CN112111530B - Method for researching muscle growth by conditional induction of tcf3a gene knockout in zebra fish - Google Patents

Abstract

The invention discloses a method for researching muscle growth by conditional induction of tcf3a gene knockout in zebra fish, which comprises the following steps: (1) preparing a tcf3a conditional knockout strain using non-homologous end joining; (2) constructing a transposon mediated expression plasmid marker muscle cell; (3) simultaneous marker plasmid and Cre mRNA injection into conditioned knockout embryos of tcf3a achieved tcf3a knockdown and muscle development and growth was observed and evaluated by fluorescence. The invention can study the growth and development of muscle in vivo and conditionally. According to the invention, the zebra fish with the tcf3a conditionally knocked out and the zebra fish with the specifically labeled rapid skeletal muscle cells are combined, so that the method for researching the muscle growth by knocking out tcf3a after the conditioned induction of the living body can be well realized.

Description

Method for researching muscle growth by conditional induction of tcf3a gene knockout in zebra fish

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a method for researching muscle growth by conditional induction of tcf3a gene knockout in zebra fish.

Background

The zebrafish tcf3a gene (designated in the literature as E12) is very important for skeletal muscle formation (see reference 1). The promoter of the mylpfa gene is used for specifically marking the fast skeletal muscle cells, and the method is a very good living body marking method for researching the muscle formation.

Currently, there is no conditional induction method for this gene in zebrafish to study muscle formation.

Disclosure of Invention

The invention aims to provide a method for researching muscle development and growth by realizing conditional induction of tcf3a knockout in zebrafish through manipulation of tcf3a gene and fluorescent labeling of muscle cells.

The purpose of the invention is realized by the following technical scheme: the invention discloses a method for researching muscle growth by conditional induction of tcf3a gene knockout in zebra fish, which comprises the following steps:

(1) searching specific recognition sites of two nucleases in introns at two ends of the 4 th exon of the zebra fish tcf3a, wherein the specific recognition sites are a sgRNA1 target spot and a sgRNA2 target spot;

(2) constructing a non-homologous end-linked knock-in plasmid, wherein the knock-in plasmid contains a left homologous arm and a right homologous arm, the left homologous arm contains one nuclease recognition site sgRNA1, the right homologous arm contains the other nuclease recognition site sgRNA2, an exogenous gene sequence to be replaced is contained between the left arm and the right arm, and the exogenous gene sequence comprises loxP sites on two sides of a 4 th exon and a myocardial cell marker red fluorescent protein capable of being used for screening; injecting a nuclease system into the fertilized eggs of the zebra fish by microinjection; culturing the injected fertilized eggs into fish, and confirming the conditional knockout of the zebra fish by the tcf3a through fluorescence and genotype identification;

(3) constructing an expression plasmid for marking the muscle of the zebra fish, wherein the expression plasmid drives CFP fluorescent protein to express by using a zebra fish mylpfa promoter, and transposon sequences are added at two ends;

(4) the above-described marker plasmid, Cre mRNA and the mRNA of tol2 transposase were co-injected into embryos generated by crossing in tcf3a conditional knockout lines, and zebrafish embryos were used after 3 days to identify deletion of tcf3a, overall phenotypic observation and phenotypic observation of muscle.

Further, in step (1), the nucleases are CRIPSR nuclease and Cas9 nuclease.

Further, in step (2), the nuclease system includes Cas9 protein or mRNA producing Cas9 protein, sgRNA1 and sgRNA2, tcf3a knock-in plasmids.

Further, in step (2), the target sequence of sgRNA1 is: GGACGCAGCTATCAGTGGCGT, respectively; the target sequence of sgRNA2 is: GCTGGTCTAGTGCTGATCTC are provided.

Further, in the step (2), the sequence of the left homology arm is shown in SEQ ID NO:1, and the sequence of the right homologous arm is shown as SEQ ID NO:1, 3253-3676, and the sequence of the exogenous gene needing to be replaced between the right arms is shown as SEQ ID NO:1, 543-th position 2710.

Further, in the step (2), constructing a left homologous arm and a right homologous arm of the knock-in plasmid connected with the non-homologous ends, taking a zebra fish genome as a template, and adding enzyme cutting sites and protective bases into a PCR primer for amplification to obtain the zebra fish genome; a sequence between two loxP sites of the fourth exon takes a zebra fish genome as a template, a loxP-tcf3a _ exon4-frt fusion sequence is obtained by amplifying a loxP and frt fusion sequence PCR primer, and the PCR primer is added with a restriction enzyme site and a protective base; the red fluorescent protein sequence can be marked by the screened cardiac muscle cells, the loxP-myl7-DsRed-pA-frt fusion sequence is obtained by amplifying the fusion sequence PCR primer of loxP and frt, and the PCR primer is added with the enzyme cutting site and the protective basic group.

Further, in step (2), knock-in donor plasmids were prepared and zebrafish zygotes were injected and screened for conditional knock-in strains that yielded tcf3 a.

Further, in the step (3), the sequence of the zebrafish mylpfa promoter is shown as SEQ ID NO: 2, and the ECFP sequence is shown as SEQ ID NO: 2558 and 3277 in FIG. 2.

Has the advantages that: the invention can study the growth and development of muscle in vivo and conditionally. According to the invention, the zebra fish with the tcf3a conditionally knocked out and the zebra fish with the specifically labeled rapid skeletal muscle cells are combined, so that the method for researching the muscle growth by knocking out tcf3a after the conditioned induction of the living body can be well realized.

