CN112111578A

CN112111578A - miRNA marker for lipid synthesis capacity under whole grain diet

Info

Publication number: CN112111578A
Application number: CN202010920993.XA
Authority: CN
Inventors: 王立; 刘金鑫; 李言; 樊铭聪; 钱海峰
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2020-09-04
Filing date: 2020-09-04
Publication date: 2020-12-22
Anticipated expiration: 2040-09-04
Also published as: CN112111578B

Abstract

The invention discloses a miRNA marker for lipid synthesis capacity under whole grain diet, belonging to the field of biological medicine and food nutrition and health. The whole grain diet is used for intervening in lipid metabolism of an organism, and the biological effect of miR-27a-3p in the lipid synthesis process is verified through analysis of lipid metabolism of the organism, sequencing analysis of serum miRNAs and evaluation of the efficacy of miR-27a-3p in the lipid metabolism function. The miR-27a-3p can be used as a new serum miRNA biomarker for whole grain diet regulation of organism lipid metabolism.

Description

miRNA marker for lipid synthesis capacity under whole grain diet

Technical Field

The invention relates to a miRNA marker of lipid synthesis capacity under whole grain diet, in particular to a serum or plasma miRNA marker of lipid synthesis capacity under whole grain diet, belonging to the fields of biological medicine and food nutrition and health.

Background

Overweight and obesity have long been a health concern as a worldwide epidemic, and have gradually emerged in recent years as a trend toward younger age-the prevalence of overweight or obesity in children and adolescents has increased year by year. In addition, overweight and obesity can cause a range of metabolic diseases including diabetes and cardiovascular disease, which severely threatens human health. Due to its complex mechanism of action, controlling the balance of lipid metabolism in the body is important for human health.

The existing method for detecting lipid metabolism condition of human body mainly detects the content of blood lipid in blood, such as cholesterol and triglyceride in blood. However, this method tends to have some hysteresis. Usually, the blood test result is obtained after the abnormal lipid metabolism ability of the human body is obtained and a higher amount of lipid is accumulated in the human body.

MicroRNAs (miRNAs) are endogenous regulatory non-coding micro RNAs and can be combined with a 3' UTR regulation site of a target gene by the principle of base complementary pairing, so that the transcription of the target gene is blocked, the translation of protein is inhibited, and the reduction of protein synthesis is promoted. miRNAs exist in blood circulation, and it has been reported that miRNAs derived from fat can regulate gene expression in different tissues of the body, thereby becoming a novel fat regulatory factor.

The staple food which we take in daily is mostly made of processed polished rice and polished flour. Whole grain refers to the complete grain seed or kernel, comprising three parts, bran, germ and endosperm. Whole grain diet refers to a diet pattern based on whole brown rice or whole wheat, for example, whole brown rice flour or whole wheat flour in a mass ratio of 40% -60%. At present, whole grain diets have proven to be an effective and healthy dietary pattern for improving lipid metabolism. Compared with non-whole grain or refined grain, the whole grain food is not processed by a broadsword processing link, and germ and bran which are rich in dietary fiber, mineral substances, vitamins and other phytochemicals are reserved, so that the whole grain food has higher nutritional value. There is increasing evidence that eating whole grain may reduce the risk of overweight or obesity. In random crossover experiments and animal experimental studies, whole grain diets were able to significantly control body weight, reduce blood lipids and liver lipid deposition. Also, with the rapid increase in the prevalence of obesity worldwide, increased intake of whole grain is recommended in southern and index finger populations in countries including europe, the united states, and asia. However, there is currently no complete evaluation system to assess the functional properties of a whole grain diet, nor are there corresponding biomarkers to indicate the regulation of lipid metabolism by a whole grain diet.

Disclosure of Invention

[ problem ] to

microRNAs capable of being used for detecting or diagnosing lipid synthesis capacity are lacked in the prior art.

[ solution ]

The invention provides a serum or plasma microRNA marker miR-27a-3p for detecting or diagnosing the lipid synthesis capacity of an organism. The novel serum or plasma microRNA marker can be used for rapidly responding the lipid synthesis condition of an organism. Can also be used for detecting and judging whether the whole grain diet on the market has the regulation and control capability on the body lipid synthesis.

The body includes: human, mouse, chimpanzee, and the like.

The lipid synthesis capacity refers to: the level of synthesis and accumulation of cholesterol and triglycerides in the liver and intestinal tract. The serum or plasma miRNA that can be used for detecting or diagnosing the lipid synthesis capability of the body is selected from the group consisting of: (1) miRNA with sequence shown as SEQ ID NO. 1; (2) a miRNA complementary to the miRNA sequence shown in (1); (3) miRNA containing sequence segment in (1) or (2).

The invention provides a method for detecting or diagnosing the lipid synthesis capacity of an organism by applying the microRNA marker, which comprises the following steps:

(a) detecting the expression level of a microRNA marker (miR-27a) in the serum of a research sample;

(b) if the expression level of the microRNA marker in the tested sample is obviously higher than the expression level in the serum of the normal sample, judging that the lipid synthesis capacity of the organism of the sample is higher; and if the expression level of the microRNA marker in the tested sample is obviously higher than the expression level in the serum of the normal sample, judging that the lipid synthesis capacity of the organism of the sample is lower. By "significant" is meant p < 0.05. The normal sample may be a sample in a diet mode where no whole grain food is consumed or the whole grain intake is lower than a comparison. The expression level in the serum of the normal sample may also be an expression level in the serum of a healthy human based on big data statistics.

