CN112111528A

CN112111528A - Method for repairing abnormal splicing of intron

Info

Publication number: CN112111528A
Application number: CN201910543865.5A
Authority: CN
Inventors: 吴宇轩; 杨菲; 李大力; 刘明耀
Original assignee: Shanghai Bangyao Biological Technology Co ltd; East China Normal University
Current assignee: Shanghai Bangyao Biological Technology Co ltd; East China Normal University
Priority date: 2019-06-21
Filing date: 2019-06-21
Publication date: 2020-12-22
Anticipated expiration: 2039-06-21
Also published as: CN112111528B

Abstract

The invention discloses a method for repairing intron abnormal splicing, which is a technology for targeted knockout of abnormal mutation sites IVS2-654C > T in beta-thalassemia (thalassemia) by using a CRISPR-Cas9 gene editing technology, and is characterized in that a guide RNA sequence (sgRNA) capable of identifying and guiding Cas9 protein to a target gene target sequence is designed and synthesized, and a mixture of the sgRNA and Cas9 protein is electrotransferred into beta-thalassemia IVS2-654C > T hematopoietic stem cells, so that the abnormal splicing mutation sites are efficiently destroyed, and normal shearing and expression of beta-globin genes are recovered. The invention can utilize the existing gene editing technology to edit transfusion dependent beta-thalassemia IVS2-654C > T, the editing efficiency is high, and the edited patient human hematopoietic stem cells can rebuild the blood system of the patient and treat thalassemia diseases after the autologous transplantation.

Description

Method for repairing abnormal splicing of intron

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a method for repairing an intron abnormal splice site.

Background

In recent years, an adaptive immune mechanism for protecting bacteria and archaea from invasion by foreign DNA fragments such as bacteriophage and plasmid has been elucidated. The system consists of a Clustered Regulated Interstitial Short Palindromic Repeats (CRISPR) and CRISPR-associated (CAS) genes. The immune interference process of CRISPR system mainly comprises 3 stages: adaptation, expression and interference. In the adaptation phase, the CRISPR system incorporates a short stretch of DNA from a phage or plasmid between the leader sequence and the first repeat, each integration being accompanied by replication of the repeat, thereby forming a new repeat-spacer unit. During the expression phase, the CRISPR locus will be transcribed into a CRISPR RNA (crRNA) precursor (pre-crRNA) which will be further processed into small crrnas at the repeats in the presence of Cas protein and tracrRNA. Mature crRNA forms a Cas/crRNA complex with Cas protein. In the interference stage, the crRNA guides the Cas/crRNA complex to find a target point through a region complementary with the target sequence, and double-stranded DNA at the target point is broken through the nuclease activity of the Cas protein at the target point position, so that the target DNA loses the original function. Wherein 3 bases adjacent to the 3 ' end of the target point must be in a form of 5 ' -NGG-3 ', so as to form a PAM (protospacer adjacent motif) structure required by the Cas/crRNA complex for recognizing the target point.

The Clustered Regulated Interstitial Short Palindromic Repeats (CRISPR) system is divided into three families, I, II, III, wherein the type II system requires only Cas9 protein to process pre-crRNA into mature crRNA that binds to tracrRNA with the help of trans-encoded small RNA (tracrRNA). It was found that by artificially constructing a mimic crRNA: the single-stranded chimera guide RNA (guide RNA) of the tracrRNA complex can effectively mediate the recognition and the cutting of the Cas9 protein to the target spot, thereby providing a wide prospect for modifying the target DNA by using a CRISPR system in the target species.

