CN112111519A - ND4 gene recombinant adeno-associated virus vector and preparation method and application thereof - Google Patents

Abstract

The invention discloses a recombinant adeno-associated virus vector containing an ND4 gene expression cassette, wherein the skeleton of the recombinant adeno-associated virus vector is pAAV8, and the ND4 gene expression cassette contains a human ND4 gene or an optimized human ND4 gene. The invention also discloses a preparation method and application of the recombinant adeno-associated virus vector. The invention takes pAAV8 as a gene vector of ND4, and when ND4 is transduced into eyes of a patient, the invention ensures safety, has higher expression quantity on retina, higher transduction efficiency and high-efficiency expression capability and stronger capability of infecting optic nerve cells. The gene can be prepared into a medicament for intravitreal injection, can enhance the effect of the gene in Leber's gene therapy, and can reduce the injection dosage and shorten the healing time.

Description

ND4 gene recombinant adeno-associated virus vector and preparation method and application thereof

Technical Field

The invention relates to the field of biological pharmacy, in particular to an ND4 gene recombinant adeno-associated virus vector, a preparation method and application thereof.

Background

Leber's Hereditary Optic Neuropathy (LHON) is a mitochondrial hereditary disease that affects primarily fibers of the macular papilla bundle, leading to optic degeneration. The disease is better in young and middle-aged men, and clinically, the disease is manifested by acute or subacute painless hypopsia of both eyes simultaneously or successively, and simultaneously, the disease can be accompanied by central visual field defect and dyschromatopsia.

LHON is caused by mutation of mitochondrial sites, Chinese scholars preliminarily confirm that more than 95% of LHON patients in China are respectively related to mutation of 11778, 14484 and 3460 sites in mitochondrial DNA, wherein the 11778 site mutation is the most common, accounts for 89.2% of LHON in China, and the prognosis is the worst. The pathogenesis of the 11778 site mutation in mitochondrial DNA is due to a mutation in the 11778 th nucleotide of mitochondrial DNA (mtDNA), i.e., guanine (G) → adenine (a), which changes the 340 th amino acid encoded by the gene in NADH dehydrogenase subunit 4(ND4) from arginine to histidine on the respiratory chain. Although they are all basic amino acids, arginine at this position is highly conserved. Since mutations may reduce the efficiency of electron flow affecting the activity of enzymes and thereby reduce ATP production in the optic nerve cells, the cells gradually die, resulting in LHON in the patient.

LHON has no treatment method at present, is one of the accepted eye diseases caused by teenagers, and the gene therapy of LHON becomes possible along with the development of gene therapy, wherein the difficulty is that transfected genes enter a nucleus, and the mutation site of LHON is in mitochondrial DNA and is caused by ND4 abnormality in mitochondria.

The existing companies or organizations at home and abroad use the technology, and pack the nucleic acid sequence (see CN102634527B) as a gene medicine by using adeno-associated virus (pAAV 2), so that the gene medicine is used for experimental research and clinical tests and has achieved preliminary effect. However, transduction with pAAV2 was inefficient, heavily HSP-dependent, and slowly expressed, and was inhibited by soluble heparin and only reached the superficial retinal layer. Therefore, an ND4 recombinant expression vector with higher transduction efficiency and rapid expression is urgently needed.

Disclosure of Invention

The invention aims to overcome the defects of low transduction efficiency, slow expression and the like when the NADH dehydrogenase subunit 4(ND4) sequence packaged by pAAV2 is a gene drug in the prior art, and provides an ND4 gene recombinant adeno-associated virus vector, and a preparation method and application thereof. The invention takes pAAV8 as a gene vector of ND4, and when ND4 is transduced into eyes of a patient, the invention ensures safety, has higher expression quantity on retina, higher transduction efficiency and high-efficiency expression capability and stronger capability of infecting optic nerve cells. The gene can be prepared into a medicament for intravitreal injection, can enhance the effect of the gene in Leber's gene therapy, and can reduce the injection dosage and shorten the healing time.

In order to solve the technical problems, the invention provides a recombinant adeno-associated virus vector comprising an ND4 gene expression cassette, wherein the recombinant adeno-associated virus vector has a framework of pAAV8 (namely, an 8-type recombinant adeno-associated virus vector), and the ND4 gene expression cassette comprises a human ND4 gene or an optimized human ND4 gene.