The invention provides application of the microRNA marker in developing a medicament for treating obesity and other related diseases, and miR-27a-3p can be used as a target of a targeted medicament.

The invention also provides a chip or a kit for detecting the lipid metabolism capability of an organism, which comprises a microRNA chip, wherein the microRNA chip comprises a solid phase carrier and oligonucleotide probes orderly fixed on the solid phase carrier, and the oligonucleotide probes specifically detect a sequence shown in SEQ ID NO. 1. The oligonucleotide probe comprises a complementary binding region and a connecting region connected with a solid phase carrier.

In another preferred embodiment, the miRNA is isolated from a mouse. Both human and mouse have the miRNA sequence and belong to conserved miRNA.

The serum or plasma miRNA provided by the invention can be used for detecting or diagnosing the lipid metabolism capability of an organism, and can also be used for a method for evaluating whole grain diet to improve lipid metabolism, wherein the whole grain diet is a diet mode mainly comprising whole brown rice or whole wheat, for example, the whole brown rice powder or the whole wheat powder accounts for 40-60% of the mass ratio, and the method comprises the following steps:

(a) providing a test group in which a whole grain diet is administered to animals of the test group and the expression level of miR-27a in serum of the test group after administration is determined, and a control group which employs the same conditions as the test group, but does not administer the whole grain diet to animals of the control group;

(b) comparing the expression level of miR-27a in the serum of the test group with that of miR-27a in the serum of the control group;

when the expression level of miR-27a in the serum of the test group is significantly lower than that of the control group, the whole grain diet is indicated to improve the lipid metabolism of the organism.

Similarly, miR-27a-3p can be used to indicate the level of hepatic triglyceride and cholesterol after the body eats the whole grain meal, to assess the condition of hepatic fat synthesis after the body eats the whole grain meal, to assess the condition of hepatic fat accumulation after the body eats the whole grain meal, to assess the condition of intestinal fat synthesis after the body eats the whole grain meal, and to determine whether the body eats the whole grain meal.

The present invention also provides a kit for assessing whole grain diet-improved lipid metabolism, comprising: a reagent for extracting serum miRNA, a reagent for reverse transcription of RNA, and a reagent for real-time quantitative PCR detection of miRNA content shown in SEQ ID NO. 1. The whole grain diet refers to a diet mode mainly comprising whole brown rice or whole wheat. Optionally, the primer for reverse transcription of the sequence shown in SEQ ID NO. 1 is shown in SEQ ID NO: 2, respectively. Optionally, the primer for PCR amplification of the sequence shown in SEQ ID NO. 1 is shown in SEQ ID NO: 3. SEQ ID NO: 4, respectively.

[ advantageous effects ]

Compared with triglyceride and cholesterol in blood, the body lipid synthesis capability marker miR-27a provided by the invention can discover the change of the body lipid synthesis capability earlier. When the content of miR-27a in the blood sample to be detected is higher than that of a normal sample, prompting that the lipid synthesis capacity of the organism of the blood sample to be detected is higher; and when the content of miR-27a in the blood sample to be detected is lower than that of the normal sample, prompting that the lipid synthesis capacity of the organism of the blood sample to be detected is lower.

The organism lipid synthesis capability marker miR-27a provided by the invention can be used for evaluating whether the commercial 'whole grain' diet is truly whole grain. If the level of miR-27a in a blood sample of a mouse eating a "whole grain" diet is reduced compared to a mouse eating a conventional diet, it is suggested that the "whole grain" diet is indeed a whole grain diet capable of regulating body lipid synthesis.

The body lipid synthesis capability marker miR-27a provided by the invention can also be used for developing a medicament for treating obesity and other related diseases, and can be used as a target of a targeted medicament.

Drawings

The features, objects, and advantages of the present invention will become more apparent by referring to the following drawings.

Figure 1 changes in serum, hepatic triglycerides, cholesterol in mice during whole grain dietary intervention. (A) Changes in triglycerides in serum; (B) changes in serum cholesterol; (C) changes in triglycerides in the liver; (D) changes in cholesterol in the liver; CS is corn starch group; BR is brown rice group; WW, Whole wheat group.

Figure 2 change in fat accumulation in mouse liver during whole grain dietary intervention. (A) HE dyeing; (B) and (5) dyeing with oil red O. CS is corn starch group; BR is brown rice group; WW, Whole wheat group.

Figure 3 change in fat synthesis in mouse liver in whole grain dietary intervention. (A) mRNA expression changes of HMGCR, FASN; (B) protein expression changes of HMGCR and FASN and quantitative analysis. CS is corn starch group; BR is brown rice group; WW, Whole wheat group.

Figure 4 change in fat synthesis in the mouse gut during whole grain dietary intervention. (A) mRNA expression changes of HMGCR, FASN; (B) protein expression changes of HMGCR and FASN and quantitative analysis. CS is corn starch group; BR is brown rice group; WW, Whole wheat group.

FIG. 5 changes in miR-27a-3p in mouse tissue organs during whole grain dietary intervention. (A) Changes in miR-27a-3p in serum; (B) changes in miR-27a-3p in white fat; (C) changes in miR-27a-3p in the liver; (D) changes in miR-27a-3p in the gut; (E) changes in miR-27a-3p in brown fat; (F) alterations in miR-27a-3p in skeletal muscle. CS is corn starch group; BR is brown rice group; WW, Whole wheat group.

