CN112125959B

CN112125959B - Peptide for inhibiting EB virus, DNA for coding peptide and application thereof

Info

Publication number: CN112125959B
Application number: CN202011079870.4A
Authority: CN
Inventors: 高嵩; 何会萍; 罗梦; 曹雨露; 欧均颖; 于冰
Original assignee: Sun Yat Sen University Cancer Center
Current assignee: Sun Yat Sen University Cancer Center
Priority date: 2020-10-10
Filing date: 2020-10-10
Publication date: 2022-07-29
Anticipated expiration: 2040-10-10
Also published as: CN112125959A

Abstract

The invention belongs to the field of biological medicine, and particularly relates to a peptide for inhibiting Epstein-Barr virus, DNA for coding the peptide and application of the peptide. By using the peptide of the present invention, replication of Epstein-Barr virus can be effectively inhibited, and thus diseases associated with Epstein-Barr virus can be prevented and/or treated.

Description

Peptide for inhibiting EB virus, DNA for coding peptide and application thereof

Technical Field

The invention belongs to the field of biological medicine, and particularly relates to a peptide for inhibiting Epstein-Barr virus, DNA for coding the peptide and application of the peptide.

Background

Epstein-Barr virus (EBV or EB virus) is a gamma-herpes virus, a double-stranded DNA virus, that is associated with a variety of human malignancies. Statistically, about 95% of the world's population carries the virus. EBV is an oncogenic virus that is closely associated with the development of a variety of specific human tumors, including nasopharyngeal carcinoma, hodgkin's lymphoma, burkitt's lymphoma, and gastric carcinoma. The world cancer report released by the international agency for cancer research (IARC)2008 indicates that EBV causes 1% of global cancers, accounting for 5.6% of all infectious cancers. EBV is listed in the first group of oncogens according to the IARC classification criteria for oncogens. Currently, there is no effective clinical method to prevent or eliminate EBV infection.

Therefore, there is a need in the art to find a solution that can prevent and/or eliminate EBV infection.

Disclosure of Invention

As described above, it is highly desirable to find a solution for preventing and/or eliminating EBV infection, thereby treating and/or preventing EBV infection and EBV-associated human diseases.

Accordingly, in a first aspect, the present invention provides a peptide comprising SEQ ID NO: 1.

In a second aspect, the present invention provides a nucleic acid sequence encoding a peptide of the first aspect of the invention.

In a third aspect, the present invention provides an expression vector comprising the nucleic acid sequence of the second aspect of the invention.

In a fourth aspect, the invention provides the use of a peptide of the first aspect of the invention, a nucleic acid sequence of the second aspect of the invention, or an expression vector of the third aspect of the invention, in the manufacture of a medicament for the treatment of an epstein-barr virus-related disease.

In a fifth aspect, the invention provides a method of inhibiting epstein-barr virus replication, the method comprising administering a peptide of the first aspect of the invention or an expression vector of the third aspect of the invention.

In a sixth aspect, the present invention provides a method of treating an epstein-barr virus related disease comprising administering to a patient a peptide of the first aspect of the invention or an expression vector of the third aspect of the invention.

In a seventh aspect, the invention provides a kit comprising a peptide of the first aspect of the invention, a nucleic acid sequence of the second aspect of the invention, or an expression vector of the third aspect of the invention.

The beneficial effects of the invention are as follows:

the peptides of the invention can effectively reduce the copy number of the viral genome, so that designing small molecule inhibitors based on the peptides can potentially alleviate and treat Epstein-Barr virus infection or Epstein-Barr virus-related human diseases.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings will be briefly described below. It is to be understood that the drawings in the following description are directed to only some embodiments of the invention.

FIG. 1 shows details of the BBRF2 Δ -BSRF1 Δ interface, where: panel a schematically shows a comparison of identifiable residues (colored regions) of BBRF2 Δ (green) and BSRF1 Δ (blue) in a BBRF2 Δ -BSRF1 Δ crystal complex with full-length BBRF2 and BSRF 1; panel b shows two views of heterodimers, color labeled with the N-and C-terminal ends of BSRF1 Δ of panel a; panel c shows the hydrophobic interaction between two antiparallel alpha helices of BSRF1 Δ; FIGS. d-f show the hydrophobic interface (d), the polar interface (e), and the BSRF1 Δ N-terminal loop mediated interface (f) at the BBRF2 Δ -BSRF1 Δ interface, respectively, with secondary structural elements labeled, and the amino acid residues involved colored to the color of the molecule to which they belong; panel g shows the surface conservation map for BBRF2 Δ (left) and BSRF1 Δ (right): for clarity, the combined BSRF1 Δ (left) and BBRF2 Δ (right) are shown as transparent, delineating the interface profile of the BBRF2 Δ -BSRF1 Δ heterodimer in yellow.

