor-promotion immune response can be used as an effective target for treating pancreatic cancer by using the medicine.

Myeloid-derived suppressor cells, also known as immature myeloid cells or myeloid suppressor cells, are a population of immature myeloid cells, including immature Dendritic Cells (DCs), macrophages and neutrophils. It was found that there is recruitment of myeloid suppressor cells under the induction of factors in the tumor microenvironment, which is composed of tumor cells and/or host cells and their secreted factors. The research shows that various factors intervene in the amplification and recruitment activation of MDSCs, and the MDSCs can be roughly divided into two types. One is inflammatory cytokines produced by tumor cells, tumor stromal cells and T cells, such as GM-CSF, IL-6, etc., which induce MDSCs to expand and activate by stimulating bone marrow and blocking the maturation of myeloid precursor cells, and most of the cytokines regulate MDSCs expansion through JAK protein family and cell signal activation and transcription factor 3(STAT3) signal pathway. The other is chemotactic factor released by tumor cells, and research shows that MDSCs are likely to gather to the tumor site by the action of various cytochemotactic factors, thereby playing an immunosuppressive role to help the tumor escape from immune monitoring of the body, such as CCL2, CXCL5, CXCL12 and the like. Inflammatory cytokines and chemokines can recruit bone marrow MDSCs to peripheral blood or tumor tissues, and MDSCs are stimulated to amplify, activate and inhibit immune responses by cytokines secreted by tumor cells, tumor stromal cells and the like, and various signal pathways are involved in the process, including STAT6, STAT1, NF-kappa B signal pathways and the like.

The involvement of MDSCs in tumor immune escape can be summarized in two aspects, and on the one hand, MDSCs can express a plurality of pro-angiogenic factors to directly promote the formation of tumor vessels, such as VEGF and MMPs. On the other hand, MDSCs can suppress T cell-mediated natural anti-tumor immunity by expressing high levels of ARG1, iNOS, and ROS. Myeloid-suppressor cells promote tumor growth by promoting inflammation, promoting tumor angiogenesis, and suppressing innate and adaptive immune responses. Therefore, myeloid-suppressor cells are also considered to be a major factor in the development of immune dysfunction and tumor burden in cancer patients.

In the study of pancreatic cancer, it was found that myeloid-suppressor cells can significantly accumulate in pancreatic adenocarcinoma tracts and stroma as compared to normal pancreatic tissue. Myeloid suppressor cells were also significantly elevated in peripheral blood of pancreatic cancer patients, which was associated with a high risk of death in the patients, while the elevation of myeloid suppressor cells was accompanied by an elevation of the cytokine IL-13. Infiltration of myeloid suppressor cells is also often accompanied by a reduction in the number of T cells, particularly CD8+ cytotoxic T cells, which is associated with myeloid suppressor cells blocking the response of CD8+ T cells by the production of ROS and NO. Myeloid-suppressor cells in mouse pancreatic cancer cells also highly express the Bcl-2 gene and hyperphosphorylated Akt, inhibiting the CD8+ T cell response. Therefore, if the amplification, recruitment and activation of myeloid-suppressor cells in the pancreatic cancer tumor immune microenvironment can be effectively inhibited, it may play an important role in the treatment of pancreatic cancer.

Antitumor active peptides (ACBPs), hereinafter referred to as "ACBPs"; the polypeptide is a peptide, protein and cytokine mixture with good anti-tumor activity separated from spleen of a goat immunized by human gastric cancer cell fragments, is obtained by applying a traditional polypeptide extraction mode at the initial stage of research and is fixedly named as 'peptide', and the project starts in 1996 and is researched for more than 20 years. The research personnel have proved by the animal in vivo experiments that the ACBPs have no toxic and side effects, can be repeatedly used for a long time and have obvious effect of inhibiting the proliferation of tumor cells, and simultaneously, the in vitro experiments show that the ACBPs have stronger biological functions of killing cancer cells and inhibiting the DNA synthesis of the tumor cells. However, the ACBPs exist in a mixture form, and have the problems of poor repeatability, low quality controllability and long acquisition mode period, and the immunogenicity is bound due to the source problem, so that the ACBPs have great limitation on the application of the ACBPs in tumor resistance.