FIG. 6miR-27a-3p inhibits the synthesis of liver and intestinal lipids by targeting HMGCR and FASN. (A) miR-27a-3p is aligned with an HMGCR 3' -UTR sequence; (B) miR-27a-3p inhibits the activity of a reporter gene containing HMGCR 3' -UTR; (C) the miR-27a-3p is aligned with the 3' UTR sequence of FASN; (D) miR-27a-3p inhibits the activity of a reporter gene containing FASN 3' -UTR. CS is corn starch group; BR is brown rice group; WW, Whole wheat group.

FIG. 7 changes in serum triglycerides, cholesterol and miR-27a-3p at different time points of whole grain dietary intervention. (A) Whole grain dietary intervention changes in serum triglycerides, cholesterol and miR-27a-3p at 2 weeks; (B) whole grain dietary intervention changes in serum triglycerides, cholesterol and miR-27a-3p at 4 weeks; (C) whole grain diets intervene in changes in serum triglycerides, cholesterol, and miR-27a-3p at 8 weeks. CS is corn starch group; BR is brown rice group; WW, Whole wheat group.

FIG. 8 expression of miR-27a-3p in serum of hyperlipidemic mouse. (A) Changes in triglyceride levels in serum of high-fat diet mice; (B) changes in serum cholesterol levels in high-fat diet mice; (C) the miR-27a-3p level in the serum of the high-fat diet mouse is changed; (D) normal dietary ob/ob mouse serum triglyceride level changes; (E) changes in serum cholesterol levels in normal dietary ob/ob mice; (F) the level of miR-27a-3p in serum of an ob/ob mouse in a normal diet is changed.

Detailed Description

Experimental materials and methods

(1) Mouse whole grain diet formula

TABLE 1 dietary formulations

Note: the whole grain diet formula is prepared by referring to American society for nutrition AIN-93 standard feed. The brown rice group and the whole wheat group were whole grain diet groups, and the corn starch group was a control group (i.e., normal sample).

(2) Serum sample collection and index detection

The C57BL/6 mice used in the experiments were purchased from Shanghai Si Laike laboratory animals, Inc., and the studies were approved by the animal ethics Committee of the university of south Jiangnan. The mice are raised for 8 weeks under the intervention of three different dietary modes, and then serum and tissues are collected for index detection. The kit for detecting triglyceride and cholesterol contents in serum and liver was used in WAKO of Japan.

(3) Liver HE staining and oil Red O staining

(a) HE staining of liver

Fixing: fresh livers are soaked in 4% neutral formaldehyde fixing solution for fixing, and the fixing is generally carried out for more than 24 hours.

And (3) dehydrating: the liver is respectively filled into a marked embedding box and is put into 75% ethanol I, II, 85% ethanol I, II, 95% ethanol I, II and 100% ethanol I, II in sequence for gradient dehydration for 1 h/time respectively.

And (3) transparency: placing the dehydrated liver in xylene I, II in turn to make ethanol in liver be replaced by xylene sufficiently to ensure paraffin to soak liver, each time for 1 hr.

Wax dipping: respectively preparing three parts of solid paraffin with the melting point of 50-60 ℃, putting the solid paraffin into a 60 ℃ oven for melting, and then sequentially putting the transparently treated liver into the melted paraffin I, II and III for infiltration for 1 h/time.

Embedding: the melted paraffin is dripped into the embedding mould until the bottom of the mould is fully paved with the paraffin, the liver to be embedded is fixed at the bottom of the embedding mould by using heated tweezers, then the embedding box cover is rapidly arranged on the embedding mould, and the gas is completely discharged from the liver to the embedding box by using paraffin solution. After the paraffin solution was slightly solidified, it was slowly moved to an ice bench to solidify it. And after the paraffin solution is completely solidified, taking down the embedding box embedded with the liver, and placing the embedding box in a refrigerator at the temperature of minus 20 ℃ for later use.

Slicing: the embedding box embedded with the liver is fixed on a paraffin slicer, and the wax block embedded with the sample is roughly cut until the blade cuts the liver. The thickness of the microtome was then adjusted to 3 μm and fine-cut. Taking out the intact paraffin section of the sample, flatly placing the paraffin section on the water surface at 37 ℃ by using forceps, and slicing and fishing the paraffin section after the paraffin section of the sample is completely flattened.

Baking slices: and selecting a completely unfolded sample slice, fishing up the sample slice by using a marked glass slide, and baking the sample slice on a baking machine to ensure that the water on the glass slide is completely evaporated, wherein the baking temperature is 40-50 ℃, and after the baking, placing the sample slice at room temperature for storage until the liver histomorphology is detected and analyzed.

Dewaxing and transparentizing: the liver slices were deparaffinized in xylene I, II sequentially for 3min each time. Then completely replacing xylene with high-concentration to low-concentration ethanol (100%, 90%, 80%), each time for 2min, and finally placing in distilled water for standby dyeing.

H & E staining: the sections which are completely dewaxed are placed in hematoxylin staining solution for staining for 20s, and the specific staining time is adjusted according to the staining degree observed under a lens in the preliminary experiment. After completion of the staining with hematoxylin, excess staining agent on the sections was washed with distilled water, and eosin staining was performed in the same manner.

And (3) dehydrating and transparency: the stained slices were rapidly dehydrated in a gradient from low to high concentration ethanol (80%, 90%, 100%) and finally cleared by xylene I, II for 5sec per staining jar.

Sealing: after the slide had dried, the neutral resin was dropped onto the slide and the slide was gently mounted from one side with a cover slip. After completely drying, the film can be observed and photographed under a microscope.