Preferably, the ND4 gene expression cassette comprises a promoter, a Mitochondrial Targeting Sequence (MTS), a human ND4 gene or an optimized human ND4 gene, and/or a UTR sequence in order from N-terminus to C-terminus.

Preferably, the promoter is a CMV promoter or a CAG promoter; the nucleotide sequence of the promoter is preferably shown as SEQ ID NO. 3 or SEQ ID NO. 7.

In the present invention, the Mitochondrial Targeting Sequence (MTS) may be an unoptimized MTS sequence, and may be an optimized MTS sequence. Preferably, the nucleotide sequence of the Mitochondrion Targeting Sequence (MTS) is shown as SEQ ID NO. 4, SEQ ID NO. 9 or SEQ ID NO. 10; and/or the nucleotide sequence of the UTR sequence is shown as SEQ ID NO 6.

Preferably, the nucleotide sequence of the human ND4 gene is shown as SEQ ID NO. 5, and the nucleotide sequence of the optimized ND4 gene is shown as SEQ ID NO. 8 or SEQ ID NO. 11.

Preferably, the nucleotide sequence of the ND4 gene expression cassette is shown as SEQ ID NO. 1 or SEQ ID NO. 2; or the nucleotide sequence of the ND4 gene expression cassette is sequentially SEQ ID NO 7, SEQ ID NO 4, SEQ ID NO 5 and SEQ ID NO 6 from N end to C end, or sequentially SEQ ID NO 7, SEQ ID NO 4, SEQ ID NO 8 and SEQ ID NO 6, or sequentially SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 11 and SEQ ID NO 6, or sequentially SEQ ID NO 7, SEQ ID NO 4, SEQ ID NO 11 and SEQ ID NO 6, or sequentially SEQ ID NO 3, SEQ ID NO 9, SEQ ID NO 5 and SEQ ID NO 6, or sequentially SEQ ID NO 3, SEQ ID NO 9, SEQ ID NO 8 and SEQ ID NO 6, or sequentially SEQ ID NO 7, SEQ ID NO 9, SEQ ID NO 6, 5 and 6 or in sequence, 7, 9, 8, and 6 or 3, 9, 11, and 6 or 7, 9, 11, and 6 or 6, 3, 10, 5, and 6 or 3, 10, 8, and 6 or 3, 10, 8, and 6 or 5, 10, 8, and 6 or 7, 10, 8, and 6 in sequence, or 5, 6 in sequence, or 7, 10, 8, and 6 in sequence, or 7, 10, 5, 6 in sequence, or 7, 10, 8, and 6 in sequence, SEQ ID NO. 6, or SEQ ID NO. 3, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 6 in that order, or SEQ ID NO. 7, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 6 in that order.

In a preferred embodiment of the present invention, the nucleotide sequence of the ND4 gene expression cassette is shown in SEQ ID NO. 1, and specifically includes CMV promoter (203bp), fusion protein is initiated in optimized MTS sequence (84bp), initiation codon is ATG, encoding 28 amino acids, wild type NADH dehydrogenase subunit 4 gene sequence (1380bp) encodes 460 amino acids, UTR sequence is COX10-F μ ll (1425 bp).

The invention can select a strong promoter CAG with the expression intensity higher than that of CMV, select the strong promoter and the optimal human seed sequence to recombine and construct adeno-associated virus, and the packaged gene medicine can reduce the injection dosage and shorten the cure time.

In order to solve the above technical problems, the present invention provides a transformant obtained by introducing the above recombinant adeno-associated virus vector into a host and integrating the vector into the genome of the host.

Preferably, the host is a mammalian cell; more preferably, the mammalian cell is a HEK293 cell.

In order to solve the above technical problems, the present invention provides a method for preparing the above recombinant adeno-associated virus vector, comprising the steps of: and (3) inserting the ND4 gene expression cassette into an adeno-associated virus vector pAAV8 to obtain the gene.

The method can quickly and simply construct recombinant adeno-associated virus vectors carrying different recombinant human NADH dehydrogenase subunit 4 genes, and the recombinant adeno-associated virus vectors with complex defects are obtained by packaging.