Figure 2 shows BSRF1 Δ derived peptides and their binding to BBRF2 Δ, wherein: FIG. a shows a schematic representation of the amino acid lengths of five BSRF1 Δ derived peptides (P1-P5), where N represents the N-loop region in the resolved structure; panel b shows binding to 10. mu.g ml ^-1 His ₆ BLI analysis of five peptides of BBRF 2. delta. Only P1 was shown to interact with His ₆ -BBRF2 Δ binding; panel c shows the binding affinity of peptide 1(P1) and BBRF2 Δ as measured by BLI: different concentrations of P1 were mixed with 10. mu.g ml ^-1 His-tagged BBRF2 Δ binding; panel d shows that P1 competes with BSRF1 Δ for binding to BBRF2 Δ: 200nM BBRF 2. delta. was mixed with different concentrations of P1 and 10. mu.g ml ^-1 Fixed BSRF1 Δ binding; panel e shows that TAT-P1 reduces EBV genomic copy number in a concentration-dependent manner,wherein error bars represent s.d. (n-3).

Detailed Description

The present invention will now be described more fully hereinafter. It is to be understood that the described embodiments are merely a subset of the present invention and not all embodiments. All other embodiments are available to the person skilled in the art based on the embodiments of the invention and are within the scope of protection of the invention.

The interaction between BBRF2 and BSRF1 (or homologs thereof) is believed to be critical for the life cycle of epstein-barr virus, and targeting the BBRF2 and BSRF1 junction surfaces is likely to be a potential clinical treatment strategy for EBV. Based on the structure of the BBRF2 Δ -BSRF1 Δ junction plane, the inventors designed 5 BSRF 1-derived peptides (P1-P5) as shown in FIG. 2a, covering the site of BBRF2 at the N-loop, α A, or α B of BSRF 1.

As will be appreciated by those skilled in the art, the target peptide may be linked to other peptides having a particular function to achieve the corresponding function. For example, a target peptide may be linked to a cell-penetrating peptide, thereby allowing the target peptide to readily penetrate the cell membrane into the cell.

Thus, in one embodiment, the peptide further comprises a cell penetrating peptide such as a TAT sequence and a linker peptide.

The nucleotide sequence encoding the peptide will be known to those skilled in the art given the amino acid sequence of the peptide.

In one embodiment, the nucleic acid sequence is SEQ ID NO:2, or a pharmaceutically acceptable salt thereof.

The sequence of SEQ ID NO 2 is shown below:

GATCTGGGCCTGCCCCCTGGTGTGCAGGTGGGAGATTTGCTAAGAAATGAGCAGACGATGGGCTCACTGAGACAGGTTTATTTGCTCGCTGTTCAAGCCAATAGCATCACGGAT。

it will be appreciated that the nucleotide sequence shown in SEQ ID NO. 2 may encode a peptide of the invention, but that degenerate sequences thereof may also encode a peptide of the invention.

As used herein, the term "expression vector" refers to a vector in which an expression element (e.g., promoter, RBS, terminator, etc.) is added to the basic backbone of a cloning vector so that a desired gene can be expressed. The expression vector may be a plasmid vector, a phage vector, a viral vector, etc., and is not particularly limited as long as it can express the target protein.

In a fourth aspect, the invention provides the use of a peptide of the first aspect of the invention, a nucleic acid sequence of the second aspect of the invention, or an expression vector of the third aspect of the invention, in the manufacture of a medicament for the treatment of an epstein-barr virus related disease.

In one embodiment, the Epstein-Barr virus-associated disease is selected from the group consisting of infectious mononucleosis, linked lymphoproliferative syndrome, viral hemophilus syndrome, oral mucoleukoplakia mucosae, viral meningitis, peripheral neuritis, viral pneumonia viral myocarditis, nasopharyngeal carcinoma, Hodgkin's lymphoma, Burkitt's lymphoma, gastric carcinoma, hepatocellular carcinoma, lymphoepithelioid sarcoma, salivary gland tumor, breast cancer, thymoma, primary effusion lymphoma, or B/T/NK cell lymphoma.