(b) Liver oil red O staining

Embedding fresh liver with OCT embedding medium, quickly freezing in liquid nitrogen, slicing, baking, and finally performing oil red O staining. Dyeing process: the sections were fixed with formaldehyde-calcium for 5 minutes; washing with distilled water; soaking and washing with 60% isopropanol; oil red O dye liquor for 5 minutes; 60% isopropanol was color-separated until the background was colorless; washing with distilled water; counterstaining with hematoxylin; washing (bluing) with tap water for 1-3 minutes; washing with distilled water; and (6) sealing the sheet. As a result: lipid droplets in the tissue cells appeared orange red, and the nuclei appeared blue.

(4) RNA extraction and real-time quantitative PCR detection

Serum miRNA is extracted by a serum miRNA extraction kit of Shanghai Biyuntian company. The reverse transcription of RNA is carried out by the reverse method of the neck ring structure, the RNA in other tissues is extracted by using a conventional Trizol reagent, and the reverse transcription of RNA is carried out by using TAKARA conventional reverse transcriptase. And finally, detecting the expression changes of miRNA and other mRNA in serum and other tissues by real-time quantitative PCR.

(5) Tissue protein extraction and western blot analysis

The protein in the tissue is extracted by RIPA of Shanghai Biyuntian, protein concentration is detected by BCA kit, HMGCR and FASN related antibodies are purchased from Wuhan Sanying biotechnology, Inc. and Cell Signaling Technology, respectively, and protein expression of HMGCR and FASN in liver and intestinal tract of mice is analyzed by western blot Technology.

(6) Statistical method

Comparing the differential analysis of the two experimental groups by t-test analysis, p values less than 0.05 were considered to have significant changes.

Example 1 serum marker screening

(1) Selection of serum miRNAs

miRNAs with obvious differences in whole grain dietary intervention are screened out from a serum miRNA expression profile chip, miRNAs participating in lipid metabolism are analyzed through miRNAs related databases, online data analysis software and the like, and miRNA is screened out to be miR-27a-3 p.

(2) Extraction of serum miRNA

The collected plasma was allowed to stand at 4 ℃ for 30 minutes, and then centrifuged at 4000 Xrpm for 15min at 4 ℃ to take out serum, which was stored at-80 ℃ for further use. Extraction of miRNA in serum Using RNAeasy from Biyuntian^TMThe animal RNA extraction kit (centrifugal column type) is used for extraction, and the specific steps are as follows:

a. sample treatment: to 200. mu.l of serum, 200. mu.l of lysate was added for lysis.

b. Adding the binding solution with the same volume into the centrifuge tube, and gently inverting and mixing for 3-5 times. The mixture was left at room temperature for 5min to completely separate the nucleic acid-protein complex.

c.4 ℃ centrifugation at 14,000g for 2min and transfer of the supernatant to a fresh RNase centrifuge tube.

d. The mixture (including the precipitate) was transferred to a purification column, centrifuged at 12,000g for 30 seconds, and the liquid in the collection tube was decanted.

e. Add 600. mu.l of Wash I, centrifuge for 30 seconds at 12,000g, and discard the liquid in the collection tube.

f. Add 600. mu.l of Wash II, centrifuge for 30 seconds at 12,000g, discard the liquid in the collection tube.

g. Repeating step f once.

h. The residual liquid was removed by centrifugation at the highest speed (about 14,000-16,000g) for 2 minutes.

i. Putting the RNA purification column into an RNA elution tube provided by the kit, adding 30-50 mul of eluent, standing at room temperature for 2-3 minutes, and centrifuging at the highest speed for 30 seconds to obtain a solution, namely purified RNA. Storing at-80 deg.C for use.

(3) qRT-PCR detection

a. Reverse transcription

In the experiment, a stem-loop reverse transcription system is used for miRNA reverse transcription. From miRBase: shtml finds the sequence in http:// www.mirbase.org/index as follows: miR-27a-3 p: UUCACAGUGGCUAAGUUCCGC, reverse transcription primers and universal PCR primers for this miRNA and HMGCR and FASN primer sequences are designed as shown in the following table, with U6 and GAPDH as references.

miR-27a reverse transcription primer sequence:

CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCGGAACT(SEQ ID No.2)；

miR-27a forward primer sequence (5 '-3'): ACACTCCAGCTGGGTTCACAGTGGCTA (SEQ ID No. 3);

miR-27a reverse primer sequence (5 '-3'): CTCAAGTGTCGTGGAGTCGGCAA (SEQ ID No. 4).

TABLE 2 primer sequences

Preparing a PCR reaction system:

RT-PCR reaction procedure:

1	42℃	15min
			2	42℃	1min
3	42℃	0min

after the reverse transcription is finished, the cDNA is diluted by 10 times, mixed evenly and stored at the temperature of minus 20 ℃ for standby.

b.Real-time PCR

The internal reference used for relative quantification of serum mirnas was U6.

Reaction system and procedure:

example 2 detection of expression of proteins involved in lipid synthesis in liver and intestinal tract

Mice were bred for 8 weeks under intervention of three different dietary patterns (CS, BR, WW), and then serum and tissue were collected for index detection. The kit for detecting triglyceride and cholesterol contents in serum and liver was used in WAKO of Japan.

(1) Extraction of liver and intestinal tissue proteins: the cells or a quantity of mouse liver tissue is collected and lysed or homogenized in RIPA lysate containing protease inhibitors and phosphatase inhibitors. Placing on ice for 30 minutes, centrifuging at 14,000rpm and 4 ℃ for 20 minutes, and collecting supernatant solution which is the total protein of the tissue; RIPA lysate: 50mM Tris-HCl, pH 7.4; 150mM NaCl; 1mM EDTA; 1% Tritonx-100; a protease inhibitor; a phosphatase inhibitor.