Disclosure of Invention

In view of the above, the present invention aims to provide a single-component host factor hPRDX5 with anti-tumor effect, a coding gene and applications thereof, wherein the host factor hPRDX5 not only has the advantages of good preparation repeatability and controllable quality, but also can reduce tumor burden and prolong tumor-bearing survival time.

The invention provides a host factor hPRDX5 with anti-tumor effect, wherein the amino acid sequence of the host factor hPRDX5 is shown as SEQ ID No. 1.

The invention provides a gene for coding the host factor hPRDX5, and the nucleotide sequence of the host factor hPRDX5 is shown as SEQ ID No. 2.

The invention provides a recombinant vector containing the gene.

The invention provides a recombinant cell containing the host factor hPRDX5 or the gene.

The invention provides a primer pair for amplifying a gene of the host factor hPRDX5, which comprises a forward primer and a reverse primer;

the nucleotide sequence of the forward primer is shown as SEQ ID No. 3; the nucleotide sequence of the reverse primer is shown as SEQ ID No. 4.

The invention provides a preparation method of the host factor hPRDX5, which comprises the following steps:

1) performing PCR amplification by using the primer pair by using the gene as a template to obtain a DNA fragment with double enzyme cutting sites;

2) carrying out double enzyme digestion on the DNA fragment with the double enzyme digestion sites and the vector respectively by adopting EcoRI and HindIII, and connecting the obtained DNA fragment after enzyme digestion with the vector to obtain a recombinant vector;

3) and (3) introducing the recombinant vector into a prokaryotic expression vector, culturing, inducing, separating and purifying to obtain a recombinant expression host factor hPRDX 5.

Preferably, the amplification system of the PCR reaction is 2 XPCR mix10 uL, ddH₂O8. mu.L, 1. mu.L of 50-200 ng/. mu.L LDNA template, 0.5. mu.L of 20. mu. mol/L forward primer and 0.5. mu.L of 20. mu. mol/L reverse primer.

Preferably, the amplification procedure of the PCR reaction is: pre-denaturation at 96 ℃ for 2 min; denaturation at 96 deg.C for 1min, annealing at 56 deg.C for 30s, extension at 72 deg.C for 40s, and 30 cycles; extension at 72 ℃ for 5 min.

The invention provides application of the host factor hPRDX5, the gene, the recombinant vector, the recombinant cell, the primer pair or the host factor hPRDX5 prepared by the preparation method in preparing antitumor drugs.

Preferably, the tumor species comprises pancreatic cancer.

The host factor hPRDX5 with anti-tumor effect provided by the invention belongs to PRDX5 superfamily, the coding gene of the host factor hPRDX5 is optimized by codon, the immunogenicity problem is overcome, and the host factor hPRDX5 is single component protein, and the host factor hPRDX5 can be obtained by exogenous expression and repeated stability. Meanwhile, the recombinant expression host factor hPRDX5 has obvious tumor inhibition effect, and test results show that hPRDX5 can obviously inhibit the growth of in-situ pancreatic cancer tumor; the regulation and control effects of the hPRDX5 on CD4, CD8, NKT and MDSCs cells in a pancreatic cancer mouse tumor immune microenvironment are researched, and the research proves that compared with a control group, the proportions of CD4+ T cells, CD8+ T cells and NKT cells in pancreatic tumor tissues are obviously increased after the hPRDX5 is used for treating pancreatic cancer, and the proportions of the MDSCs cells are obviously reduced; the proportion of several cells in the spleen is not obviously changed, the proportion of G-MDSCs cells is obviously reduced, and the proportion of M-MDSCs cells is not obviously changed.