In order to solve the above technical problems, the present invention provides a method for preparing ND4 fusion protein, comprising the steps of:

(1) preparing the above transformant;

(2) screening recombinants to obtain positive clones, expressing and purifying ND4 fusion protein.

In order to solve the technical problems, the invention provides an application of the recombinant adeno-associated virus vector in preparing a medicament for treating Leber hereditary optic neuropathy.

On the basis of the common knowledge in the field, the above preferred conditions can be combined randomly to obtain the preferred embodiments of the invention.

The reagents and starting materials used in the present invention are commercially available.

The positive progress effects of the invention are as follows: the invention takes pAAV8 as a gene vector of ND4, and when ND4 is transduced into eyes of a patient, the invention ensures safety, has higher expression quantity on retina, higher transduction efficiency and high-efficiency expression capability and stronger capability of infecting optic nerve cells. The gene can be prepared into a medicament for intravitreal injection, can enhance the effect of the gene in Leber's gene therapy, and can reduce the injection dosage and shorten the healing time. The fusion protein coded by the ND4 gene or the optimized ND4 gene expressed by the pAVV8 recombinant adeno-associated virus can enter mitochondria, and the expression level of the fusion protein is higher. In addition, the fusion protein is superior to the fusion protein expressed by other recombinant adeno-associated viruses such as pAVV2 and the like, is suitable for preparing medicaments for intravitreal injection, and is used for enhancing the effect of the gene in Leber's gene therapy.

Drawings

FIG. 1 is plasmid maps of two different recombinant human NADH dehydrogenase subunit 4 genes, FIG. 1A is a schematic diagram of pAAV-ND4, and FIG. 1B is a schematic diagram of pAAV-optimized ND 4.

FIG. 2 is a graph showing the results of the electrophoretic detection of the PCR products in example 1.

FIG. 3 is a graph showing the result of SDS-PAGE in example 1.

Fig. 4 is the fundus photographic result of one month after the operation in example 2.

FIG. 5 shows the immunofluorescence results of the retina against ND4 in example 2.

Fig. 6 shows the results of OCT measurement in example 2.

FIG. 7 shows the results of the relative quantification method for 2- Δ CT in example 2.

FIG. 8 shows the results of Western blot in example 2.

FIG. 9 is a statistical graph of the change in body weight of the mice in example 3 over one month.

FIG. 10 shows the results of QPCR detection in example 3.

Detailed Description

The invention is further illustrated by the following examples, which are not intended to limit the scope of the invention. The experimental methods without specifying specific conditions in the following examples were selected according to the conventional methods and conditions, or according to the commercial instructions.

Marker is available from bio-engineering (Shanghai) Co., Ltd,

the PCR product purification and recovery kit is purchased from Biotechnology engineering (Shanghai) Co., Ltd,

kpn I/Sal I enzyme is available from Biotechnology engineering (Shanghai) Co., Ltd,

the PlasmidTrans II (VGTC) transfection kit was purchased from Invitrogen, USA.

Example 1 construction of recombinant adeno-associated virus vector of human NADH dehydrogenase subunit 4 Gene and method for packaging and purifying Virus

Construction of recombinant adeno-associated virus vector containing human NADH dehydrogenase subunit 4(ND4) gene

1) Vector construction

The peptide as shown in SEQ ID NO:1 and the sequence of the recombinant human NADH dehydrogenase subunit 4(ND4) fusion gene shown as SEQ ID NO:2, respectively adding two enzyme cutting sites Kpn I and Sal I into the optimized fusion gene sequence of the recombinant human NADH dehydrogenase subunit 4(ND4) shown in the specification, synthesizing (the gene sequences are synthesized by Kpn I biotechnology Limited of Chengdu Optingxi), or respectively designing primers (2 primers respectively comprise two enzyme cutting sites of Kpn I and Sal I) by taking the DNA sequence of ND4 as a template, carrying out PCR amplification, respectively carrying out double enzyme cutting on the synthesized product or the amplified product and a plasmid vector pAAV-MCS (comprising outer shell plasmids pAAV2, pAAV3, pAAV4, pAAV6, pAAV7 and pAAV8 which are all purchased from Biovector), and recovering the enzyme cutting product. The enzyme digestion products of the DNA sequences of ND4 and optimized ND4 are respectively mixed with the enzyme digestion product of pAAV-MCS plasmid, T4DNA Ligase (purchased from Tiangen) is added for connecting overnight at 16 ℃, and the connecting reaction system is conventional in the art. The ligation product was transformed into competent cell DH5a (Tiangen Biochemical technology (Beijing) Co., Ltd.) to obtain different recombinant human NADH dehydrogenase subunit 4 gene plasmids: pAAV-ND4 (FIG. 1A) and pAAV-optimized ND4 (FIG. 1B).