(2) Preparing a sample: after the protein concentration was determined using the BCA kit, the protein was adjusted to the same concentration. Adding sample buffer solution, decocting at 100 deg.C for 5min, and storing at-80 deg.C or performing sample electrophoresis;

(3) electrophoresis: a10% SDS polyacrylamide gel was prepared and loaded with protein in an amount of 40. mu.g-80. mu.g per sample. Performing 140V constant-voltage electrophoresis until the bromophenol blue at the front end runs out of the bottom of the gel;

(4) film transfer: soaking a PVDF membrane in methanol for 1 minute, then placing the PVDF membrane and glue in a membrane transferring solution together for balancing for 5 minutes, then placing the PVDF membrane and glue in the order of anode-sponge-two layers of filter paper-PVDF membrane-glue-two layers of filter paper-sponge-cathode, placing the PVDF membrane and glue in a wet membrane transferring instrument, embedding the PVDF membrane in ice, and transferring the PVDF membrane for 3 hours at 300 mA;

(5) and (3) sealing: and taking out the PVDF membrane, putting the PVDF membrane into ponceau red dye liquor for dyeing, washing off redundant dye by using deionized water, observing the protein membrane transfer effect, and shearing the membrane according to the corresponding position. Sealing 5% skimmed milk for 1 hr;

(6) a first antibody: adding the antibody diluted with 5% BSA at a suitable ratio, and shaking horizontally overnight at 4 deg.C;

(7) washing the membrane: recovering the antibody, washing the membrane with TBST for 5min 3 times;

(8) secondary antibody: adding corresponding secondary antibody (1:3000) diluted by 5% skimmed milk, and incubating at room temperature for 1 hour;

(9) washing the membrane: removing the secondary antibody, washing the membrane with TBST for 3 times, 5 minutes each time;

(10) and (4) photographing and storing by using a protein gel imaging system.

Note: the primary antibodies of HMGCR, FASN and GAPDH are selected as internal references in the process.

Results of the experiment

1. Whole grain diets reduced triglyceride and cholesterol levels in serum and liver in mice

Serum and liver samples of mice with different dietary patterns are collected, and the content of triglyceride and cholesterol in the samples is detected by using the kit. As shown in fig. 1 and table 3, the levels of triglyceride (fig. 1(a)) and cholesterol (fig. 1(B)) in serum were significantly reduced in BR and WW groups, respectively by 29.0%, 21.5%, and 11.7%, 22.2%, as compared to CS group. At the same time, the levels of triglyceride (fig. 1(C)) and cholesterol (fig. 1(D)) in the liver were also significantly reduced in the BR and WW groups by 24.5%, 23.2% and 18.3%, 20.4%, respectively.

TABLE 3 Effect of the Whole grain diet on triglyceride, cholesterol in mouse serum and liver

2. Whole grain diet reduces lipid accumulation in mouse liver

Liver samples from mice from different diet groups were collected and observed by HE staining, oil red O staining, histomorphology of the liver under whole grain dietary intervention, with a high number of fat vacuoles and fat droplet scatter in the CS group visual field, and conversely less in the BR and WW groups (fig. 2 (a)). Oil red O staining further confirmed this result. The red areas stained with oil red O were significantly smaller in both BR and WW groups compared to CS group (fig. 2 (B)). These visual results show that the whole grain diet is associated with lipid metabolism and can improve liver lipid deposition.

3. The whole grain diet reduced fat synthesis in liver and intestinal tract of mice

The liver and intestinal tract are the major sites of triglyceride and cholesterol synthesis, while HMGCR is the rate-limiting enzyme of cholesterol biosynthesis, and FASN is the key enzyme of fatty acid synthesis. The mRNA and protein expression of HMGCR and FASN in liver was significantly decreased in BR group and WW group compared to CS group by qRT-PCR and western blot analysis (fig. 3(a) & fig. 3(B)), and the expression of HMGCR and FASN in intestinal tract was also significantly decreased (fig. 4(a) & fig. 4 (B)). Thus, a whole grain diet may improve lipid metabolism to some extent by inhibiting fat synthesis.

4. Correlation of serum miR-27a-3p and body lipid synthesis

Serum of a mouse under the intervention of the whole grain diet is collected, and serum miRNAs biomarkers of the whole grain diet regulation and control of lipid metabolism are screened out through sequencing of the mouse serum miRNAs and inquiry of miRNAs related database. Sequencing of serum miRNAs we screened 136 miRNAs that changed significantly in the whole grain diet. Further analysis revealed that 16 of these miRNAs showed the same trend of change in both BR and WW groups.

Next, we performed KEGG and GO analysis on the 16 miRNAs by the online miRNAs related analysis software DIANA-miRPath v3.0(http:// www.microrna.gr/miRPath v3) and found that miR-27a-3p and miR-690 are involved in regulating lipid metabolism under whole grain dietary intervention. Through online Metabioanalyser software (version 4.0; https:// www.metaboanalyst.ca /) miRNAs are subjected to PLS-DA analysis, and the VIP score of miR-27a-3p is higher than that of miR-690, so that the contribution degree of miR-27a-3p to whole grain diet regulation of body lipid metabolism is larger, and miR-27a-3p can be used for detecting the mouse lipid metabolism capability.