Beta-thalassemia is a common hereditary disease with abnormal hemoglobin in adults caused by beta-globin gene defects, and about 3000 thousands of people are gene carriers of thalassemia in China, and about 3000 thousands of families and 1 hundred million people are involved, wherein about 30 thousands of patients with severe thalassemia and intermediate thalassemia are involved. The IVS2-654C > T genotype is a common one in 'poor land' in China, and the pathogenesis is that the 654 th base in the 2 nd intron of the HBB gene generates C > T mutation, so that an abnormal splice site is generated, 73nt of exon is additionally added in beta-globin mRNA, and translation is terminated in advance. At present, intermediate and heavy patients need long-term blood transfusion and deferrization treatment to maintain life, the only radical treatment mode is allogeneic hematopoietic stem cell transplantation, but the main implementation obstacles are the shortage of blood resources in China, the allogenic hematopoietic stem cell mating difficulty, transplantation related complications and the like. Among them, gene therapy using lentiviral vectors has shown great potential, but the semi-random vector integration is a carcinogenic risk. Meanwhile, expression elements in lentiviruses are gradually silenced in the long-term homing and self-renewal process of hematopoietic stem cells, so that the curative effect is reduced, and the aim of lifelong healing cannot be fulfilled. In addition, the high concentration and quality of lentivirus required clinically is extremely demanding in terms of equipment and technology, and therefore cost reduction is difficult. Therefore, a parallel, safer, less costly clinical protocol is highly desirable.

The ideal gene therapy approach is to repair or destroy the traditional thalassemia mutations in the diseased human hematopoietic stem cell DNA, to restore gene function, and to permanently produce wild-type adult β -globin under the action of endogenous transcriptional control factors, to differentiate normally into erythroid cells. The repair mode of the DNA sequence after gene editing mainly comprises Non-homologus end joining (NHEJ) repair, the proportion of Homology Direct Repair (HDR) is extremely low, and efficient HDR efficiency is required for repairing point mutation. Aiming at the abnormal mutation of the pathogenic site, the strategy that the mutation site can be destroyed only by cutting the target DNA in a targeted manner to realize NHEJ mutation is more feasible. Clinically, the aim of healing can be achieved only by transplanting autologous hematopoietic stem cells repaired in an NHEJ mode after gene editing back into the body.

Disclosure of Invention

The invention provides a repair method aiming at intron abnormal splicing caused by mutation of beta-globin gene (HBB) IVS2-654C > T.

The invention utilizes CRISPR-Cas9 system to repair the abnormal splicing of intron caused by IVS2-654C > T. When Cas9 targets the cleavage site, it is necessary that the 3 bases immediately adjacent to the 3 ' end of the target must be in the form of 5 ' -NGG-3 ' in the selection of sequences for targeting, in order to constitute a pam (protospacer adjacent motif) structure recognized by Cas9 itself. However, there is no suitable PAM-targeted cleavage near the pathogenic mutation site to disrupt the aberrant splice site, which results in the inability to directly cleave and repair the IVS2-654C > T mutation site using the CRISPR-Cas9 system.

Intensive studies of intron aberrant splicing by IVS2-654C > T have been conducted by the present inventors, and it was found that mutation of IVS2-654C > T results in an additional splice donor site "AAGGTAATA" in the second intron of HBB, resulting in an aberrant β -globin mRNA of 73 bases in excess, leading to premature translation termination. Theoretically, disruption of the function of the extra splice donor site due to IVS2-654C > T in the HBB gene region, such that it does not trigger aberrant variable splicing, would allow this genomic region to be transcribed to produce normal β -globin mRNA and translated to produce normal β -globin.

In one embodiment, the additional splice donor site "AAGGTAATA" due to IVS2-654C > T can be disrupted by way of base insertion, deletion, alteration, frameshift mutation, or knock-out.

In one embodiment, the additional splice donor site "AAGGTAATA" due to IVS2-654C > T can be disrupted using the CRISPR-Cas9 system; preferably, when the CRISPR-Cas9 system is used, the targeting sequence of the designed sgRNA is preferably within 20bp upstream of the IVS2-654C > T site to 70bp downstream of the IVS2-654C > T site.

In the invention, the CRISPR-Cas system is a CRISPR-Cas system suitable for being artificially modified and a nuclease system derived from an archaebacterium II type (CRISPR) -CRISPR-associated protein (Cas) system, and compared with ZFN and TALEN, the system is simpler and more convenient to operate.

The invention adopts RNA-guided endonucleases (RGENs) to realize specific cutting of a target gene sequence. RGENs are composed of chimeric guide RNA and Cas9 protein, wherein the former is formed by fusing CRISPR RNAs (crRNAs) and trans-activating crRNA (tracrRNA) in a naturally-occurring II-type CRISPR-Cas system into a single-stranded guide RNA (sgRNA), so as to combine with Cas9 protein and guide the latter to perform specific cleavage on a target DNA sequence, the cleavage will form double-stranded break (DSB), and the damage can be repaired by Non-homologous end junction (NHEJ) which is easy to miss, so that the code shift of a target gene can be efficiently caused, and the damage to a pathogenic mutation site can be realized.