2) Screening and characterization of recombinants

The 2 recombinant human NADH dehydrogenase subunit 4 gene plasmids obtained above are respectively coated on an LB plate, and the LB plate cultured at 37 ℃ is taken to generate blue spots and white spots, wherein the white spots are recombinant clones. White colonies were picked up and added to LB liquid medium containing Amp at 100mg/L, and cultured at 37 ℃ and 200rpm for 8 hours. After the culture, taking a bacterial liquid, extracting plasmids, wherein a plasmid extraction reagent is a Biomiga plasmid extraction kit, and the steps refer to the manufacturer's instructions. Taking 1 uL plasmid as a template to carry out PCR amplification (the amplification procedure is shown in Table 1) and then carrying out electrophoresis identification, wherein,

for SEQ ID NO:1, designing specific primers as follows:

1F：5’-ATCTCCGCACACTCTCTCCTCA-3’(SEQ ID NO:12)

1R：5’-GAGGAAAACCCGGTAATGATGTC-3’(SEQ ID NO:13)

for SEQ ID NO:2, designing specific primers as follows:

2F：5’-CAGCCCCCACACCCTGAGCAGC-3’(SEQ ID NO:14)

2R：5’-CTGCTGAAGCCGGTGATGATGTC-3’(SEQ ID NO:15)

TABLE 1 PCR amplification procedure

And (3) carrying out electrophoresis detection on all PCR products to obtain a target band with the size of about 1500bp, which indicates that the screened plasmid is the target plasmid. In fig. 2, M: a protein Marker; 1: the screened pAAV 2/2-optimized ND4 positive recombinant; 2: the selected pAAV 2/8-optimized ND4 positive recombinant.

3) Bacterial liquid preservation, PCR amplification and fragment sequencing thereof

And (3) sucking 1mL of identified bacterial liquid and sterilized glycerol in a volume ratio of 1:3, uniformly mixing, storing at-80 ℃, sequencing bacterial liquid (Wuhan jin Kerui bioengineering Co., Ltd.), and respectively comparing and analyzing sequences obtained by sequencing with corresponding recombinant human NADH dehydrogenase subunit 4 genes to successfully obtain recombinant adeno-associated virus plasmids with correct sequences.

(II) production of human NADH dehydrogenase subunit 4 gene recombination adeno-associated virus

1) The day before transfection, HEK293(ATCC) cells were seeded at 225cm²In the cell culture bottle, the inoculation density is 3.0 multiplied by 10⁷The cells were cultured in DMEM + 10% bovine serum (Corning) at 37 ℃ in the presence of 5% CO₂Was cultured overnight in an incubator.

2) The day of transfection, the medium was changed and the culture was continued in fresh DMEM medium containing 10% bovine serum. When the cells grow to 80-90%, the culture medium is discarded, and transfection is carried out by using a plasmid Trans II (VGTC) transfection kit. The method comprises the following specific steps:

(a) taking pAdhelper (purchased from Biovector), pAAV-r2c8 (purchased from Biovector) and the obtained plasmids in a molar ratio of 1:1:1 and DMEM + plasmid Trans II (VGTC) (transfection reagent) in each transfection bottle, mixing uniformly in a 1.5mL sterile Ep tube, numbering as reagent A, and standing at room temperature for 10-15 min;

(b) uniformly mixing the reagent A with 30mL of DMEM + 10% bovine serum, and numbering the reagent B;

(c) adding reagent B into cell culture bottle uniformly, and adding 5% CO at 37 deg.C₂Continuously culturing in the incubator;

(d) 16 hours after transfection, all were replaced with complete medium (DMEM + 10% bovine serum) for culture.

3) Cells were harvested 48 hours after transfection.

4) Harvested cells were resuspended in PBS and freeze-thawed 3 times repeatedly.