5. Evaluation of serum miR-27a-3p as body lipid synthesis capability marker

Under the whole grain dietary intervention, miR-27a-3p in the BR and WW groups was found to be significantly reduced in serum, white fat (fig. 5(a) & fig. 5(B)) and significantly increased in liver, intestinal tract (fig. 5(C) & fig. 5(D)) compared to the CS group by qRT-PCT analysis, with no significant change in brown fat and skeletal muscle (fig. 5(E) & fig. 5 (F)).

Further, it was found that the 3' UTR of both HMGCR and FASN contained highly conserved miR-27a-3p binding sites as determined by TargetScanHuman (http:// www.targetscan.org/vert-72 /) (FIG. 6(A) & FIG. 6 (C)). By studying luciferase reporter activities of miR-27a-3p on HMGCR and FASN 3 '-UTR-containing HEK293T cells, it was found that miR-27a-3p mimic transfection inhibited luciferase activities of both HMGCR and FASN 3' -UTR reporters (FIG. 6(B), FIG. 6(D)), respectively. Therefore, the serum miR-27a-3p can be utilized by receptor cells in the liver to inhibit the synthesis of cholesterol and fatty acid so as to regulate and control lipid metabolism, and the serum miR-27a-3p is a new biomarker for regulating and controlling lipid synthesis in whole grain diet.

Example 3 use of miR-27a-3p for testing and evaluating lipid metabolism ability of mice at different time points

Mice were kept for 8 weeks under intervention of three different dietary patterns (CS, BR, WW).

(a) And detecting the expression level of miR-27a-3p and the content of triglyceride and cholesterol in the serum or plasma of the sample at 2 weeks, 4 weeks and 8 weeks of whole grain dietary intervention.

(b) And (b) judging the levels (contents) of triglyceride, cholesterol and miR-27a-3p in serum or plasma of the detected sample at different time points after eating the whole grain meal according to the detection result of the step (a), and evaluating the sensitivity of the miR-27a-3p to lipid metabolism. The judging method comprises the following steps: the expression level of miR-27a-3p and the content of triglyceride and cholesterol in serum or plasma are respectively detected at 2 weeks, 4 weeks and 8 weeks of whole grain dietary intervention, and are respectively compared with a control group (a corn starch group), and the change trend of the p value is tested (the smaller the p value is, the more obvious the change is). If miR-27a-3p can detect the decrease of miR-27a-3p at an early time node, and triglyceride and cholesterol do not have significant changes at the early time node but decrease at a later time node, the sensitivity of miR-27a-3p for whole grain diet regulation and control of lipid metabolism is higher, and the change of body lipid can be detected at an early time.

Specifically, as shown in fig. 7(a), at 2 weeks of whole grain dietary intervention, the expression level of miR-27a-3p in serum of the sample was significantly lower than that of 6.2% or 5.6% of the normal sample (p <0.05), with only 0.5% or 2.7% reduction in serum triglyceride level and only 0.4% or 2.9% reduction in serum cholesterol level (p > 0.05); as shown in fig. 7(B), at 4 weeks of whole grain dietary intervention, miR-27a-3p expression levels in serum of the samples were significantly lower than 5.5% or 5.0% of normal samples (p <0.01), with levels of triglycerides in serum significantly reduced by 4.0% or 4.2% (p <0.05), and levels of cholesterol in serum significantly reduced by 4.6% or 4.3% (p < 0.05); as shown in fig. 7(C), at 8 weeks of whole grain dietary intervention, miR-27a-3p expression levels in serum of the samples were significantly lower than 57.9% or 42.8% of normal samples (p <0.01 or p <0.001), with a significant decrease in triglyceride levels of 28.7% or 22.0% in serum (p <0.01) and a significant decrease in cholesterol levels of 11.8% or 22.2% in serum (p < 0.01). From the data, miR-27a-3p in the serum can detect the change trend of lipid metabolism of the organism at an earlier time point, and the sensitivity is higher than that of detecting triglyceride and cholesterol in the serum.

Example 4 expression of miR-27a-3p in serum of hyperlipidemic mouse

Detecting the change of miR-27a-3p, triglyceride and cholesterol in the serum of a high-fat diet and an obese mouse, and evaluating the expression condition of the miR-27a-3p in the serum of the hyperlipidemic mouse.

Specifically, in a control experiment, a control group of mice is fed with a common normal feed, an experimental group is fed with a 60% high-fat feed, after 8 weeks of dietary intervention, mouse serum is collected, and the expression condition of miR-27a-3p in the serum and the level change of triglyceride and cholesterol are detected. As a result, the triglyceride and cholesterol levels in the serum of the high-fat diet mice were increased by 17.1% and 78.5%, respectively, as compared with the normal diet mice (FIG. 8(A) & FIG. 8(B)), while the level of miR-27a-3p in the serum was not decreased but increased by 13.1% (FIG. 8 (C)); in contrast, in the normal mice and ob/ob mice fed with the normal diet for 8 weeks, the levels of triglyceride and cholesterol in the serum of ob/ob mice were found to be increased by 43.7% and 107.6%, respectively, as compared with those of the normal wild-type mice (FIG. 8(D) & FIG. 8(E)), while the level of miR-27a-3p in the serum was not decreased but increased by 71.8% (FIG. 8 (F)).

Example 5 chip or kit for testing the lipid metabolism ability of an organism

The chip or the kit for detecting the lipid metabolism capability of an organism contains a microRNA chip, wherein the microRNA chip comprises a solid phase carrier and oligonucleotide probes orderly fixed on the solid phase carrier, and the oligonucleotide probes specifically detect a sequence shown in SEQ ID NO. 1. The oligonucleotide probe comprises a complementary binding region and a connecting region connected with a solid phase carrier.