It is understood that the "inhibition of epstein-barr virus replication" described herein may be performed for various purposes, such as for therapeutic purposes, such as for research purposes, or for some commercial purpose.

The invention has the beneficial effects that:

the peptides of the invention can effectively reduce the viral genome copy number and thus can alleviate and treat epstein-barr virus infection and epstein-barr virus-related human diseases.

The following examples are provided for a better understanding of the present invention. The test methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples were purchased from a conventional reagent store unless otherwise specified. It should be noted that the summary above and the detailed description below are merely intended to specifically illustrate the present invention and are not intended to limit the invention in any way. The scope of the invention is to be determined by the appended claims without departing from the spirit and scope of the invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

Examples

The first step of experiment:

protein expression and purification

The cDNAs of BBRF2 and BSRF1 were amplified from the genome of the human herpesvirus type 4 strain M81. Full-length BBRF2 and BBRF2 _17-278 The cDNA of (BBRF 2. delta.) was cloned into the engineered pET28 vector (pSKB) and a fusion protein with a 6 XHis-tag followed by a PreScission cleavage site at the N-terminus was expressed in E.coli Rosetta (DE3) cells. The transformed bacteria were cultured in Terrific Broth (TB) medium at 37 ℃ and induced with the addition of 100. mu.M isopropyl-1-thio-. beta. -D-thiogalactoside (IPTG) at an optical density of 0.6. After induction, cells were grown overnight (about 16-18 hours) at 18 ℃ and harvested by centrifugation.

The collected cells were lysed in ice-cold buffer (containing 20mM HEPES (pH 7.0), 600mM NaCl, 10% glycerol, 30mM imidazole, 1. mu.M DNase I, 1mM phenylmethanesulfonyl fluoride (PMSF) and 2 mM. beta. -mercaptoethanol (. beta. -ME) using a cell disruptor (JNBIO), and centrifuged at 40,000g for 1 hour at 4 ℃ the supernatant was filtered and applied to a Ni-NTA (first Ni-NTA) column (GE Healthcare) equilibrated with binding buffer A (containing 20mM HEPES (pH 7.0), 600mM NaCl, 10% glycerol, 30mM imidazole, 2 mM. beta. -ME), washed with binding buffer A, the protein was eluted with an elution buffer containing 20mM HEPES (pH 7.0), 600mM NaCl, 10% glycerol, 300mM imidazole and 2mM β -ME the eluted protein was incubated with PreScission protease (PSP) fused with 20 μ g glutathione S-transferase (GST) to remove His. ₆ Tag and dialyzed overnight at 4 ℃ against binding buffer B containing 20mM HEPES (pH 7.0), 600mM NaCl, 10% glycerol, 2mM β -ME. After dialysis, PSP was removed using a GST column. The protein was re-loaded onto a second Ni-NTA column equilibrated with binding buffer B and eluted with binding buffer a. Subsequently, the eluted proteins were applied to Size Exclusion Chromatography (SEC) using a HiLoad 16/60Superdex 75 column (GE Healthcare) equilibrated with buffer C containing 20mM HEPES (pH 7.0), 600mM NaCl, 10% glycerol, and 1mM Dithiothreitol (DTT). The protein was eluted with discrete peaks (discrete peak) and collected. BBRF2 _17-278 Selenomethionine (SeMet) derivatives of (A) are tabulated as previously describedAnd purified as the native BBRF2 protein.

BSRF1 _34-159 (BBRF 1. delta.) cDNA was cloned into pGEX-6p-1 vector. The recombinant protein was expressed and collected in lysis buffer containing 50mM HEPES (pH 7.0), 150mM NaCl, 1mM PMSF and 2mM β -ME as was BBRF2 protein. The collected proteins were loaded onto a GST column equilibrated with a binding buffer containing 20mM HEPES (pH 7.0), 150mM NaCl and 2mM β -ME and eluted with a buffer containing 20mM HEPES (pH 7.0), 150mM NaCl, 10mM glutathione and 2mM β -ME. After treatment with 20 μ g PSP, the protein was loaded onto a GST column to remove the GST tag and PSP. SEC was performed according to the same method as BBRF2 protein. BBRF2 was prepared by mixing purified BBRF2 Δ and BSRF1 Δ at a molar ratio of 1:1 and incubating overnight at 4 ℃ _17-278 -BSRF1 _34-159 (BBRF 2. delta. -BSRF 1. delta.) the complex was then purified by SEC using HiLoad 16/60Superdex 200 column (GE) in buffer C. BSRF1 _20-218 The cDNA of (3) was cloned into pSKB vector. As with the BBRF2 construction, recombinant proteins were expressed, collected and purified, with all buffers containing less NaCl (300mM) and no glycerol.