The Cas9 may be selected from Streptococcus pyogenes, Staphylococcus aureus or n.meningitis derived Cas 9. The Cas9 may be selected from a wild-type Cas9, and may also be selected from a mutant Cas 9; the mutant Cas9 did not result in loss of cleavage and targeting activity of Cas 9.

In other embodiments, other Cas enzymes may be used in place of Cas 9.

In the invention, because no targeting sequence suitable for Cas9 protein cleavage exists near the IVS2-654C > T site, cleavage is selected from the range of 20bp upstream of the IVS2-654C > T site to 70bp downstream of the IVS2-654C > T site, and the cleavage can cause abnormal translation of the additional splice donor site 'AAGGTAATA' generated by IVS2-654C > T, thereby achieving the repairing effect. Therefore, in the present invention, Cas9 does not need to introduce a foreign DNA donor sequence for homologous recombination repair after cleavage of the target sequence.

In one embodiment, sgRNA-1 is used to cleave the target sequence, the targeting sequence of sgRNA-1 is CAGTGATAATTTCTGGGTTA (SEQ ID No.1), sgRNA-1 can direct Cas9 to cleave the DNA 6 bases upstream of the IVS2-654C > T site, cleavage alone resulting in a base loss, such that the additional splice donor site due to IVS2-654C > T causes additional base loss, disrupting the additional splice donor site.

In another embodiment, sgRNA-1 can also be used in combination with sgRNA-2, the targeting sequence of sgRNA-2 is TAAATTGTAACTGATGTAAG (SEQ ID No.2), sgRNA-2 can direct Cas9 to cleave DNA 53 bases downstream of the IVS2-654C > T site; the sgRNA-1 and sgRNA-2 combination can also disrupt the additional splice donor site due to IVS2-654C > T.

Whether sgRNA-1 alone or both sgRNA-1 and sgRNA-2 are used, the function of the additional splice donor site can be disrupted such that it does not initiate aberrant variable splicing, thereby allowing this genomic region to be transcribed to produce normal β -globin mRNA and translated to produce normal β -globin.

If sgRNA1 or sgRNA1+2 targeted gene editing is performed on the second intron region of normal human HBB, and corresponding base loss or large-fragment DNA deletion is generated, the normal shearing or transcription of beta-globin mRNA is not influenced. This indicates that when editing a disease-causing allele, the expression of β -globin is not affected even if another normal allele is edited at the same time.

Detailed description of the invention:

in one aspect, the invention provides a repair method for aberrant splicing of introns caused by mutation of HBB (β -globin gene) IVS2-654C > T in a cell, which IVS2-654C > T may cause an additional splice donor site, the method comprising the step of genetically editing HBB using CRISPR-Cas9 system which genetically edits HBB to inactivate the additional splice donor site using CRISPR-Cas9 system, the CRISPR-Cas9 system comprising Cas9 and at least one sgRNA targeting a target sequence.

Such inactivation includes disrupting the function of the additional splice donor sites described above by way of base insertion, deletion, alteration, frameshift mutation, or knock-out.

Further, the targeting sequence of the sgRNA is 20bp upstream of the IVS2-654C > T site to 70bp downstream of the IVS2-654C > T site.

In one embodiment, the sgRNA includes sgRNA-1; in other embodiments, the sgRNA includes sgRNA-1 and sgRNA-2.

The targeting sequence of the sgRNA-1 is CAGTGATAATTTCTGGGTTA; the targeting sequence of the sgRNA-2 is TAAATTGTAACTGATGTAAG.

Further, the sequence of the additional splice donor site is AAGGTAATA.

Further, the cell is hematopoietic stem cell, preferably, the cell is CD34⁺The hematopoietic stem and progenitor cells of (a); more preferably, the cell is an ex vivo cell.