The invention has the following advantages:

(1) the method provided by the invention is applied to research on the muscle growth and development of zebra fish, can induce the knockout of the tcf3a gene at different times, can research the effect of tcf3a in the muscle growth and development in different development stages, and is a latest method for applying an inducible gene knockout technology to muscle research.

(2) The invention utilizes zebra fish living model and observes the growth and differentiation of muscle cells by a fluorescent protein labeling method.

Drawings

For ease of illustration, the invention is described in detail by the following specific examples and figures:

FIG. 1 is a schematic diagram of the integration of the dual loxP sites into zebrafish tcf3a gene using non-homologous recombination as a mediator in accordance with the present invention;

the zebrafish tcf3a gene (also known as E12) plays an important role in early developmental stage muscle development (Chong et al, 2007). sgRNA1 and sgRNA2 targets are indicated by red or blue arrows, respectively. In the tcf3a conditioned donor (tcf3a-loxP-exon4-frt-SM-frt-loxP), two loxP sites and homology arms (double-arrowed brown line) were added. The left and right arms are 530bps and 424bps long, respectively. To reduce the effort of intensive screening for conditional alleles, a selectable marker (SM, 1.2kb) can express DsRed under the control of the myl7 promoter in the reverse direction of transcription compared to tcf3 a. SM is also flanked by frt recombination sites and can therefore be excised by Flp recombinase. Zebrafish tcf3a had 19 exons and E4 (exon 4) contained 68 bps. After co-injection of donors with sgRNA1, sgRNA2 and zCas9 mRNA, endogenous E4 was replaced by tcf3a-loxP-exon4-frt-SM-frt-loxP at the tcf3a site. Black short arrows indicate primers used for validation (F1, R1, F2, R2).

FIG. 2 is a graph of PCR and phenotypic characterization of a tcf3a conditional knockout line of the invention following Cre mRNA injection; C) no ("-Cre") or ("+ Cre") Cre mRNA was injected at the single cell stage into the cell at the heterozygote Ki (tcf3 a)^f1) Mated embryos were subjected to PCR analysis. The red arrow indicates the product at 1.0kb, which is in principle excised from the original 3.9kb fragment by Cre. (D and E)2.5-dpf Ki (tcf3 a)^fl/+) Brightfield images of mating-produced embryos at the single-cell stage (D) with or without (E) Cre mRNA injection, show that Cre mRNA injection results in loss of DsRed expression in the heart (inset D, ratio 80/82) and defects in overall morphology (D, ratio 21/82). Scale bar: 250 μm (D, E).

FIG. 3 is a graph of the phenotypic characterization of the tcf3a conditional knockout line of the invention after plasmid injection of Cre mRNA and labeled muscle cells; no ("-Cre") or ("+ Cre") Cre mRNA was injected at the single cell stage into the cell at the heterozygote Ki (tcf3 a)^f1) The embryos were mated and injected simultaneously with mylpfa-ECFP plasmid, which labeled muscle cells. Fluorescence images of embryos developed to 2.5dpf, showing that Cre mRNA injection results in defects in growth and development of muscle cells.

Detailed Description

The present invention is further illustrated in detail by the following examples, but it should be noted that the scope of the present invention is not limited by these examples at all.

The invention discloses a method for researching muscle growth by conditional induction of tcf3a gene knockout in zebra fish, which comprises the following steps:

(1) searching specific recognition sites of two nucleases in introns at two ends of the 4 th exon of the zebra fish tcf3a, wherein the specific recognition sites are a sgRNA1 target spot and a sgRNA2 target spot; the nuclease is CRIPSR nuclease and Cas9 nuclease.

(2) Constructing a non-homologous end-linked knock-in plasmid, wherein the knock-in plasmid contains a left homologous arm and a right homologous arm, the left homologous arm contains one nuclease recognition site sgRNA1, the right homologous arm contains the other nuclease recognition site sgRNA2, an exogenous gene sequence to be replaced is contained between the left arm and the right arm, and the exogenous gene sequence comprises loxP sites on two sides of a 4 th exon and a myocardial cell marker red fluorescent protein capable of being used for screening; injecting a nuclease system into the fertilized eggs of the zebra fish by microinjection; culturing the injected fertilized eggs into fish, and confirming the conditional knockout of the zebra fish by the tcf3a through fluorescence and genotype identification;

the nuclease system comprises Cas9 protein or mRNA for generating Cas9 protein, sgRNA1 and sgRNA2, tcf3a knock-in plasmids.

The target sequence of sgRNA1 is: GGACGCAGCTATCAGTGGCGT, respectively; the target sequence of sgRNA2 is: GCTGGTCTAGTGCTGATCTC are provided.

The sequence of the left homologous arm is shown as SEQ ID NO:1, and the sequence of the right homologous arm is shown as SEQ ID NO:1, 3253-3676, and the sequence of the exogenous gene needing to be replaced between the right arms is shown as SEQ ID NO:1, 543-th position 2710.

Constructing a left homologous arm and a right homologous arm of a knock-in plasmid connected with a non-homologous end, taking a zebra fish genome as a template, and adding a restriction enzyme site and a protective base into a PCR primer for amplification to obtain the zebra fish genome; a sequence between two loxP sites of the fourth exon takes a zebra fish genome as a template, a loxP-tcf3a _ exon4-frt fusion sequence is obtained by amplifying a loxP and frt fusion sequence PCR primer, and the PCR primer is added with a restriction enzyme site and a protective base; the red fluorescent protein sequence can be marked by the screened cardiac muscle cells, the loxP-myl7-DsRed-pA-frt fusion sequence is obtained by amplifying the fusion sequence PCR primer of loxP and frt, and the PCR primer is added with the enzyme cutting site and the protective basic group.