And (3) crystallization:

using hanging drop vapor diffusion, by equal volume of protein (about 7 mg.ml) ^-1 ) And the mixture of stock solutions were subjected to crystallization experiments. Crystals of SeMet BBRF 2. delta. were grown from 0.09M NPS (0.03M NaNO) at 4 deg.C ₃ 、0.03M Na ₂ HPO ₄ 、0.03M(NH ₄ ) ₂ SO ₄ ) 0.1M 2- (N-morphine) ethanesulfonic acid (MES)/imidazole (pH 6.5), 12.5% PEG1000, 12.5% PEG 3350, and 12.5% MPD. Crystals of the BBRF2 Δ -BSRF1 Δ complex were grown from 0.1M magnesium acetate, 0.05M MES (pH 5.6), and 20% MPD after 1:1000M/M α -chymotrypsin treatment overnight at 4 ℃. The crystals were snap frozen directly in liquid nitrogen.

Structure analysis:

the X-ray diffraction data set for BBRF2 Δ was collected at beam lines BL17U1 and BL19U1 of the shanghai synchrotron radiation apparatus (SSRF). A data set of BBRF2 Δ -BSRF1 Δ composite was collected at the SSRF beam line BL18U 1. Processing numbers using XDS program groupsAnd (6) collecting data. The initial phase of the BBRF2 Δ structure was obtained by a single wavelength anomalous dispersion (SAD) method and corrected from the diffraction data set of SeMet substituted BBRF2 Δ crystals using phenix. The BBRF2 Δ -BSRF1 Δ complex structure was resolved by molecular replacement using Phaser with the structure of BBRF2 Δ as a search model. The model for BSRF1 Δ was constructed manually using COOT. The AutoBuild program in the Phenix group was used to minimize model bias. Structure verification was performed using MolProbity. Using a PyMOL molecular graphics system (version 0.99,

http: // www.pymol.org /) and CCP4mg generate the block diagrams. X-ray data collection and optimization statistics are listed in table 1.

Table 1: crystallography data acquisition and correction

The numbers in parentheses are the numbers from the highest resolution layer.

Cell culture

CNE2-EBV cells were donated by professor Zengzhi (college of Chinese medical sciences). Cells were cultured in RPMI 1640 medium (GIBCO) containing 10% FBS and penicillin/streptomycin. The cell line is mycoplasma free. CNE2-EBV cells were derived from a mother cell line that had been infected with recombinant EBV.

Biomembrane interference technique (BLI)

The BLI detection was performed using an eight-channel OctetRED biofilm interferometer system (Forte Bio). To determine the interaction between BBRF2 Δ and BSRF1 Δ or peptides P1-P5, His was included ₆ BBRF2 Δ (10 μ g ml) of the tag ^-1 ) Immobilized on the tip of an NTA biosensor (Forte Bio), which has been previously retarded with a reaction containing 20mM HEPES (pH7.0)), 600mM NaCl, 10% glycerol and 1mM DTTAnd (5) flushing balance. BSRF1 delta or peptide P1-P5 was diluted to 4-8 different concentrations and delivered by a single band with His ₆ BBRF2 Δ coated tips of the tag were analyzed in turn at each concentration.

To monitor the competitive binding of BSRF1 Δ and P1 peptide to BBRF2 Δ, BSRF1 Δ was biotinylated using Biotinylation Kit (Genemore) at room temperature for 30 minutes, and then BSRF1 Δ was immobilized onto streptavidin-coated (SA) biosensor tips pre-equilibrated in reaction buffer. The P1 peptide was diluted to different concentrations (100. mu.M, 50. mu.M, 25. mu.M, 12.5. mu.M, 6.3. mu.M and 3.1. mu.M) in reaction buffer and mixed with 200nM of BBRF 2. delta. respectively. All experiments were performed at 25 ℃. Each measurement involved a 120s baseline (using reaction buffer), followed by a 180s (using protein) or (using peptide) binding phase, and a 180s dissociation phase (using reaction buffer). The raw Data was processed using Octet Data Analysis software 11.0 supplied by Fortebio to derive the dissociation constant (K) _D ). Results were plotted using Origin (2019 version, Origin lab).