Drawings

FIG. 1 is an SDS-PAGE electrophoretic analysis of hPRDX5 protein;

FIG. 2 is a graph of significant inhibition of in situ pancreatic cancer tumor growth by hPRDX5, wherein FIG. 2-A is a graph comparing the volumes of in situ pancreatic cancer tumors in the hPRDX 5-treated group and the control group, and FIG. 2-B is a graph of in situ pancreatic cancer tumor growth in the hPRDX 5-treated group and the control group;

FIG. 3 shows that hPRDX5 up-regulates the proportion of CD4+/CD8+ T cells in tumor tissues in situ in pancreatic cancer mice, wherein FIG. 3-A shows the proportion of CD4+/CD3+ cells in tumor cells of mice in hPRDX 5-treated group and blank control group; FIG. 3-B is the cell ratio of CD8+/CD3+ in the tumor cells of mice in the hPRDX 5-treated group and the blank control group; FIG. 3-C is a cell ratio of CD4+/CD3+ in spleen cells of mice in hPRDX 5-treated group and blank control group; FIG. 3-D is a cell ratio of CD8+/CD3+ in spleen cells of mice in hPRDX 5-treated group and blank control group;

FIG. 4 shows hPRDX5 up-regulating NKT cell ratio in tumor tissues in mice with pancreatic cancer, wherein FIG. 4-A shows NK/CD3 in tumor cells of mice in hPRDX 5-treated group and blank control group^-The cell ratio of (a); FIG. 4-B shows NKT/CD3 in tumor cells of mice in hPRDX 5-treated group and blank control group⁺The cell ratio of (a); FIG. 4-C shows NK/CD3 in spleen cells of mice in hPRDX 5-treated group and blank control group^-The cell ratio of (a); FIG. 4-D is the cell ratio of NKT/CD3+ in spleen cells of mice in hPRDX 5-treated group and blank control group;

FIG. 5 shows the ratio of MDSCs cells in tumor tissue of mice with pancreatic cancer inhibited by hPRDX5, wherein FIG. 5-A shows the ratio of Ly6C +/Ly6G + cells in tumor cells of mice in hPRDX 5-treated group and blank control group; FIG. 5-B shows the cell ratio of Ly6C +/Ly6G + in spleen cells of mice in the hPRDX 5-treated group and the blank control group.

Detailed Description

The invention provides a host factor hPRDX5 with anti-tumor effect, wherein the amino acid sequence of the host factor hPRDX5 is shown as SEQ ID No. 1. The host factor hPRRDX 5 belongs to PRDX5 superfamily, belongs to human protein, so it is prepared into medicine and has no immunogenicity to human medicine.

The invention provides a gene for coding the host factor hPRDX5, and the nucleotide sequence of the host factor hPRDX5 is shown as SEQ ID No. 2. The gene is obtained by codon optimization on the basis of the primary structure of a host factor hPRDX 5. The length of the gene preferably comprises 489 bp. The source of the gene is preferably obtained by artificial synthesis. In the examples of the present invention, the genes were synthesized by Huada Gene Co.

The invention provides a primer pair for amplifying a gene of the host factor hPRDX5, which comprises a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown as SEQ ID No. 3; the nucleotide sequence of the reverse primer is shown as SEQ ID No. 4. In the present invention, the source of the primer pair is preferably artificially synthesized. The sequences of the primer pairs are respectively provided with two enzyme cutting site sequences.

In the present invention, the amplification system of the PCR reaction is preferably 2 XPCR mix 10. mu.L, ddH₂O8. mu.L, 1. mu.L of 50-200 ng/. mu.L LDNA template, 0.5. mu.L of 20. mu. mol/L forward primer and 0.5. mu.L of 20. mu. mol/L reverse primer.

In the present invention, the amplification procedure of the PCR reaction is preferably: pre-denaturation at 96 ℃ for 2 min; denaturation at 96 deg.C for 1min, annealing at 56 deg.C for 30s, extension at 72 deg.C for 40s, and 30 cycles; extension at 72 ℃ for 5 min.

In the present invention, the vector is not particularly limited, and those containing EcoRI and HindIII cleavage sites well known in the art can be used. In the examples of the present invention, the vector was pET28a (+), and pET28a (+) was purchased from Novagen. The procedures and systems for the double cleavage described may be those well known in the art.

In the present invention, the method of the ligation is not particularly limited, and a ligation method known in the art may be used. In the present example, the ligase for ligation is T4 ligase. The connection procedure is not particularly limited in the present invention, and a connection procedure known in the art may be used.