Knock-in donor plasmids were prepared and zebrafish zygotes were injected and screened for conditional knock-in strains that yielded tcf3 a.

(3) Constructing an expression plasmid for marking the muscle of the zebra fish, wherein the expression plasmid drives CFP fluorescent protein to express by using a zebra fish mylpfa promoter, and transposon sequences are added at two ends; the sequence of the zebrafish mylpfa promoter is shown as SEQ ID NO: 2, and the ECFP sequence is shown as SEQ ID NO: 2558 and 3277 in FIG. 2.

(4) The above-described marker plasmid, Cre mRNA and the mRNA of tol2 transposase were co-injected into embryos generated by crossing in tcf3a conditional knockout lines, and zebrafish embryos were used after 3 days to identify deletion of tcf3a, overall phenotypic observation and phenotypic observation of muscle.

Example 1

The design idea of the invention is as follows:

1. designing specific guide RNA aiming at the sequences at both sides of the target segment of the target gene.

2. PDM-19T is used as a framework to construct donor plasmids. The plasmid comprises three parts: left arm sequence, exogenous sequence and right arm sequence. The sequence of the left arm is the genomic sequence 5' upstream of the segment of interest and comprises the left guide RNA target sequence. The left arm sequence is followed by the exogenous sequence. Next is the right arm, the 3' downstream sequence of the right arm target segment, and contains the guide RNA target sequence on the right.

3. The above synthesized guide RNA and donor plasmid, together with optimized zebrafish Cas9 mRNA, were co-microinjected into one-cell stage zebrafish zygotes and further screened for conditional knockout lines.

4. Constructing a transgenic plasmid mylpfa-ECFP for marking muscle cells of the zebra fish;

5. simultaneously microinjecting the transgenic plasmids mylpfa-ECFP and Cre mRNA into embryos generated by conditional knockout heterozygote internal crossing of tcf3a, and identifying and analyzing the phenotype of muscle growth and development of zebrafish.

Example 2

Materials and methods:

1. construction of a knock-in Donor plasmid for loxP-tcf3a _ exon4-frt-SM-frt-loxP

The genome of zebra fish and DsRed plasmid marking the heart of zebra fish are taken as templates, and loxP-tcf3a _ exon4-frt-SM-frt-loxP fusion sequences are obtained by PCR primer amplification of the loxP and frt fusion sequences. Adding enzyme cutting sites and protecting bases into the PCR primer.

LF：ctcGGTACCCTCCTGTCAGTCAGTCAGTC(SEQ ID NO:3)

LR：tatGAGCTCATGCGATTTGGGACGCAGCT(SEQ ID NO:4)

MF：CATGAGCTCataacttcgtatagcatacattatacgaagttatacttatgcactattctacgc(SEQ ID NO:5)

MR：taagcatgcgaagttcctatactttctagagaataggaacttccactaaacatgatcaactaa(SEQ ID NO:6)

SM-F:ttcgcatgcttaagatacattgatgagtt(SEQ ID NO:7)

SM-R:

TATagatctGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCtcatccatccttttcatccc(SEQ ID NO:8)

RF:

TTCagatctATAACTTCGTATAGCATACATTATACGAAGTTATATCCTCATGTTTA CCTGCTG(SEQ ID NO:9)

RR:cagGTCGACTTGTATATTTATACACACTA(SEQ ID NO:10)

loxP is a sequence recognized by Cre recombinase, and a sequence between two loxP sites in the same orientation can be deleted by Cre recombinase.

The amplified sequences were ligated sequentially into pMD-19T vector (purchased from Takara) to form the final donor plasmid.

2. Synthesis of sgRNA and zCas9 mRNA

Plasmid pGH-T7-ZCAS9 expressing ZCAS9 was obtained from the university of Beijing, Life sciences college. The plasmid was linearized with Xba I endonuclease and purified by transcription with mMACHINE T7 Ultra kit (Ambion) to obtain ZCAS9 mRNA.

The DNA sequences used to prepare the different sgrnas are shown below:

tcf3a sgRNA 1: GGACGCAGCTATCAGTGGCGT (SEQ ID NO:11) (reverse strand, on the antisense strand);

tcf33a sgRNA 2: GCTGGTCTAGTGCTGATCTC (SEQ ID NO:12) (forward strand, on the sense strand);

the above sgRNA sequences were cloned into BbsI sites of pT7-sgRNA plasmids (obtained from Life sciences of Beijing university) and subjected to cloning by Maxisscript T7 kit (Ambion)By external transcription with mirVana^TMAnd recovering the miRNA Isolation Kit (Ambion) Kit to obtain the guide RNA.