Synthesis of peptides

Sangon Bio (Shanghai, China) was entrusted with the synthesis of the following peptides. The amino acid sequence of the peptide is shown in table 2 below:

TABLE 2 amino acid sequence of the peptides

Peptide transfection assay

The TAT-peptide was dissolved in RPMI 1640 medium. Peptides were added at different concentrations to 12-well plates pre-seeded with CNE2-EBV cells (human nasopharyngeal carcinoma cells with persistent EBV infection) and incubated at 37 ℃ for 2 hours. The cells were subsequently washed 3 times with PBS and then transferred to RPMI 1640 supplemented with 10% Fetal Bovine Serum (FBS), penicillin/streptomycin, sodium butyrate and phorbol 12-myristate 13-acetate (PMA). After 48 hours, the EBV genomic copy number of these cells was determined.

EBV Gene copy number assay

CNE2-EBV cells pre-transfected with TAT-peptide were treated with 2.5mM sodium butyrate and20ng ml ^-1 phorbol 12-myristate 13-acetate (PMA) was treated for 12 hours to induce EB virion production. After 48 hours, cells were harvested and washed 3 times with PBS for measurement of virus replication, and then the remaining medium was filtered through a 0.45 μm filter and centrifuged at 1,000g for 10 minutes at 4 ℃ to remove cell debris. Copy number of the enveloped virus genomic DNA was determined by qPCR analysis of virus supernatants. Briefly, (QIAGEN) the enveloped viral genomic DNA is extracted from the induced cells. The supernatant was washed with DNase I (105U ml) ^-1 ) Digested at 37 ℃ for 1 hour, then mixed with lysis buffer and 0.1mg ml ^-1 And mixing the protease K. Protease K was added to remove the viral envelope and capsid. The mixture was heated at 56 ℃ for 10 minutes and then at 75 ℃ for 20 minutes to inactivate the enzyme. The samples were diluted 1:10 with RNase free water and then qPCR was performed using primers for BALF5 DNA polymerase gene. The EBV-encoded gene was quantified by qPCR using gene-specific primers (table 3).

TABLE 3 primer List for qPCR

II, results and discussion:

based on the structural details of the validated BBRF2 Δ -BSRF1 Δ binding interface, the present inventors designed 5 BSRF 1-derived peptides (P1-P5) that cover the binding site of BBRF2 at the N-loop, α a or α B of BSRF1 (fig. 2 a). BLI analysis showed that only the longest P1 (covering the N loop and a) showed significant binding to BBRF2 Δ, K _D At 7.4. mu.M (FIG. 2c, FIG. 2 b). This means that a single structural element of BSRF1 is insufficient to form a stable bond between BSRF1 Δ and BBRF 2. The inventors then examined whether P1 could compete with wild-type BSRF1 Δ in the BBRF2 Δ -BSRF1 Δ complex. As shown by BLI analysis, the addition of P1 disrupted the binding between BBRF2 Δ and cured BSRF1 Δ in a concentration-dependent manner (fig. 2d), indicating that P1 could compete with BSRF1 in binding to BBRF2 Δ. In view of this result, the present inventors investigated P1 in CNE2-EBV cells (a cell with persistent EBV infection) Human nasopharyngeal carcinoma cells). To facilitate cellular uptake of P1, the inventors fused the TAT sequence and a tetraglycine linker to the N-terminus of P1 (TAT-P1). TAT-P1 reduces viral genome copy number in a concentration-dependent manner when transfected into CNE2-EBV cells. At a concentration of 5. mu.M, TAT-P1 was able to reduce EBV genome copy number by 75%, but this effect was not further enhanced at higher concentrations of TAT-P1 (FIG. 2 e). These results indicate that disrupting the BBRF2-BSRF1 interaction may be an effective method to control EBV production.

In the previous studies of the inventors, complex structures of EBV interlayer proteins BBRF2 and BSRF1 were reported, revealing a conserved pattern between EBV interlayer proteins. Based on biochemical and cellular experimental results and previous researches on BBRF2/BSRF1 homologues in other herpesviruses, the BBRF2-BSRF1 compound plays an important role in EBV assembly and has important significance on secondary envelope. The BBRF2-BSRF1 complex can create a permissive confinement environment that favors the EBV secondary envelope. On the other hand, it has been reported that knock-down of BBRF2 or BSRF1 decreases the viral genome copy number in EBV-infected cells, and that the BBRF2-BSRF1 complex may perform different critical processes in EBV maturation and efflux. Finally, the unique folding of BBRF2 makes it a potential specific drug target against EBV. Given that the P1 peptide had inhibitory effect on EBV genome copy number at low molar levels (fig. 2e), targeting the BBRF2-BSRF1 complex by the optimized BSRF1 derived peptide is expected to be a new strategy for treating EBV infection and EBV-related human diseases.