In one embodiment, the sgRNA includes a chemical modification of a base. In a preferred embodiment, the sgRNA comprises a chemical modification of any one or any few of the 1 st to n th bases at the 5 'terminus, and/or a chemical modification of any one or any few of the 1 st to n th bases at the 3' terminus; and n is selected from 2, 3, 4, 5, 6, 7, 8, 9 or 10. Preferably, the sgRNA comprises a chemical modification of one, two, three, four or five bases at the 5 'end and/or a chemical modification of one, two, three, four or five bases at the 3' end. For example, the sgRNA is chemically modified at the 1 st, 2 nd, 3 rd, 4 th, 5 th, or 1 to 2 nd, 1 to 3 rd, 1 to 4 th, and 1 to 5 th bases at the 5' end of the sgRNA; and/or chemically modifying the 1 st, 2 nd, 3 rd, 4 th, 5 th or 1-2 th, 1-3 rd, 1-4 th, or 1-5 th bases at the 3' end of the sgRNA. In a preferred embodiment, the chemical modification is one or any of methylation modification, fluorination modification or thio modification.

In a preferred embodiment, the complex comprising Cas9 and sgRNA is introduced into the cell using electrotransformation.

Further, the Cas9 and sgRNA are in a molar ratio of 1:1 to 3, preferably, 1:2, more preferably, 1: 3.

Further, the Cas9 and sgRNA form a complex by incubation; preferably, the temperature of the incubation is 20-50 ℃, preferably, 25-37 ℃; preferably, the incubation time is 2-30 minutes, preferably, 5-20 minutes.

Further, the ratio of Cas9 and sgRNA to cell is 20-100 μ g of complex: (1X 10)²-1×10⁶Individual) cells, preferably, 30 μ g of complex: (1X 10)³-1×10⁵One) cells.

Further, the cells after electroporation were cultured in CD34⁺Extracting the genome DNA of the cell obtained in the step for genotype identification in an EDM-1 differentiation system for 7 days, and determining the mutation efficiency; after the mutation is determined, EDM-2 stage differentiation is carried out for 4 days, and EMD-3 stage differentiation is carried out for 7 days. After each stage of differentiation is finished, RNA is extracted, reverse transcription is carried out to detect abnormal splicing of the intron by cDNA gel electrophoresis, and whether the CDS region of the restored hematopoietic stem cell can recover the normal coding function is verified.

In another aspect, the invention also provides sgRNA used for repairing intron aberrant splicing caused by HBB (β -globin gene) IVS2-654C > T mutation, wherein the sgRNA includes sgRNA-1 and the targeting sequence of sgRNA-1 is CAGTGATAATTTCTGGGTTA.

Further, the sgRNA also comprises sgRNA-2, and the targeting sequence of the sgRNA-2 is TAAATTGTAACTGATGTAAG.

On the other hand, the invention also provides application of the sgRNA in repairing intron abnormal splicing caused by HBB (beta-globin gene) IVS2-654C > T mutation in cells.

Has the advantages that:

the sgRNA is designed aiming at the non-target region of IVS2-654C > T, so that the possibility of more accurate and flexible editing on the genome is provided, the mutation efficiency of the invention can reach 95 percent, and is obviously higher than the mutation rate which can be achieved by adopting ZFN, TALEN or Cas12a/Cpf1 RNP. The method has great significance in saving experiment time and investment of manpower and material resources through the realized high mutation efficiency.

The invention relates to a method for rapidly constructing mutation near a pathogenic site of hematopoietic stem cells of a beta-thalassemia IVS2-654C > T patient, directly introducing guide RNA and CAS9 protein which can cut the pathogenic site into defective hematopoietic stem cells, causing the code shift of a target gene through DNA Double Strand Break (DSB) and Non-homologous end joining (NHEJ) repair caused by the DSB, and rapidly and efficiently causing the damage of the pathogenic site. The beta-globin intron obtained by the invention can be normally spliced, and the CDS region restores the coding function.

Drawings

The accompanying drawings, which are included to provide a further understanding of the application and are incorporated in and constitute a part of this application, illustrate embodiment(s) of the application and together with the description serve to explain the application and not to limit the application. In the drawings:

fig. 1 is a schematic diagram of the CRISPR/Cas9 system action principle.