3. Zebra fish strain and breeding

The adult zebra fish is cultured in an aquatic animal culture system of Beijing Aisheng company in an environment with the water temperature of 28 ℃, the pH value of 7-8 and the photoperiod of 14 hours light/10 hours dark. Embryos were raised in 10% Hank's solution. The solution composition was as follows (millimoles): 140NaCl, 5.4KCl, 0.25Na₂HPO₄，0.44KH₂PO₄，1.3CaCl₂，1.0MgSO₄And 4.2NaHCO₃(pH 7.2)。

4. Microinjection

zCas9 mRNA, sgRNA and donor plasmid were injected together by microinjection into one-cell stage zebrafish zygotes. Each fertilized egg was injected with 1nl of liquid. Containing 600 ng/. mu.l zcAS9 mRNA, 100 ng/. mu.l sgRNA, and 15 ng/. mu.l donor plasmid. The fertilized eggs can directly develop into the zebra fish under the in vitro culture condition (see 3. zebra fish feeding). The injection concentration of Cre mRNA was 100ng/ul, and the injection concentrations of mylpfa-EGFP plasmid and tol2 mRNA were 25ng/ul, respectively.

5. PCR validation of genomic substitutions

Extracting gene DNA of zebra fish embryo, identifying correct insertion and gene replacement by PCR method, using primers as follows:

tcf3a-LF：TTTGCCGACCTCACCCATC(SEQ ID NO:13)；

DsRed-R：CCCACAACGAGGACTACACC(SEQ ID NO:14)；

DsRed-F：CCCTTGGTCACCTTCAGCTT(SEQ ID NO:15)；

tcf3a-RR：TTTAAAGGGACTTGGAGTAAAAGTG(SEQ ID NO:16)；

6. confocal imaging

Confocal imaging successive fluorescence pictures were taken in the Z-axis direction using FV1000 confocal microscope (Olympus, Japan) with 20-fold or 40-fold water scope (n.a., 0.80) in the form of optical sections. The resolution of all pictures is 1024 × 1024 or 800 × 600. Structural morphology was later reconstructed by ImageJ software (NIH).

The foregoing shows and describes the general principles, essential features, and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the foregoing description only for the purpose of illustrating the principles of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the invention as defined by the appended claims, specification, and equivalents thereof.

Sequence listing

<110> Nanjing and admire technology and technology Limited

<120> a method for studying the effect of tcf3a gene in muscle growth by conditional induction in zebrafish

<130> 2020

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 6341

<212> DNA

<213> Artificial sequence (knock-in plasmid sequence)