Sequence listing

<110> center for preventing and treating tumors of Zhongshan university

<120> peptide for inhibiting EB virus, DNA encoding the peptide and use thereof

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 38

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Asp Leu Gly Leu Pro Pro Gly Val Gln Val Gly Asp Leu Leu Arg Asn

1 5 10 15

Glu Gln Thr Met Gly Ser Leu Arg Gln Val Tyr Leu Leu Ala Val Gln

20 25 30

Ala Asn Ser Ile Thr Asp

35

<210> 2

<211> 114

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gatctgggcc tgccccctgg tgtgcaggtg ggagatttgc taagaaatga gcagacgatg 60

ggctcactga gacaggttta tttgctcgct gttcaagcca atagcatcac ggat 114

<210> 3

<211> 12

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Asp Leu Gly Leu Pro Pro Gly Val Gln Val Gly Asp

1 5 10

<210> 4

<211> 17

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Asp Leu Gly Leu Pro Pro Gly Val Gln Val Gly Asp Leu Leu Arg Asn

1 5 10 15

Glu

<210> 5

<211> 22

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Glu Gln Thr Met Gly Ser Leu Arg Gln Val Tyr Leu Leu Ala Val Gln

1 5 10 15

Ala Asn Ser Ile Thr Asp

20

<210> 6

<211> 17

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Arg Ser Val Ile Trp Asn Thr Met Ile Ser Leu Ala Val Ser Gly Ile

1 5 10 15

Glu

<210> 7

<211> 53

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Gly Gly Gly Ser Asp

1 5 10 15

Leu Gly Leu Pro Pro Gly Val Gln Val Gly Asp Leu Leu Arg Asn Glu

20 25 30

Gln Thr Met Gly Ser Leu Arg Gln Val Tyr Leu Leu Ala Val Gln Ala

35 40 45

Asn Ser Ile Thr Asp

50

<210> 8

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 8

Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Ala Ala Gln Gly Phe

1 5 10 15

Gly Cys Pro Leu

20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cttatggaga tgtgcgccct 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gtggtacttg accagggtgg 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

taagcggcat cgagatggac 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

agttgatgaa aggggccgag 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ggtcacaatc tccacgctga 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

caacgaggct gacctgatcc 20

Claims

1. A peptide having an amino acid sequence as set forth in SEQ ID NO: 1 is shown.

2. A peptide consisting of SEQ ID NO: 1, and cell penetrating peptides and linker peptides.

3. The peptide of claim 2, wherein the cell penetrating peptide is a TAT sequence.

4. An isolated nucleic acid encoding the peptide of any one of claims 1-3.

5. The nucleic acid of claim 4, wherein the sequence of said nucleic acid is SEQ ID NO: 2, or a sequence shown in the figure.

6. An expression vector comprising the nucleic acid of claim 4 or 5.

7. Use of the peptide of any one of claims 1 to 3, the nucleic acid of claim 4 or 5, or the expression vector of claim 6 in the manufacture of a medicament for the treatment of an epstein-barr virus-related disease.

8. The use of claim 7, wherein the Epstein-Barr virus-associated disease is selected from infectious mononucleosis, Linked lymphoproliferative syndrome, viral hemophilt syndrome, oral mucoleukoplakia mucosae, viral meningitis, peripheral neuritis, viral pneumonia viral myocarditis, nasopharyngeal carcinoma, Hodgkin's lymphoma, Burkitt's lymphoma, gastric cancer, hepatocellular carcinoma, lymphoepithelioid sarcoma, salivary gland tumor, breast cancer, thymoma, primary effusion lymphoma or B/T/NK cell lymphoma.

9. A method of inhibiting epstein-barr virus replication comprising administering a peptide of any of claims 1-2 or an expression vector of claim 5, wherein the method is for a non-therapeutic purpose.

10. A kit comprising the peptide of any one of claims 1-3, the nucleic acid of claim 4 or 5, or the expression vector of claim 6.