FIG. 2 is a schematic representation of the aberrant splicing mutation sites of β -thalassemia IVS2-654C > T.

FIG. 3 is a diagram showing Sanger sequencing of a genomic region obtained by extracting genomic DNA of cells and PCR-amplifying the corresponding genomic region after editing pathogenic sites of hematopoietic stem cells of a patient, wherein the upper diagram shows that a sequencing peak diagram is normal in an electrotransfer blank control group (IVS2-654 patient derived hematopoietic stem cells without any RNP introduced); the middle panel is an electrotransfer sgRNA-1 group, and the sequencing peak image shows that a hetero-peak is generated from the sgRNA-1 cleavage site due to random number of base losses; the lower panel is a set of electrotransformed sgRNA-1+ sgRNA-2, and the sequencing peak plot shows that a hetero-peak is generated from the sgRNA-1 cleavage site due to random number of base losses.

FIG. 4 is the gel electrophoresis diagram of cDNA PCR detection after editing pathogenic sites of hematopoietic stem cells and differentiating red blood cells of a patient. The upper slower migrating band (468bp) is the amplification product of abnormal shearing, the lower slower migrating band (395bp) is the amplification product of normal shearing, and the ratio of the intensity of the abnormal shearing band to the intensity of the normal shearing band of the edited sample is obviously reduced. Lanes 1 and 6 are DNA size standards, lanes 2-5 are samples of erythrocytes differentiated in vitro to 11 days (cultured in EDM-2 medium), and lanes 7-10 are samples of erythrocytes differentiated in vitro to 18 days (cultured in EDM-3 medium). HU-2 represents in vitro differentiated red blood cells derived from healthy people, IVS2-654 represents in vitro differentiated red blood cells derived from poor patients, and 654-sg1 or 654-sg1+2 represents in vitro differentiated red blood cells after Cas9 editing.

FIG. 5 is the PCR amplification of HBB sequence from the complete cDNA and Sanger sequencing after editing pathogenic sites of hematopoietic stem cells and differentiating erythrocytes in patients; the top panel is an electrotransfer blank control (IVS2-654 patient derived hematopoietic stem cells without any RNP introduced), and the sequencing peak shows that a doublet is produced at the junction of the second and third exons due to an abnormal splicing of one allele; the middle graph is an electrotransfer sgRNA-1 group, and a sequencing peak graph shows that a main peak is a normal HBB sequence and only has a double peak caused by extremely low shearing abnormality; the lower panel shows an electrotransfer sgRNA-1+ sgRNA-2 group, and a sequencing peak diagram shows that a main peak is a normal HBB sequence and only a double peak is caused by extremely low shearing abnormality.

FIG. 6 is a diagram of globin qPCR after differentiation of hematopoietic stem cell pathogenic site mutation of a patient. The results show that the mRNA ratio of HBB and HBA of the sgRNA-1-edited cells is about 50%, and the mRNA ratio of HBB and HBA of the sgRNA-1+ 2-edited cells is close to 100%. This ratio is sufficient to eliminate erythrocytotoxicity resulting from excessive HBA levels, and is effective in relieving thalassemia symptoms.

Detailed Description

The present invention will be described in further detail with reference to the following specific examples and drawings, and the present invention is not limited to the following examples. Variations and advantages that may occur to those skilled in the art may be incorporated into the invention without departing from the spirit and scope of the inventive concept, and the scope of the appended claims is intended to be protected. The procedures, conditions, reagents, experimental methods and the like for carrying out the present invention are general knowledge and common general knowledge in the art except for the contents specifically mentioned below, and the present invention is not particularly limited. Such as those described in Sambrook et al, molecular cloning, A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations.

The invention utilizes CRISPR-Cas9 gene editing technology shown in figure 1 to destroy abnormal mutation sites IVS2-654C > T in beta-thalassemia in a targeted mode (figure 2), constructs a guide RNA sequence (sgRNA) capable of identifying and guiding Cas9 protein to a target gene target sequence, and is a method for targeting and changing pathogenic target DNA, and the method comprises the following steps: and introducing sgRNA encoding nucleic acid for identifying a target gene and Cas9 protein into the defective hematopoietic stem cells, so as to identify and cut a target genomic DNA sequence. Then, the cells are cultured in vitro, nuclease is expressed, and double strand breaks occur in the genomic DNA of interest in the vicinity of the pathogenic site, followed by repair of the DNA break site.