<400> 1

ggtaccctcc tgtcagtcag tcagtctgtc agcacgtcac cttaaagggt taaacaaata 60

acgcacagca ctactacagt tacagaaaag cttgcgctgt tataatttac ttacctttga 120

atgcgttttg gtgcgattta taacctgcta ttaaaacaac aacaatgact gaatgttttg 180

aatgagaagc tgtaatgtag ccgtagcggg atgaattttg gtgtagaggg tccattaaat 240

ggcacaacat aaaatgaaaa ccgaaaattt ggtcaatctc taatatcaaa acaaatttag 300

agtcccattg ttacatattt ctgctgtgtg attggctctc agatcaatat agagtaatta 360

gtccagagct tcttgttatt aacaaacatt tttttgcgat tcgatataat actgtttacc 420

agcccagccc taatgtatat gatttttaca aaaaaacatt tctcacttag aatttttgtc 480

ttgtttctag tccaaatgtc tacctacgcc actgatagct gcgtcccaaa tcgcatgagc 540

tcataacttc gtatagcata cattatacga agttatactt atgcactatt ctacgccatt 600

ttgtagtata aatagtgtga gtagtgcgtt cacactggaa actcgaacaa ttataagtgc 660

acttgaatta cccggatgat gcactcattc agccagtata atgaagtgtg taatgatgga 720

cacttcacgc actcaacgat cgcaggtttg cttatgtagc ggaaggggca gagctattgg 780

gcgcacatgt tggataactt tatttatttt ggatgttgaa agcaaaattc tcctacgaga 840

gtgattatag cgcctcctga tggtgaatgc ggttatactc acggcaggta ttattggata 900

attcggtcgt ttatttcact gatttggcaa ccgtcaaacg tcatcaggga aactatttta 960

atttccaatt agaaaaaaac attagtgtgc catttgggac gccactactt acatatacta 1020

tcctgttaag tgtggaagtg cataagtgca tagtgcatag tgtgccattt gggatgcagc 1080

tataattttc ttaaaacaag ctcttaattt gcatttattt cttcaggcgg tgaaaaacta 1140

aacaactttt tactttgtct gaggtttttt ttgtgatatt tggactagaa acaagacaaa 1200

aagtaagaaa atatagatat ttttttgcat tgtgattatt caatttcttt tgttgtactc 1260

cgtaaaaacc ttctgaaaat attcatattg cgatatttat cacgtaaaaa ttcaatatta 1320

ttatatcaga ttccaatatc gtgcagccct aatctgttta ttattgttct ttacttgttt 1380

gtttggtttt atttaccagg ttacacctca gtgccttgca gtaaggtcca tttaagtggt 1440

ctgtccagaa agggtggggt aggggctgtc agaaaataat gtttacttgt gcattgattt 1500

gattctgtaa attgcaaatg tgaaaataaa tatgttgata tataataatt ggtaaattta 1560

ttcacactga tgtttgtttg tttgtttgtg tttcaggttt agatgacaga aatggctccg 1620

gctcctgggg ttcagaagca aacagtcctt cattcggcgc acgggtatga acacacacac 1680

acacacacag agataacgtc tctggtgaag cattaaacct taatccctaa agaaaacaaa 1740

cccgacagga tcagatctgt aatgcacttg aagacgtctc ctgttttgac tcgtgatgct 1800

ttatttgggg gaaaccgcgc gcgcgtgtgt gtgtgtgtaa gtgtgtgtgt gtgtaagtgt 1860

gtgtgtatag agtgcgagat caggagacgt gtgttagtag gtcagtcggt cggtggctga 1920

gattagttga tcatgtttag tggaagttcc tattctctag aaagtatagg aacttcgcat 1980

gcttaagata cattgatgag tttggacaaa ccacaactag aatgcagtga aaaaaatgct 2040

ttatttgtga aatttgtgat gctattgctt tatttgtaac cattataagc tgcaataaac 2100

aagttaacaa caacaattgc attcatttta tgtttcaggt tcagggggag gtgtgggagg 2160

ttttttaaag caagtaaaac ctctacaaat gtggtatggc tgattatgat ctagagtcgc 2220

ggccgctaca ggaacaggtg gtggcggccc tcggcgcgct cgtactgctc cacgatggtg 2280

tagtcctcgt tgtgggaggt gatgtccagc ttggagtcca cgtagtagta gccgggcagc 2340

tgcacgggct tcttggccat atagatagac ttgaactcca ccaggtagtg gccgccgtcc 2400

ttcagcttca gggccttgtg gatctcgccc ttcagcacgc cgtcgcgggg gtacaggcgc 2460

tcggtggagg cctcccagcc catagtcttc ttctgcatta cggggccgtc ggaggggaag 2520

ttcacgccga tgaacttcac cttgtagatg aaggagccgt cctgcaggga ggagtcctgg 2580

gtcacggtca ccacgccgcc gtcctcgaag ttcatcacgc gctcccactt gaagccctcg 2640

gggaaggaca gcttcttgta gtcggggatg tcggcggggt gcttcacgta caccttggag 2700

ccgtactgga actgggggga caggatgtcc caggcgaagg gcagggggcc gcccttggtc 2760

accttcagct tggcggtctg ggtgccctcg taggggcggc cctcgccctc gccctcgatc 2820

tcgaactcgt ggccgttcac ggagccctcc atgcgcacct tgaagcgcat gaactccttg 2880

atgacgtcct cggaggaggc cataccggtt cactgtctgc tttgctgttg gtctgggctc 2940

ctgggtcact gacttactaa tggagtcttt atgtatgagg actcttatca tttgttcttc 3000

tataaaggtc tgcagtgttt ctgttcgtcc cctacatgga cacccagagc ctcctaaata 3060

caggagccct gataactgca caagtgctca gattccagca gggtggaaaa tgagataaag 3120

tgtgcagatg gggaggggga cgtgaatgag agatttgagg gatgaaaagg atggatgaga 3180

agttcctatt ctctagaaag tataggaact tcagatctat aacttcgtat agcatacatt 3240

atacgaagtt atatcctcat gtttacctgc tggtctagtg ctgatctcag gaagtgtgag 3300

tgatccgtcc tctcctgtct gtggcctact ttacttttag actcagaaac cttcaaatat 3360

aacttgaata aagccctgat taaacttgat gaagcctgat attgcacaca cagtcagata 3420

gtgtgtataa atacaacaca cataaacaaa tttacatcaa actttacatc catttatatt 3480

aatagtgaac acatgtttat gcagtgcgta taaatatata caaatgcact tatatactac 3540

tttacattta taattataat gcacacgtta atatagtgat tataaatgac ataaatatac 3600

acaaatgcag ttgtacacta cttcacatcc ctttatattc atattgcacg ttaatatagt 3660

gtgtataaat atacaagtcg acctgcaggc atgcaagctt ggcgtaatca tggtcatagc 3720

tgtttcctgt gtgaaattgt tatccgctca caattccaca caacatacga gccggaagca 3780

taaagtgtaa agcctggggt gcctaatgag tgagctaact cacattaatt gcgttgcgct 3840

cactgcccgc tttccagtcg ggaaacctgt cgtgccagct gcattaatga atcggccaac 3900

gcgcggggag aggcggtttg cgtattgggc gctcttccgc ttcctcgctc actgactcgc 3960

tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt 4020

tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg 4080

ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg 4140

agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat 4200

accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta 4260

ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct 4320

gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc 4380

ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa 4440

gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg 4500

taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact agaagaacag 4560

tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt 4620

gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta 4680

cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc 4740

agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca 4800

cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa 4860

cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat 4920

ttcgttcatc catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct 4980

taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt 5040

tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat 5100

ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta 5160

atagtttgcg caacgttgtt gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg 5220

gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt 5280

tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg 5340

cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg 5400

taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc 5460

ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca catagcagaa 5520

ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac 5580

cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt 5640

ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg 5700

gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa 5760

gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata 5820

aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgacgtc taagaaacca 5880

ttattatcat gacattaacc tataaaaata ggcgtatcac gaggcccttt cgtctcgcgc 5940

gtttcggtga tgacggtgaa aacctctgac acatgcagct cccggagacg gtcacagctt 6000

gtctgtaagc ggatgccggg agcagacaag cccgtcaggg cgcgtcagcg ggtgttggcg 6060

ggtgtcgggg ctggcttaac tatgcggcat cagagcagat tgtactgaga gtgcaccata 6120

tgcggtgtga aataccgcac agatgcgtaa ggagaaaata ccgcatcagg cgccattcgc 6180

cattcaggct gcgcaactgt tgggaagggc gatcggtgcg ggcctcttcg ctattacgcc 6240

agctggcgaa agggggatgt gctgcaaggc gattaagttg ggtaacgcca gggttttccc 6300

agtcacgacg ttgtaaaacg acggccagtg aattcgagct c 6341

<210> 2

<211> 6660

<212> DNA

<213> Artificial sequence (sequence of Zebra fish)