(III) purification and concentration of human NADH dehydrogenase subunit 4 gene virus

Adopting three steps of chloroform treatment, PEG/NaCl precipitation and chloroform extraction to separate, concentrate and purify to obtain rAAV2/2 and rAAV2/8 viruses. Total recovery is the number of virus particles in the final product ÷ the number of virus particles in the final product.

(IV) verification of Virus purity and titer

And pouring SDS-PAGE separation gel and lamination gel, wherein the concentration of the separation gel is 10%. Each well was loaded with 15. mu.g of the sample. After electrophoresis, the gel was stained with Coomassie Brilliant blue (Biyuntian) and destained with the appropriate destaining solution until a clear band with low background was revealed (results are shown in FIG. 3).

The results showed that VP1/VP2/VP3 (corresponding to three bands from top to bottom) of the Viral Particles (VP) corresponding to the above viral proteins were 1:1:10 (the ratio is the ratio of the relative molecular mass), the bands were clear, the ratio was normal, no bands were visible, and the purity was 99% or more. In FIG. 3, lane 1 protein marker; lane 2: rAAV 2/2-optimized ND 4; lane 3: rAAV 2/8-optimized ND 4.

Measurement of titer of recombinant human NADH dehydrogenase subunit 4 Gene the physical titer of the human NADH dehydrogenase subunit 4 gene (number of viral particles contained in each ml of liquid) was determined by the fluorescent quantitative PCR method.

SYBRⅡ(takara); target fragment primer (20. mu.M); packaging the target plasmid for virus (plasmid copy number 2E +12 vg/ml); a virus to be tested; PCR octal tubes (Bio-red). The experimental method comprises the following steps: mu.l template, 7. mu.l SYBR II, 10.25. mu.l primer, 20.25. mu.l primer, and nucleole-free water to 14. mu.l. And (3) PCR reaction conditions: pre-denaturation: 10min at 95 ℃; and (3) circulation: 95 ℃ for 15sec, 60 ℃ for 1 min; 40 cycles. The genome titer was determined to be 1X 10¹²vg/mL。

Example 2: effect experiment of human NADH dehydrogenase subunit 4 gene recombinant adeno-associated virus on Leber's dominant hereditary optic neuropathy

First, rabbit eye vitreous chamber and retina detection ND4 expression result

1. Injection for rabbit eye in vitreous cavity

The rabbits were divided into groups according to the following table, 2 rabbits in each group were aspirated by 50. mu.l of 1X 10 rabbits¹²vg/mL of different recombinant human NADH dehydrogenase subunit 4 gene adeno-associated viruses puncture the pars plana of the ciliary body into the vitreous cavity at a distance of 3mm from the limbus, and vitreous cavity injection is carried out.

In the invention, unless otherwise specified, the wild ND4 refers to human ND4, and the specific sequence corresponds to SEQ ID NO: 1; the optimized ND4 refers to the optimized ND4, and the specific sequence corresponds to the sequence shown in SEQ ID NO: 2.

2. slit lamp, intraocular pressure, fundus photography examination

The 3 groups of rabbits were subjected to slit lamp and intraocular pressure examination at 1, 7 and 30 days after the operation. All rabbits had no obvious abnormality, no conjunctival congestion, no secretion, no endophthalmitis, and no increase in intraocular pressure. Fundus photographs taken one month post-surgery (fig. 4) showed no significant complications or damage to retinal vessels and optic nerves in all rabbits. Indicating that the normal standard vitreous cavity injection does not have a significant inflammatory response or other complications.

3. Fluorography of retina

After 30 days of intravitreal injection, fluorescence photography of the retina shows that GFP is successfully expressed on the retina, which indicates that the rAAV is used as a vector and carries GFP to transfect the vitreous humor of rabbit eyes, and proves that the rAAV2/8-ND4, rAAV2/2-ND4 recombinant genes and other recombinant genes can be expressed on the retina.