Wherein, the repair mode includes: (a) repair of non-homologous end joining. Non-homologous end joining repair results in the introduction of a gene mutation (base insertion, deletion) into the genomic sequence of interest. (b) And (3) homologous recombination and repair. Homologous recombination repair introduces donor foreign DNA sequences into the target genomic DNA sequence, resulting in alterations in the endogenous target gene sequence. In this embodiment, no foreign DNA sequences need to be introduced.

The invention relates to a construction method for destroying pathogenic sites in IVS2-654C > T defective hematopoietic stem cells, which comprises the following steps:

(1) sgRNA design:

sgRNA-1 targeting sequence CAGTGATAATTTCTGGGTTA (SEQ ID No. 1);

sgRNA-2 targeting sequence TAAATTGTAACTGATGTAAG (SEQ ID No. 2);

(2) synthesizing sgRNA;

(3) the sgRNA and Cas9 proteins were mixed in a molar ratio of 1-2: 1 mixing and electrotransfering hematopoietic stem cells of a patient with beta-thalassemia IVS2-654C > T;

(4) culturing the cells after electrotransformation in a CD34+ EDM-1 differentiation system for 7 days, extracting the genomic DNA of the cells obtained in the steps, and carrying out genotype identification to determine mutation efficiency;

(5) after the mutation is determined, EDM-2 stage differentiation is carried out for 4 days, and EMD-3 stage differentiation is carried out for 7 days. After each stage of differentiation is finished, RNA is extracted, reverse transcription is carried out to cDNA gel electrophoresis to detect the abnormal splicing of introns, qPCR is carried out to detect the content and proportion of the mRNA of the globin after editing, and whether the CDS region of the hematopoietic stem cells after repairing can recover the normal coding function is verified.

In the present invention, the hematopoietic stem cells are beta-thalassemia IVS2-654C>Hematopoietic stem and progenitor cells from patients with T genotype (CD 34)⁺HSPCs). The chemically modified sgRNA and Cas9 protein mixture is electrically transformed to beta-thalassemia IVS2-654C>T hematopoietic stem cells, efficiently destroy the abnormal splicing mutation sites, thereby restoring the expression of the beta-globin gene. The invention can repair the transfusion dependent type beta-thalassemia IVS2-654C by using the existing gene editing technology>T, the editing efficiency is high, and the autologous hematopoietic stem cells can be efficiently modified to permanently balance the hematopoietic system.

Example 1 disruption of pathogenic sites in beta-thalassemia IVS2-654C > T deficient hematopoietic stem cells

1. Design of sgrnas

In the embodiment, the patient is a beta-thalassemia double heterozygote with the genotype of IVS2-654/CD17, and the abnormal splicing sites are destroyed based on that the IVS2-654 pathogenic site does not have proper PAM targeted cutting, so that sgRNA-1 and sgRNA-2 are designed before and after the pathogenic sites respectively. Wherein, the sgRNA-1 alone can cause the repair of the fracture before the pathogenic mutation site, and the sgRNA-1 and the sgRNA-2 act together to generate large fragment deletion before and after the pathogenic site.

2. Preparation of sgRNA and Cas9 protein

3. Electrotransformation of sgRNA and Cas9 protein complexes

Mixing the sgRNA synthesized by chemical modification and Cas9 protein according to a certain ratio, incubating at room temperature for 10min, respectively electrotransfering sgRNA-1(654-sg1), sgRNA-1+ sgRNA-2(654-sg1+2) and blank control (cells without any RNP), mixing electrotransfer solution according to an electrotransfer kit ratio, and electrotransfering the number of cells not more than 10⁵And then, after the cells are centrifuged, the cell is resuspended in an electrotransformation solution and is gently mixed with the incubated sgRNA and Cas9 protein compound, the mixture is transferred to an electrotransfer cup, bubbles are avoided in the operation process, a CD34 cell electrotransfer program EO-100 is used for electrotransfer (Lonza-4D electrotransfer), after the successful electrotransfer is confirmed, the cells are stood and incubated for 5min at room temperature, the Cas9 protein and the electrotransfer solution are removed by recentrifugation, and the CD34⁺After suspending the cells by EDM-1 culture medium, adding a cell culture plate for differentiation culture at 37 degrees, and completing the disruption of the pathogenic mutation site of the defective hematopoietic stem cells.