In the present invention, before introducing the recombinant vector into a prokaryotic expression vector, it is preferable to further verify the recombinant vector. Preferably, the recombinant vector is transferred into escherichia coli DH5a competent cells, screening is carried out on an LB plate containing kanamycin antibiotics, recombinants are extracted after screening single bacteria, restriction enzymes EcoRI and HindIII are used for carrying out double enzyme digestion on the recombinants, fragments of enzyme digestion products are fragments of about 480bp and the vector of about 5300bp are positive plasmids respectively, and the positive plasmids are used for subsequent experiments. The E.coli DH5a competent cells of the present invention are not particularly limited, and any commercially available source known in the art may be used. In the present example, the E.coli DH5a competent cells were purchased from Kyoto Kogyo gold Biotech Co., Ltd. The kit for extracting the recombinants is preferably a plasmid extraction kit of Beijing kang, a century Biotechnology Co., Ltd.

After verification, the recombinant vector is introduced into a prokaryotic expression vector, cultured, induced, separated and purified to obtain a recombinant expression host factor hPRDX 5.

In the present invention, the prokaryotic expression vector is preferably e.coli bl21(DE3), and the source of e.coli bl21(DE3) is not particularly limited, and any source known in the art may be used. In the present examples, the e.coli bl21(DE3) was purchased from total gold biotechnology limited, beijing. The method for introducing the prokaryotic expression vector is not particularly limited, and the vector can be transformed by a method conventional in the art.

In the present invention, the temperature of the culture is preferably 37 ℃; the culture is preferably performed by overnight shaking, and the culture medium is preferably LB culture medium. The induction time is 5h at 37 ℃ until OD is reached₆₀₀Induction was carried out at 0.5. The induction mode is preferably cultureIPTG is added into the nutrient medium until the final concentration is 1mmol/L, and separation and purification are carried out after 18-DEG C induction expression is carried out for 18 h. The method of separation and purification is not particularly limited in the present invention, and a separation and purification method well known in the art may be used.

The invention provides a recombinant vector containing the gene. The expression vector in the recombinant vector is preferably pET28a (+). The source of pET28a (+) is not particularly limited in the present invention, and any plasmid known in the art may be used. In the examples of the invention, the pET28a (+) was purchased from Novagen. The method of the recombinant vector is described in the method of the recombinant vector obtained in the above preparation method.

The invention provides a recombinant cell containing the host factor hPRDX5 or the gene. The preparation method of the recombinant cell preferably refers to the prokaryotic expression vector which is introduced with the recombinant vector and prepared in the preparation method.

In the present invention, the tumor is preferably pancreatic cancer. When the anti-tumor medicament is used for resisting tumors, the dosage of the hPRDX5 is preferably 10 mg/kg. The amount can be used for human or mouse. The dosage form of the anti-tumor medicament is preferably injection.

The host factor hPRDX5, the encoding gene and the application thereof having anti-tumor effect provided by the present invention will be described in detail with reference to the following examples, which should not be construed as limiting the scope of the present invention.

Example 1

The amplification primers hPRDX 5-forward primer and hPRDX 5-reverse primer are designed according to the sequence hPRDX 5. The DNA template used for amplification was a codon optimized DNA sequence (SEQ ID No.2) and PCR amplification was performed to introduce the desired cleavage sites.

The primer sequences are as follows:

hPRDX 5-forward primer: ggaattcatggctccgatcaaagttggtgacg (SEQ ID No. 3);

hPRDX 5-reverse primer cccaagcttttacagctgagagatgatgttcgga (SEQ ID No. 4).

The PCR amplification system is as follows: 2 XPCR mix 10. mu.l, ddH₂O8. mu.l, 1. mu.l (about 50ng-200ng) of template DNA, and 0.5. mu.l of each of 20. mu.M forward and reverse primers. The PCR reaction conditions are as follows: pre-denaturation at 96 ℃ for 2 min; denaturation at 96 deg.C for 1min, annealing at 56 deg.C for 30s, and extension at 72 deg.C for 40s (30 cycles); finally, the extension is carried out for 5min at 72 ℃, and the product is stored at 4 ℃.