4. Immunofluorescence detection

After 30 days of intravitreal injection, the eyeballs of the experimental group and the control group were peeled off and paraffin sections were prepared. Paraffin sections were placed in a 65 ℃ oven and baked for 2 hours, dewaxed to water, and rinsed three times with PBS for 5min each. The slices are placed in EDTA buffer solution for microwave repair, the power is cut off after the medium fire is boiled, and the low fire is boiled at intervals of 10 min. After natural cooling, the cells were washed with PBS for 5min 3 times. The sections were placed in 3% hydrogen peroxide solution and incubated at room temperature for 10 min. Washing with PBS for 3 times, each for 5min, spin-drying, and blocking with 5% BSA for 20 min. BSA solution was removed and 50. mu.l of diluted primary antibody (Abcam) was added to each section to cover the tissue overnight at 4 ℃. PBS was washed three times for 5min each. PBS solution is removed, 50-100. mu.l of fluorescent secondary antibody (Abcam) of the corresponding species is added to each section, and incubation is carried out for 50min-1h at room temperature in the absence of light. Washed 3 times with PBS in the dark for 5min each time. The PBS solution was removed. Each section was stained with 50-100. mu.l DAPI (Hangzhou Haoxin Biotechnology Co., Ltd.) for 5min in the dark. PBS wash 3 times for 5min each. After the section is dried slightly, the section is sealed by an anti-fluorescence quenching sealing agent, and the section is stored at 4 ℃ in the dark for photographing.

The results of the immunofluorescence prediction of the retina against ND4 show that the fluorescence intensity of the experimental M and N groups is higher than that of the control group, the AAV2/2 group and other groups (the fluorescence intensity is improved by about 50%), and a significant difference exists (P is less than 0.05, and figure 5), which indicates that the effect of infecting the optic nerve cells by the AAV2/8 is obviously better than that of infecting the optic nerve cells by the AAV2/2, the AAV2/3, the AAV2/4, the AAV2/6 and the AAV 2/7. Meanwhile, the immunofluorescence detection of the rAAV 2/8-optimized ND4 group is obviously higher than that of the rAAV 2/8-wild ND4 group, and the difference is significant (P is less than 0.05, and figure 5).

5. Optical Coherence Tomography (OCT) detection

The results showed no significant difference in retinal nerve fiber layer thickness between the experimental group A, M and the control group (P > 0.05, FIG. 6).

(II) RT-PCR (Real-Time PCR) detection of ND4 expression result

1. Primer design

Firstly, analyzing the conserved structure of hND4 by using NCBI conserved domain analysis software to ensure that the amplification fragment of the designed primer is positioned in a non-conserved region; then, according to the primer design principle of fluorescent quantitative PCR, a primer premier 5 is used for designing a primer (rabbit-actin is used as an internal reference):

rabbit-actin-F: CCTTCTACAACGAGCTGCGC (SEQ ID NO:16)

rabbit-actin-R: TACAGGGACAGCACGGCC (SEQ ID NO:17)

For SEQ ID NO:1 primer

H-ND4-1F：CTGCCTACGACAAACAGAC(SEQ ID NO:18)

H-ND4-1R：AGTGCGTTCGTAGTTTGAG(SEQ ID NO:19)

For SEQ ID NO:2 in the presence of a primer

H-ND4-2F：CTGCCTGCGCCAGACCGAC(SEQ ID NO:20)

H-ND4-2R：TCCAGGGGGTCTGGATCAG(SEQ ID NO:21)

2. RNA extraction, reverse transcription

Total RNA of rabbit retinas of different experimental groups was extracted by TRIZOL kit (Tiangen) and reverse transcribed to synthesize cDNA template.

3. Reaction system and reaction program of fluorescent quantitative PCR

Fluorescent quantitative PCR was performed on a Real-time PCR Detection System instrument. SYBR Green mix 12.5. mu. L, ddH was added to a 0.2mL PCR reaction tube₂O8. mu.L, 1. mu.L each of a pair of primers, 2.5. mu.L of cDNA sample, 25. mu.L of total. Each sample is used for amplifying a target gene and an internal reference gene rabbit-actin, and amplification of each gene is repeated three times. In order to reduce errors in actual sample application, reagents common to the individual PCR reaction tubes may be added together and then dispensed. After the sample is added, performing fluorescence quantitative PCR.

Amplification was performed according to a 40 cycle reaction program of pre-denaturation at 95 ℃ for 1s, denaturation at 94 ℃ for 15s, annealing at 55 ℃ for 15s, and extension at 72 ℃ for 45s, and fluorescent signals were collected during the extension phase of each cycle. And after the reaction is finished, analyzing a melting curve at 94-55 ℃.