Example 6A method for assessing the improvement of lipid metabolism in the body by a whole grain diet

(a) Providing a test group in which a whole grain diet is administered to animals of the test group and the expression level of miR-27a-3p in serum of the test group is determined after the administration, and a control group which uses the same conditions as the test group except that the whole grain diet is not administered to the animals of the control group (CS);

(b) comparing the expression level of miR-27a in the serum of the test group with the expression level of miR-27a-3p in the serum of the control group;

when the expression level of miR-27a-3p in the serum of the test group is significantly lower than that of the control group, the whole grain diet is indicated to improve the lipid metabolism of the organism.

Example 7 method for indicating changes in serum or plasma triglyceride, cholesterol levels following a Whole grain diet for a body by miR-27a-3p

(a) Detecting the expression level of miR-27a-3p in sample serum;

(b) according to the detection result in the step (a), judging the level content of triglyceride and cholesterol in serum or plasma of the detected sample after eating the whole grain meal, wherein the judging method comprises the following steps: and if the expression level of miR-27a-3p in the serum of the test group is obviously lower than that in the serum of a normal sample, judging that the content of triglyceride and cholesterol in the serum of the test sample is obviously reduced after the test sample is eaten by the whole grain diet.

Specifically, when the expression level of miR-27a-3p in the serum of the sample is significantly lower than 42.8% or 57.9% of that of a normal sample, the content of triglyceride in the serum or the plasma is significantly reduced by 21.5% or 29.0%, and the content of cholesterol in the serum or the plasma is significantly reduced by 22.2% or 11.7%.

Example 8 method for indicating the level of hepatic triglyceride, cholesterol levels after a body consumes a whole grain diet using miR-27a-3p

(a) Detecting the expression level of miR-27a-3p in sample serum;

(b) according to the detection result in the step (a), judging the level contents of triglyceride and cholesterol in the liver after the detected sample eats the whole grain meal, wherein the judging method comprises the following steps: and if the expression level of miR-27a-3p in the serum of the test group is obviously lower than that in the serum of a normal sample, judging that the level contents of triglyceride and cholesterol in the liver of the test sample are obviously reduced after the test sample eats the whole grain meal.

Specifically, when the expression level of miR-27a-3p in the serum of the sample is significantly lower than 42.8% or 57.9% of that of a normal sample, the content of triglyceride in the liver is significantly reduced by 20.4% or 20.6%, and the content of cholesterol in the liver is significantly reduced by 23.2% or 24.5%.

Example 9 method of miR-27a-3p for assessing liver fat synthesis after a body consumes a whole grain diet

(a) Detecting the expression level of miR-27a in sample serum;

(b) judging the change of fat synthesis in the liver after the detected sample eats the whole grain meal according to the detection result in the step (a), wherein the judging method comprises the following steps: and if the expression level of miR-27a in the serum of the test group is obviously lower than that in the serum of the normal sample, judging that the fat synthesis level in the liver of the test sample is obviously reduced after the test sample eats the whole grain diet.

Specifically, when the expression level of miR-27a in the serum of the sample is significantly lower than 42.8% or 57.9% of that of a normal sample, the expression level of enzymes (such as HMGCR and FASN) related to fat synthesis in the liver is significantly reduced, which indicates that the fat synthesis level in the liver is significantly reduced.

Example 10 method of miR-27a-3p for assessing liver fat accumulation after a body consumes a whole grain diet

(a) Detecting the expression level of miR-27a-3p in sample serum;

(b) according to the detection result of the step (a), evaluating the liver fat accumulation condition of the organism after eating the whole grain meal, wherein the evaluation method comprises the following steps: and if the expression level of miR-27a-3p in the serum of the test group is obviously lower than that in the serum of a normal sample, judging that the fat accumulation in the liver of the test sample is obviously reduced after the test sample eats the whole grain diet.

Specifically, when the expression level of miR-27a-3p in the serum of the sample is significantly lower than 42.8% or 57.9% of that of a normal sample, the fat vacuole in the liver is reduced and the content of fat droplets is reduced through HE (high intensity intrinsic lymphocyte) staining or oil red O (oil red O) staining, which indicates that the fat accumulation in the liver is reduced.

Example 11 method of miR-27a-3p for assessing intestinal fat synthesis in a subject following a whole grain diet, comprising the steps of:

(a) detecting the expression level of miR-27a-3p in sample serum;

(b) judging the change of fat synthesis in the intestinal tract after the detected sample eats the whole grain meal according to the detection result in the step (a), wherein the judging method comprises the following steps: and if the expression level of miR-27a-3p in the serum of the test group is obviously lower than that in the serum of a normal sample, judging that the fat synthesis level in the intestinal tract of the test sample is obviously reduced after the test sample eats the whole grain diet.

Specifically, when the expression level of miR-27a-3p in the serum of the sample is significantly lower than 42.8% or 57.9% of that of a normal sample, the expression level of enzymes (such as HMGCR and FASN) related to fat synthesis in the intestinal tract is significantly reduced, which indicates that the fat synthesis level in the intestinal tract is significantly reduced.

Example 12 method of miR-27a-3p for determining whether a body consumes a whole grain diet

(a) Detecting the expression level of miR-27a-3p in sample serum;

(b) judging whether the detected sample is eaten by the whole grain meal according to the detection result of the step (a), wherein the judging method comprises the following steps: and if the expression level of miR-27a-3p in the serum of the test group is lower than that in the serum of the normal sample, judging that the test sample is eaten by the whole grain diet.