Example 2

Construction method of recombinant plasmid for expressing protein hPRDX5

After the PCR amplification in example 1 was completed, the amplification was carried out by electrophoresis using 1% agarose gel at 120V, and after tapping, the desired DNA fragment of about 480bp was recovered by using a gel recovery kit (Beijing kang, century Biotech Co., Ltd.), and then double digestion was carried out with EcoRI and HindIII, and the obtained DNA fragment was ligated with the vector pET28a (+), and then the ligation product was transformed into E.coli DH5a competent cells and screened on an LB plate containing kanamycin antibiotic.

The recombinants were verified by double digestion with the restriction enzymes EcoRI and HindIII. The enzyme-digested product was subjected to agarose gel electrophoresis at 120V to verify the sizes of the fragments to be about 480bp and about 5300bp, respectively.

Example 3

Obtaining of monoclonal cell line expressing protein hPRDX5

Extracting recombinant plasmids in the positive bacteria screened in the example 2 by using a plasmid extraction kit, and then transforming into an expression host E.coliBL21(DE3) by a conventional method to obtain the Escherichia coli engineering bacteria of the protein hPRDX5 gene.

Example 4

Purification and enrichment of protein hPRDX5

Inoculating the engineered Escherichia coli constructed in example 3 into LB medium, shaking overnight at 37 deg.C, inoculating 4% of the strain into LB medium, culturing at 37 deg.C for 5h, and waiting for OD₆₀₀At 0.5, 1M IPTG was added to a final concentration of 1mM, and expression was induced at 18 ℃ for 18 h. The fermentation liquor is centrifuged at 4000rpm for 40min, remove the supernatant, the bacteria with 50mM Tris-HCl (pH 8.0) heavy suspension, high pressure homogeneous crusher crushing, 12000rpm centrifugation for 40min, get the enzyme supernatant. Subsequently, a single protein was obtained by purification through a Ni column, and SDS-PAGE electrophoretic analysis was performed to determine the content thereof. The SDS-PAGE electrophoresis is shown in FIG. 1. Quantitative detection shows that 14.1mg of protein is obtained from 1L of bacterial liquid.

Example 5

Tumor-inhibiting effect of hPRDX5 on pancreatic cancer Panc02 tumor-bearing mice.

Experimental animals: c57BL/6 mice, purchased from institute of laboratory animals, college of medical sciences, China; mouse pancreatic cancer Panc02 tumor cell suspension originated from tumor hospital of Chinese academy of medical sciences

The experimental method comprises the following steps: c57BL/6 female mice with the age of 4-6 weeks are selected for culturing Panc02 cells of a pancreatic cancer cell line of the mice. Pancreas in situ injection of 50 μ L2X 10⁷/mL Panc02 cells.

Grouping administration: the successfully modelled mice were randomly divided into 2 groups according to a random number table, 6 per group: protein hPRDX5 treatment group; blank control group. On the third day after surgery, 10mg/kg of ACBPs monocomponent protein hPRDX5 or solvent PBS was injected intraperitoneally daily for 2 weeks.

Experimental treatment and result analysis: and separating the tumor and the spleen the next day after the last administration, measuring the tumor weight, and finally calculating the average tumor inhibition rate.

The results are shown in FIG. 2. FIG. 2 is a graph of significant inhibition of in situ pancreatic cancer tumor growth by hPRDX5, wherein FIG. 2-A is a graph comparing the volumes of in situ pancreatic cancer tumors in the hPRDX 5-treated group and the control group, and FIG. 2-B is a bar graph comparing the growth of in situ pancreatic cancer tumors in the hPRDX 5-treated group and the control group. The result shows that the protein hPRDX5 has obvious inhibiting effect on pancreatic cancer.

Example 6

The regulation effect of hPRDX5 on CD4, CD8, NKT and MDSCs cells in tumor immune microenvironment of pancreatic cancer mice.

The experimental method comprises the following steps: after the mice are sacrificed by adopting a cervical dislocation method, tumor tissues and spleens of the mice are respectively taken, and cells obtained after treatment are collected and analyzed by a flow cytometer.