The difference of gene expression quantity is researched by adopting a 2-delta-CT relative quantification method (Livak et al 2001), a standard curve is not required to be made, the internal reference gene of a housekeeping gene rabbit-actin (Wuhan Kingkunrei bioengineering Co., Ltd.) can be used for automatically generating an expression numerical value by analysis software carried by an instrument, compared with a control group and an AB group, the ND4 gene expression water of an experiment M, N group is obviously improved (P is less than 0.05, and figure 7), the rAAV2/8 has stronger capability of infecting optic nerves than that of rAAV2/2, rAAV2/3, rAAV2/4, rAAV2/6 and rAAV2/7, wherein the mRNA level of rAAV2/5 is improved by about 50% than that of rAAV 2/2.

(III) detection of expression of ND4 protein by Western blot (Western blot experiment)

Retinas of the eyeballs of rabbits of different experimental groups were separated, and a corresponding volume of RIPA lysate (brand: Solarbio, cat # R0010) was added to each 100. mu.L/50 mg of tissue, and the supernatant was collected by centrifugation after homogenization in a homogenizer. After the BCA method is used for determining the protein concentration, the sample loading volumes of an experimental group and a control group are calculated according to 50 mu g of total protein, and SDS-PAGE gel electrophoresis and Western blot are carried out. The antibody (abcam) was incubated and then developed.

In the Western blot experiment group, the relative expression level of ND4 in the M group and the N group is obviously higher than that in the A group and the B group (P > 0.05, FIG. 8), which indicates that rAAV2/8 has stronger infectivity than rAAV2/2 and other groups. Wherein, the protein expression level of the rAAV2/10 is about 2 times higher than that of the rAAV 2/2.

Example 3: AAV2/2-hND4 and AAV2/8-hND4 were injected into mouse muscle tissue, and their expression differences were analyzed by qPCR.

20 mice were divided into 5 groups and divided into control groups as described above (intravitreal injection of 0.1% 5X 10)¹⁰vg rAAV-ZsGreen [ Guangzhou Paizhizhen Biotechnology Co., Ltd ]]) And the experimental group A, B, C, D were injected into the 4 recombinant human NADH dehydrogenase subunit 4 gene recombinant adeno-associated viruses in vitreous form(rAAV 2/2-optimized ND4 and rAAV2/2-ND4, rAAV 2/8-optimized ND4 and rAAV2/8-ND4, 50 μ l, 1 × 10¹²vg/mL), was injected by puncture at the medial thigh of the mouse. The change in body weight of the mice over one month was observed (the results are shown in FIG. 9) and mouse thigh tissue mRNA was extracted. The ND4 gene was detected by qPCR, and the relative expression levels of the ND4 gene in the experimental group and the control group were compared (the results are shown in FIG. 10).

As can be seen in FIG. 9, the weight of A, B, C, D group mice increased over time, and injection of AAV2/2 and AAV2/8 was safe for the mice.

As can be seen from FIG. 10, the relative expression levels of the rAAV 2/2-optimized ND4 and the rAAV2/2-ND4 in the A, B group were increased by about 40 times, and the relative expression levels of the rAAV 2/8-optimized ND4 and the rAAV2/8-ND4 in the C, D group were increased by about 80 times.

With the rapid development of gene therapy in the treatment of ocular diseases, it would also be difficult to cure Leber's. Since the human eye is similar to the rabbit eye in anatomy and volume, we modeled the rabbit eye as a intravitreal injection of rAAV-ND 4. The experiment researches the injection dosage, the safety level and the postoperative complications, and provides important reference for future clinical trials. The examination of the slit lamp and intraocular pressure of all rabbits showed no obvious abnormality, no conjunctival congestion, no secretion, no endophthalmitis, and no increase in intraocular pressure. Fundus photographs taken one month after surgery showed no obvious complications or damage to retinal vessels and optic nerves in all rabbits. The experiment is shown to be safe.

Since Leber's lesions cause apoptosis of retinal ganglion cells surrounding the optic disc. The results of fundus photography and OCT show that a single intravitreal injection is 1.5X 10¹⁰The vg/mL rAAV2/8-ND4 has no safety problem and can be applied to clinical tests. The results of immunofluorescence, real-time quantitative PCR and Western blot prove that the rAAV2/8-ND4 is more strongly expressed on the retina of rabbits than the rAAV2/2-hND 4. Preferably, the invention can also select a strong promoter CAG with the expression intensity higher than that of CMV, select the strong promoter and the optimal human seed sequence to recombine and construct adeno-associated virus, and the packaged gene medicine can reduce the injection dosage and shorten the healing time.