The following is used to identify whether the method for constructing the target gene mutation of the present invention is successfully implemented.

(1) Mutation identification of genomic DNA

And 3, carrying out in-vitro differentiation culture on the hematopoietic stem cells obtained in the step 3 for 3-4 days, collecting a proper amount of cells, extracting a genome, carrying out Sanger sequencing detection on mutation efficiency after PCR amplification, and continuously differentiating the rest cells in an EDM-1 culture medium until the 7 th day. As shown in FIG. 3, the mutation rate of the target site after electrotransformation can reach 95%. Wherein, the primer sequence of 654-check-F is as follows: CACATATTGACCAAATCAGGG (SEQ ID No. 3); 654-check-R primer sequence: CTTTGCCAAAGTGATGGGCCA (SEQ ID No. 4).

(2) EDM-2 and EDM-3 differentiation culture

After Sanger sequencing, the target site mutation is determined to be successful, and then differentiation can be continued in an EDM-2 culture medium. At this stage, the cells can be greatly amplified, after the EDM-2 differentiation stage is finished, a proper amount of cells are collected, RNA is extracted and is reversely transcribed into cDNA, meanwhile, the rest cells are continuously differentiated into EDM-3, and after the differentiation is finished, RNA is extracted and is reversely transcribed into cDNA.

(3) Exon, CDS region amplification, q-PCR

And (3) amplifying the differentiated exons, and verifying whether the pathogenic site can be normally spliced after mutation. As shown in fig. 4, the hematopoietic stem cell intron after the pathogenic site mutation substantially restored normal splicing compared to the defective cell; the HBB CDS region is amplified, and as shown in FIG. 5, a sequencing result shows that compared with a defective cell, the HBB gene of the hematopoietic stem cell with a mutated pathogenic site restores the normal coding function. The q-PCR analysis shows that the mRNA ratio of HBB and HBA of the cells edited by sgRNA-1 is about 50%, while the mRNA ratio of HBB and HBA of the cells edited by sgRNA-1+2 is close to 100% when the content of globin in hematopoietic stem cells after the pathogenic site mutation is changed, as shown in FIG. 6. This ratio is sufficient to eliminate erythrocytotoxicity resulting from excessive HBA levels, and is effective in relieving thalassemia symptoms.

Wherein, the primer sequences are as follows:

654-exon1-F primer sequence: TGAGGAGAAGTCTGCCGTTAC (SEQ ID No. 5);

654-exon3-R primer sequence: CACCAGCCACCACTTTCTGA (SEQ ID No. 6);

HBB-CDS-F primer sequence: ATGGTGCATCTGACTCCTGA (SEQ ID No. 7);

HBB-CDS-R primer sequence: TTAGTGATACTTGTGGGCCA (SEQ ID No. 8);

HBA-S _ qPCR primer sequences: GCCCTGGAGAGGATGTTC (SEQ ID No. 9);

HBA-a _ qPCR primer sequences: TTCTTGCCGTGGCCCTTA (SEQ ID No. 10);

HBB-S _ qPCR primer sequences: TGAGGAGAAGTCTGCCGTTAC (SEQ ID No. 11);

HBB-AS _ qPCR primer sequences: ACCACCAGCAGCCTGCCCA (SEQ ID No. 12);

HBG-S _ qPCR primer sequences: GGTTATCAATAAGCTCCTAGTCC (SEQ ID No. 13);

HBG-AS _ qPCR primer sequences: ACAACCAGGAGCCTTCCCA (SEQ ID No. 14);

HBB _ e2-e3 primer sequence: TTCAGGCTCCTGGGCAAC (SEQ ID No. 15);

r _ HBB _ exon3 primer sequence: CACCAGCCACCACTTTCTGA (SEQ ID No. 16).