<400> 2

gggcgaattg ggcccagagg tgtaaagtac ttgagtaatt ttacttgatt actgtactta 60

agtattattt ttggggattt ttactttact tgagtacaat taaaaatcaa tacttttact 120

tttacttaat tacatttttt tagaaaaaaa agtacttttt actccttaca attttattta 180

cagtcaaaaa gtacttattt tttggagatc acttcattct attttccctt gctattacca 240

aaccaattga attgcgctga tgcccagttt aatttaaata gatctggcca tctagagcgg 300

ccgctatcac cccatatgtc ccatgctcag catatatgag tacacccctc tagcctgatc 360

tcaagagaaa acgcgagtat tttatgtttt gccagtttag ttcagtcatt gggggatgag 420

caaatcatac taaaatgtac gaattagttc gtacgaatta gccactaaat gaaaaagtta 480

caaatttgtg ttgacccctc acaaatctgt cttcattcat tttcttttag gcttagtccc 540

tttattaatc aggattcgcc acagaggaat gagccaccaa ctcatccagt gtatttttta 600

tgcagcggat gcccatccag ttgcagccct acactgggaa acacccaaat ctgtctttta 660

aattaatatt tttaatagga agctatacaa tgttatattt gtgcatatac attagattag 720

tcagtacact ctcagaaata aaggtccgca agctgtcact gcggtggtac cttttcaaaa 780

ggtacatatt tgtacttaaa gggtccatat tgatacctca aaagtatata ttagtgccta 840

aaaattttaa gagaaacact tttgtacttt ttaggtacta atatataccc ttgaggtttt 900

attatggacc tttaaggtac aaatttttat catttggaaa ggtaccaccc cagtgacagt 960

ttacaccctt tatttctgag agtgaagcta aatctggagc ttatttaaca aaataactta 1020

tgataacggt ccaaaaacta ctacacccat atttatatgt tattgaaaaa tattaaatac 1080

aaattttaaa acagggaaaa atcaagagaa gcaaaacaat ggaaaaaaat ttgttcaaaa 1140

tttgtaggtt gtaatttttt tgttgcaata tttagcttta tttaaattgt tttatctttc 1200

aattttgtga ctaaaatatt attttaataa atatagctgt ttaataaatc tgttttgttt 1260

aaatgcacca aaatacattg cctatattaa ctgagagatg gagaaaaata ttcattttca 1320

aaatgggctg tactcaatta ctctgagcac tgtaattatc tgtttttcta ggtactgtaa 1380

aataatgcta atcttaaaca attttggaac aagaaggagc aaaacaagcc gacagactca 1440

caggatatca aattagtcta aagaaagaag ggaatgcaca acaaactcaa gggggacaaa 1500

acagtgactg atgaattaga caagaaaaag agagcaagga gcgctcaaga ttgtttagct 1560

attttggtca cccacagctg ttccttatgc ctgccttccc aaaaaaaaac tgtcttaagc 1620

ctcaaatttc tcttcatgag ggtccaacat caaccactca gagggctgta gtgtgctgac 1680

catctaaaaa ctgggaaaaa ggggtaatta cgtgcttgtc cacagggcag cttcccacaa 1740

atggcacctc acagtcactg aagtgaccgg gtgaggtcat aggtcgatcg gcagagagag 1800

agagagagag agagagagag agagtgctga atatgggcat ggccatgtgg acgggtgtgg 1860

tgggggcact tgaaccgaaa tcttacagca tcactatact aggaaaagca ttaaaaccta 1920

ttttcgatta gggctgattt gaaataaggg ttaagacacc agaacgtcct cttatatatc 1980

agccaggggc gtgaacaaat atgaacaaca taatcattgg ctcaaaaaat ctctggattg 2040

aaatccatca ggatctatca ctgcaaccct ccccatccaa caagtaatcc tgcaagataa 2100

gccagtattg atctgctgct aatctaactt taggggaggg agttgcgtcc cctttagact 2160

cagtggctac agctcattca tttcaaattg agttatgtga ttgtatgaag ctcaaacagt 2220

cccttacgtc cccatgtcct tattagtcaa cgcgagacat gcaggccgct gccatcagta 2280

tcagattcat cccattccaa gactccaata gctatttctg agcactgtaa gatgatagta 2340

catcccagcc ggtgtccctc catcactttc cccctacctc atagtttttc ctctttctct 2400

ctcggtctgc tatttcccaa acctcactta aggttgggtc tataattagc aaggggcctt 2460

cgtcagtata taagcccctc aagtacagga cactacgcgg cttcagactt ctcttcttga 2520

tcttcttaga cttcacacat accgtctcga cgccaccatg gtgagcaagg gcgaggagct 2580

gttcaccggg gtggtgccca tcctggtcga gctggacggc gacgtaaacg gccacaagtt 2640

cagcgtgtcc ggcgagggcg agggcgatgc cacctacggc aagctgaccc tgaagttcat 2700

ctgcaccacc ggcaagctgc ccgtgccctg gcccaccctc gtgaccaccc tgacctgggg 2760

cgtgcagtgc ttcagccgct accccgacca catgaagcag cacgacttct tcaagtccgc 2820

catgcccgaa ggctacgtcc aggagcgcac catcttcttc aaggacgacg gcaactacaa 2880

gacccgcgcc gaggtgaagt tcgagggcga caccctggtg aaccgcatcg agctgaaggg 2940

catcgacttc aaggaggacg gcaacatcct ggggcacaag ctggagtaca actacatcag 3000

ccacaacgtc tatatcaccg ccgacaagca gaagaacggc atcaaggcca acttcaagat 3060

ccgccacaac atcgaggacg gcagcgtgca gctcgccgac cactaccagc agaacacccc 3120

catcggcgac ggccccgtgc tgctgcccga caaccactac ctgagcaccc agtccgccct 3180

gagcaaagac cccaacgaga agcgcgatca catggtcctg ctggagttcg tgaccgccgc 3240

cgggatcact ctcggcatgg acgagctgta caagtaacgg ccgcgactct agatcataat 3300

cagccatacc acatttgtag aggttttact tgctttaaaa aacctcccac acctccccct 3360

gaacctgaaa cataaaatga atgcaattgt tgttgttaac ttgtttattg cagcttataa 3420