The proportion of immune cells in mouse orthotopic tumor tissues was analyzed on the basis of the determination of the anti-tumor effect of hPRDX5 on pancreatic cancer. The results are shown in FIGS. 3 to 5. Wherein FIG. 3 shows that hPRDX5 upregulates the proportion of CD4+/CD8+ T cells in tumor tissues in pancreatic cancer mice in situ, and wherein FIG. 3-A shows the proportion of CD4+/CD3+ T cells in tumor cells of mice in hPRDX 5-treated group and control blank group; FIG. 3-B is the cell ratio of CD8+/CD3+ in the tumor cells of mice in the hPRDX 5-treated group and the blank control group; FIG. 3-C is a cell ratio of CD4+/CD3+ in spleen cells of mice in hPRDX 5-treated group and blank control group; FIG. 3-D is a cell ratio of CD8+/CD3+ in spleen cells of mice in hPRDX 5-treated group and blank control group.

And (4) analyzing results: compared with a control group, the proportion of CD4+ T, CD8+ T, NKT cells in the tumor tissue is obviously increased after the hPRDX5 treatment, and the proportion of MDSCs cells is obviously reduced correspondingly; the proportion of several cells in the spleen is not obviously changed, the proportion of G-MDSCs cells is obviously reduced, and the proportion of M-MDSCs cells is not obviously changed.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> institute of medical and Biotechnology of Chinese academy of medical sciences

<120> host factor hPRDX5 with anti-tumor effect, coding gene and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 162

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Ala Pro Ile Lys Val Gly Asp Ala Ile Pro Ala Val Glu Val Phe

1 5 10 15

Glu Gly Glu Pro Gly Asn Lys Val Asn Leu Ala Glu Leu Phe Lys Gly

20 25 30

Lys Lys Gly Val Leu Phe Gly Val Pro Gly Ala Phe Thr Pro Gly Cys

35 40 45

Ser Lys Thr His Leu Pro Gly Phe Val Glu Gln Ala Glu Ala Leu Lys

50 55 60

Ala Lys Gly Val Gln Val Val Ala Cys Leu Ser Val Asn Asp Ala Phe

65 70 75 80

Val Thr Gly Glu Trp Gly Arg Ala His Lys Ala Glu Gly Lys Val Arg

85 90 95

Leu Leu Ala Asp Pro Thr Gly Ala Phe Gly Lys Glu Thr Asp Leu Leu

100 105 110

Leu Asp Asp Ser Leu Val Ser Ile Phe Gly Asn Arg Arg Leu Lys Arg

115 120 125

Phe Ser Met Val Val Gln Asp Gly Ile Val Lys Ala Leu Asn Val Glu

130 135 140

Pro Asp Gly Thr Gly Leu Thr Cys Ser Leu Ala Pro Asn Ile Ile Ser

145 150 155 160

Gln Leu

<210> 2

<211> 489

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggctccga tcaaagttgg tgacgctatc ccggctgttg aagttttcga aggtgaaccg 60

ggtaacaaag ttaacctggc tgaactgttc aaaggtaaaa aaggtgttct gttcggtgtt 120

ccgggtgctt tcaccccggg ttgctctaaa acccacctgc cgggtttcgt tgaacaggct 180

gaagctctga aagctaaagg tgttcaggtt gttgcttgcc tgtctgttaa cgacgctttc 240

gttaccggtg aatggggtcg tgctcacaaa gctgaaggta aagttcgtct gctggctgac 300

ccgaccggtg ctttcggtaa agaaaccgac ctgctgctgg acgactctct ggtttctatc 360

ttcggtaacc gtcgtctgaa acgtttctct atggttgttc aggacggtat cgttaaagct 420

ctgaacgttg aaccggacgg taccggtctg acctgctctc tggctccgaa catcatctct 480

cagctgtaa 489

<210> 3

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggaattcatg gctccgatca aagttggtga cg 32

<210> 4

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cccaagcttt tacagctgag agatgatgtt cgga 34

Claims

1. The application of a host factor hPRDX5, a gene for coding the host factor hPRDX5, a recombinant vector containing the gene, a recombinant cell containing the recombinant vector or a primer pair in preparing a medicament for resisting pancreatic cancer;

the amino acid sequence of the host factor hPRDX5 is shown as SEQ ID No. 1;

the nucleotide sequence of the gene of the coding host factor hPRDX5 is shown as SEQ ID No. 2;

the primer pair comprises a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown as SEQ ID No. 3; the nucleotide sequence of the reverse primer is shown as SEQ ID No. 4.