The above description is only an example of the present application and is not intended to limit the present application. Various modifications and changes may occur to those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the scope of the claims of the present application.

SEQUENCE LISTING

<110> Shanghai Bodhisae Biotech Co., Ltd, university of east China

<120> a method for repairing intron aberrant splicing

<130> JH-CNP190598

<160> 16

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence

<400> 1

cagtgataat ttctgggtta 20

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence

<400> 2

taaattgtaa ctgatgtaag 20

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence

<400> 3

cacatattga ccaaatcagg g 21

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence

<400> 4

ctttgccaaa gtgatgggcc a 21

<210> 5

<211> 21

<212> DNA

<213> Artificial sequence

<400> 5

tgaggagaag tctgccgtta c 21

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence

<400> 6

caccagccac cactttctga 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence

<400> 7

atggtgcatc tgactcctga 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence

<400> 8

ttagtgatac ttgtgggcca 20

<210> 9

<211> 18

<212> DNA

<213> Artificial sequence

<400> 9

gccctggaga ggatgttc 18

<210> 10

<211> 18

<212> DNA

<213> Artificial sequence

<400> 10

ttcttgccgt ggccctta 18

<210> 11

<211> 21

<212> DNA

<213> Artificial sequence

<400> 11

tgaggagaag tctgccgtta c 21

<210> 12

<211> 19

<212> DNA

<213> Artificial sequence

<400> 12

accaccagca gcctgccca 19

<210> 13

<211> 23

<212> DNA

<213> Artificial sequence

<400> 13

ggttatcaat aagctcctag tcc 23

<210> 14

<211> 19

<212> DNA

<213> Artificial sequence

<400> 14

acaaccagga gccttccca 19

<210> 15

<211> 18

<212> DNA

<213> Artificial sequence

<400> 15

ttcaggctcc tgggcaac 18

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence

<400> 16

caccagccac cactttctga 20

Claims

1. A repair method for aberrant splicing of introns in cells due to mutation of HBB (β -globin gene) IVS2-654C > T, said mutation of IVS2-654C > T introducing an additional splice donor site resulting in aberrant splicing of introns, characterized by:

the method comprises the steps of gene editing HBB by using a CRISPR-Cas9 system;

the gene editing of HBB using CRISPR-Cas9 system to inactivate the additional splice donor sites;

the CRISPR-Cas9 system includes Cas9 and at least one sgRNA that targets a target sequence.

2. The repair method of claim 1, wherein the sgRNA targeting site is within 20bp upstream of the IVS2-654C > T site and 70bp downstream of the IVS2-654C > T site.

3. The repair method of claim 2, wherein the sgrnas include sgRNA-1; the targeting sequence of the sgRNA-1 is a sequence shown in SEQ ID No. 1; preferably, the sgRNA includes a chemical modification of a base.

4. The repair method of claim 3, wherein the sgRNA further includes sgRNA-2; the targeting sequence of the sgRNA-2 is a sequence shown in SEQ ID No. 2; preferably, the sgRNA includes a chemical modification of a base.

5. Repair method according to any one of the claims 1-4, characterized in that the sequence of the additional splice donor site is AAGGTAATA.

6. Repair method according to any of claims 1-5, characterized in that the complex comprising Cas9 and sgRNA is introduced into the cell by means of electrotransformation.

7. The method of repair according to any one of claims 1 to 6, wherein the cells are hematopoietic stem cells, preferably the cells are CD34⁺The hematopoietic stem and progenitor cells of (1).

8. An sgRNA used for repairing intron abnormal splicing caused by HBB (beta-globin gene) IVS2-654C > T mutation, wherein the sgRNA comprises sgRNA-1, and the targeting sequence of the sgRNA-1 is a sequence shown in SEQ ID No. 1; preferably, the sgRNA further comprises sgRNA-2, and the targeting sequence of the sgRNA-2 is a sequence shown in SEQ ID No. 2.

9. Use of the sgRNA of claim 8 to repair intron aberrant splicing in a cell caused by a HBB (β -globin gene) IVS2-654C > T mutation.

10. Use according to claim 9, wherein said cells are hematopoietic stem cells, preferably said cells are CD34⁺The hematopoietic stem and progenitor cells of (1).