tggttacaaa taaagcaata gcatcacaaa tttcacaaat aaagcatttt tttcactgca 3480

ttctagttgt ggtttgtcca aactcatcaa tgtatcttag gtaccctgca gaagcttaaa 3540

caagaatctc tagttttctt tcttgctttt acttttactt ccttaatact caagtacaat 3600

tttaatggag tactttttta cttttactca agtaagattc tagccagata cttttacttt 3660

taattgagta aaattttccc taagtacttg tactttcact tgagtaaaat ttttgagtac 3720

tttttacacc tctgctcgac catatgggag agctcccaac gcgttggatg catagcttga 3780

gtattctata gtgtcaccta aatagcttgg cgtaatcatg gtcatagctg tttcctgtgt 3840

gaaattgtta tccgctcaca attccacaca acatacgagc cggaagcata aagtgtaaag 3900

cctggggtgc ctaatgagtg agctaactca cattaattgc gttgcgctca ctgcccgctt 3960

tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag 4020

gcggtttgcg tattgggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg 4080

ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat 4140

caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta 4200

aaaaggccgc gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa 4260

atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc 4320

cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt 4380

ccgcctttct cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca 4440

gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg 4500

accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat 4560

cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta 4620

cagagttctt gaagtggtgg cctaactacg gctacactag aagaacagta tttggtatct 4680

gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac 4740

aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa 4800

aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa 4860

actcacgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc tagatccttt 4920

taaattaaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact tggtctgaca 4980

gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt cgttcatcca 5040

tagttgcctg actccccgtc gtgtagataa ctacgatacg ggagggctta ccatctggcc 5100

ccagtgctgc aatgataccg cgagacccac gctcaccggc tccagattta tcagcaataa 5160

accagccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc gcctccatcc 5220

agtctattaa ttgttgccgg gaagctagag taagtagttc gccagttaat agtttgcgca 5280

acgttgttgc cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat 5340

tcagctccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag 5400

cggttagctc cttcggtcct ccgatcgttg tcagaagtaa gttggccgca gtgttatcac 5460

tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta agatgctttt 5520

ctgtgactgg tgagtactca accaagtcat tctgagaata gtgtatgcgg cgaccgagtt 5580

gctcttgccc ggcgtcaata cgggataata ccgcgccaca tagcagaact ttaaaagtgc 5640

tcatcattgg aaaacgttct tcggggcgaa aactctcaag gatcttaccg ctgttgagat 5700

ccagttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt actttcacca 5760

gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga ataagggcga 5820

cacggaaatg ttgaatactc atactcttcc tttttcaata ttattgaagc atttatcagg 5880

gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa caaatagggg 5940

ttccgcgcac atttccccga aaagtgccac ctgatgcggt gtgaaatacc gcacagatgc 6000

gtaaggagaa aataccgcat caggaaattg taagcgttaa tattttgtta aaattcgcgt 6060

taaatttttg ttaaatcagc tcatttttta accaataggc cgaaatcggc aaaatccctt 6120

ataaatcaaa agaatagacc gagatagggt tgagtgttgt tccagtttgg aacaagagtc 6180

cactattaaa gaacgtggac tccaacgtca aagggcgaaa aaccgtctat cagggcgatg 6240

gcccactacg tgaaccatca ccctaatcaa gttttttggg gtcgaggtgc cgtaaagcac 6300

taaatcggaa ccctaaaggg agcccccgat ttagagcttg acggggaaag ccggcgaacg 6360

tggcgagaaa ggaagggaag aaagcgaaag gagcgggcgc tagggcgctg gcaagtgtag 6420

cggtcacgct gcgcgtaacc accacacccg ccgcgcttaa tgcgccgcta cagggcgcgt 6480

ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg cctcttcgct 6540

attacgccag ctggcgaaag ggggatgtgc tgcaaggcga ttaagttggg taacgccagg 6600

gttttcccag tcacgacgtt gtaaaacgac ggccagtgaa ttgtaatacg actcactata 6660

<210> 3

<211> 29

<212> DNA

<213> Artificial sequence (LF)

<400> 3

ctcggtaccc tcctgtcagt cagtcagtc 29

<210> 4

<211> 29

<212> DNA

<213> Artificial sequence (LR)

<400> 4

tatgagctca tgcgatttgg gacgcagct 29

<210> 5

<211> 63

<212> DNA

<213> Artificial sequence (MF)