Specifically, if the expression level of miR-27a-3p in the serum of the sample is lower than 42.8% of that of a normal sample, preferably lower than 57.9% of that of the normal sample, the detection sample is judged to eat the whole grain diet.

Example 13A kit for assessing improvement in lipid metabolism of a Whole grain diet

A kit for assessing whole grain diet improves lipid metabolism comprising: a reagent for extracting serum miRNA, a reagent for reverse transcription of RNA, and a reagent for real-time quantitative PCR detection of miRNA content shown in SEQ ID NO. 1. The whole grain diet refers to a diet mode mainly comprising whole brown rice or whole wheat. The primer for reverse transcription of the sequence shown in SEQ ID NO. 1 is shown as SEQ ID NO: 2, respectively. The primer for PCR amplification of the sequence shown in SEQ ID NO. 1 is shown as SEQ ID NO: 3. SEQ ID NO: 4, respectively.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> miRNA markers for lipid synthesis capacity under whole grain diet

<130> BAA200885A

<160> 15

<170> PatentIn version 3.3

<210> 1

<211> 21

<212> DNA

<213> mice

<400> 1

uucacagugg cuaaguuccg c 21

<210> 2

<211> 44

<212> DNA

<213> Artificial sequence

<400> 2

ctcaactggt gtcgtggagt cggcaattca gttgaggcgg aact 44

<210> 3

<211> 27

<212> DNA

<213> Artificial sequence

<400> 3

acactccagc tgggttcaca gtggcta 27

<210> 4

<211> 23

<212> DNA

<213> Artificial sequence

<400> 4

ctcaagtgtc gtggagtcgg caa 23

<210> 5

<211> 44

<212> DNA

<213> Artificial sequence

<400> 5

ctcaactggt gtcgtggagt cggcaattca gttgaggcgg aact 44

<210> 6

<211> 44

<212> DNA

<213> Artificial sequence

<400> 6

ctcaactggt gtcgtggagt cggcaattca gttgagaaaa tatg 44

<210> 7

<211> 27

<212> DNA

<213> Artificial sequence

<400> 7

acactccagc tgggttcaca gtggcta 27

<210> 8

<211> 30

<212> DNA

<213> Artificial sequence

<400> 8

acactccagc tgggcgcaaa ttcgtgaagc 30

<210> 9

<211> 23

<212> DNA

<213> Artificial sequence

<400> 9

ctcaagtgtc gtggagtcgg caa 23

<210> 10

<211> 21

<212> DNA

<213> Artificial sequence

<400> 10

agcttgcccg aattgtatgt g 21

<210> 11

<211> 23

<212> DNA

<213> Artificial sequence

<400> 11

tctgttgtga accatgtgac ttc 23

<210> 12

<211> 21

<212> DNA

<213> Artificial sequence

<400> 12

ggaggtggtg atagccggta t 21

<210> 13

<211> 21

<212> DNA

<213> Artificial sequence

<400> 13

tgggtaatcc atagagccca g 21

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence

<400> 14

acatcatccc tgcatccact 20

<210> 15

<211> 19

<212> DNA

<213> Artificial sequence

<400> 15

gtcctcagtg tagcccaag 19

Claims

1. A marker useful for detecting or diagnosing the lipid synthesis ability of a body, characterized by having a sequence represented by any one of (1) to (3):

(1) miRNA with sequence shown as SEQ ID NO. 1;

(2) a miRNA complementary to the miRNA sequence shown in (1);

(3) miRNA containing sequence segment in (1) or (2).

2. A marker useful in the detection or diagnosis of the lipid synthesis capacity of a body according to claim 1, wherein the body comprises: human, mouse, chimpanzee.

3. A marker useful for detecting or diagnosing the lipid synthesis capacity of a body according to claim 1, wherein the lipid synthesis capacity is: the level or ability of the liver, the gut to synthesize or accumulate cholesterol and triglycerides.

4. Use of the marker of claim 1 for the development of a medicament for the treatment of diseases associated with obesity and the like.

5. The use according to claim 4, wherein the marker is targeted to a targeted drug.

6. The chip or the kit for detecting the lipid metabolism capability of an organism is characterized by comprising a microRNA chip, wherein the microRNA chip comprises a solid phase carrier and oligonucleotide probes orderly fixed on the solid phase carrier, and the oligonucleotide probes specifically detect a sequence shown by SEQ ID NO. 1 or a sequence complementary to SEQ ID NO. 1.

7. The chip or the kit for detecting the lipid metabolism ability of the body according to claim 6, wherein the oligonucleotide probe comprises a complementary binding region and a linking region linked to a solid support.

8. A kit for assessing whole grain diet improved lipid metabolism, comprising: a reagent for extracting serum miRNA, a reagent for reverse transcription of RNA, and a reagent for real-time quantitative PCR detection of miRNA content shown in SEQ ID NO. 1.

9. The kit of claim 8, wherein the whole grain diet refers to a diet pattern based on whole brown rice or whole wheat.

10. The kit for assessing improvement of lipid metabolism by a whole grain diet according to claim 9,

the primer for reverse transcription of the sequence shown in SEQ ID NO. 1 is shown as SEQ ID NO: as shown in figure 2, the first and second,

the primer for PCR amplification of the sequence shown in SEQ ID NO. 1 is shown as SEQ ID NO: 3. SEQ ID NO: 4, respectively.