<400> 5

catgagctca taacttcgta tagcatacat tatacgaagt tatacttatg cactattcta 60

cgc 63

<210> 6

<211> 63

<212> DNA

<213> Artificial sequence (MR)

<400> 6

taagcatgcg aagttcctat actttctaga gaataggaac ttccactaaa catgatcaac 60

taa 63

<210> 7

<211> 29

<212> DNA

<213> Artificial sequence (SM-F)

<400> 7

ttcgcatgct taagatacat tgatgagtt 29

<210> 8

<211> 63

<212> DNA

<213> Artificial sequence (SM-R)

<400> 8

tatagatctg aagttcctat actttctaga gaataggaac ttctcatcca tccttttcat 60

ccc 63

<210> 9

<211> 63

<212> DNA

<213> Artificial sequence (RF)

<400> 9

ttcagatcta taacttcgta tagcatacat tatacgaagt tatatcctca tgtttacctg 60

ctg 63

<210> 10

<211> 29

<212> DNA

<213> Artificial sequence (RR)

<400> 10

caggtcgact tgtatattta tacacacta 29

<210> 11

<211> 21

<212> DNA

<213> Artificial sequence (nucleotide sequence of sgRNA 1)

<400> 11

ggacgcagct atcagtggcg t 21

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence (nucleotide sequence of sgRNA 2)

<400> 12

gctggtctag tgctgatctc 20

<210> 13

<211> 19

<212> DNA

<213> Artificial sequence (tcf3a-LF primer)

<400> 13

tttgccgacc tcacccatc 19

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence (DsRed-R primer)

<400> 14

cccacaacga ggactacacc 20

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence (DsRed-F primer)

<400> 15

cccttggtca ccttcagctt 20

<210> 16

<211> 25

<212> DNA

<213> Artificial sequence (tcf3a-RR primer)

<400> 16

tttaaaggga cttggagtaa aagtg 25

Claims (4)

1. A method for conditionally inducing tcf3a gene knockout in zebrafish for studying muscle growth, comprising the steps of:

(1) searching specific recognition sites of two nucleases in introns at two ends of the 4 th exon of the zebra fish tcf3a, wherein the specific recognition sites are a sgRNA1 target spot and a sgRNA2 target spot; the nuclease is CRIPSR nuclease and Cas9 nuclease;

(2) constructing a knock-in plasmid connected with non-homologous ends, wherein the knock-in plasmid contains a left homologous arm and a right homologous arm, the left homologous arm contains a nuclease recognition site sgRNA1, the right homologous arm contains another nuclease recognition site sgRNA2, an exogenous gene sequence to be replaced is contained between the left arm and the right arm, and the exogenous gene sequence comprises loxP sites on two sides of a 4 th exon and cardiac muscle cell marker red fluorescent protein capable of being used for screening; injecting a nuclease system into the fertilized eggs of the zebra fish by utilizing microinjection; culturing the injected fertilized eggs into fish, and confirming the conditional knockout of the zebra fish by the tcf3a through fluorescence and genotype identification; the nuclease system comprises Cas9 protein or mRNA for generating Cas9 protein, sgRNA1 and sgRNA2, tcf3a knock-in plasmids; the target sequence of sgRNA1 is: GGACGCAGCTATCAGTGGCGT, respectively; the target sequence of sgRNA2 is: GCTGGTCTAGTGCTGATCTC, respectively;

(3) constructing an expression plasmid for marking the muscle of the zebra fish, wherein the expression plasmid drives CFP fluorescent protein to express by using a zebra fish mylpfa promoter, and transposon sequences are added at two ends;

(4) the above-described marker plasmid, Cre mRNA and the mRNA of tol2 transposase were co-injected into embryos generated by crossing in tcf3a conditional knockout lines, and zebrafish embryos were used after 3 days to identify deletion of tcf3a, overall phenotypic observation and phenotypic observation of muscle.

2. The method for conditionally inducing tcf3a gene knock-out in zebrafish of claim 1 for studying muscle growth, wherein: in the step (2), the sequence of the left homology arm is shown as SEQ ID NO:1, and the sequence of the right homologous arm is shown as SEQ ID NO:1, 3253-3676, and the sequence of the exogenous gene needing to be replaced between the right arms is shown as SEQ ID NO:1, 543-th position 2710.

3. The method for conditionally inducing tcf3a gene knock-out in zebrafish of claim 2 for studying muscle growth, wherein: in the step (2), constructing the left homologous arm and the right homologous arm of the knock-in plasmid connected with the non-homologous ends, taking a zebra fish genome as a template, and adding enzyme cutting sites and protective bases into a PCR primer for amplification to obtain the zebra fish genome; a sequence between two loxP sites of the fourth exon takes a zebra fish genome as a template, a loxP-tcf3a _ exon4-frt fusion sequence is obtained by amplifying a loxP and frt fusion sequence PCR primer, and the PCR primer is added with a restriction enzyme site and a protective base; the red fluorescent protein sequence can be marked by the screened cardiac muscle cells, the loxP-myl7-DsRed-pA-frt fusion sequence is obtained by amplifying the fusion sequence PCR primer of loxP and frt, and the PCR primer is added with the enzyme cutting site and the protective basic group.

4. The method for conditionally inducing tcf3a gene knock-out in zebrafish of claim 3 for studying muscle growth, wherein: in the step (3), the sequence of the zebrafish mylpfa promoter is shown as SEQ ID NO: 2, and the ECFP sequence is shown as SEQ ID NO: 2558 and 3277 in FIG. 2.

Images