SEQUENCE LISTING

<110> Wuhan Newcastle Biotechnology Ltd

<120> ND4 gene recombinant adeno-associated virus vector, preparation method and application thereof

<130> P180117394C

<160> 21

<170> PatentIn version 3.5

<210> 1

<211> 3092

<212> DNA

<213> Artificial Sequence

<220>

<223> CMV + MTS sequence optimized 1+ ND4 sequence unoptimized + UTR

<400> 1

gtgatgcggt tttggcagta catcaatggg cgtggatagc ggtttgactc acggggattt 60

ccaagtctcc accccattga cgtcaatggg agtttgtttt gcaccaaaat caacgggact 120

ttccaaaatg tcgtaacaac tccgccccat tgacgcaaat gggcggtagg cgtgtacggt 180

gggaggtcta tataagcaga gctatggccg ccagccccca caccctgagc agccgcctgc 240

tgaccggctg cgtgggcggc agcgtgtggt acctggagcg ccgcaccatg ctaaaactaa 300

tcgtcccaac aattatgtta ctaccactga catggctttc caaaaaacac atgatttgga 360

tcaacacaac cacccacagc ctaattatta gcatcatccc tctactattt tttaaccaaa 420

tcaacaacaa cctatttagc tgttccccaa ccttttcctc cgacccccta acaacccccc 480

tcctaatgct aactacctgg ctcctacccc tcacaatcat ggcaagccaa cgccacttat 540

ccagtgaacc actatcacga aaaaaactct acctctctat gctaatctcc ctacaaatct 600

ccttaattat gacattcaca gccacagaac taatcatgtt ttatatcttc ttcgaaacca 660

cacttatccc caccttggct atcatcaccc gatggggcaa ccagccagaa cgcctgaacg 720

caggcacata cttcctattc tacaccctag taggctccct tcccctactc atcgcactaa 780

tttacactca caacacccta ggctcactaa acattctact actcactctc actgcccaag 840

aactatcaaa ctcctgggcc aacaacttaa tgtggctagc ttacacaatg gcttttatgg 900

taaagatgcc tctttacgga ctccacttat ggctccctaa agcccatgtc gaagccccca 960

tcgctgggtc aatggtactt gccgcagtac tcttaaaact aggcggctat ggtatgatgc 1020

gcctcacact cattctcaac cccctgacaa aacacatggc ctaccccttc cttgtactat 1080

ccctatgggg catgattatg acaagctcca tctgcctacg acaaacagac ctaaaatcgc 1140

tcattgcata ctcttcaatc agccacatgg ccctcgtagt aacagccatt ctcatccaaa 1200

ccccctggag cttcaccggc gcagtcattc tcatgatcgc ccacgggctt acatcctcat 1260

tactattctg cctagcaaac tcaaactacg aacgcactca cagtcgcatc atgatcctct 1320

ctcaaggact tcaaactcta ctcccactaa tggctttttg gtggcttcta gcaagcctcg 1380

ctaacctcgc cttacccccc actattaacc tactgggaga actctctgtg ctagtaacca 1440

cgttctcctg gtcaaatatc actctcctac ttacaggact caacatgcta gtcacagccc 1500

tatactccct ctacatgttt accacaacac aatggggctc actcacccac cacattaaca 1560

acatgaaacc ctcattcaca cgagaaaaca ccctcatgtt catgcaccta tcccccattc 1620

tcctcctatc cctcaacccc gacatcatta ccgggttttc ctcttaagag cactgggacg 1680

cccaccgccc ctttccctcc gctgccaggc gagcatgttg tggtaattct ggaacacaag 1740

aagagaaatt gctgggttta gaacaagatt ataaacgaat tcggtgctca gtgatcactt 1800

gacagttttt ttttttttta aatattaccc aaaatgctcc ccaaataaga aatgcatcag 1860

ctcagtcagt gaatacaaaa aaggaattat ttttcccttt gagggtcttt tatacatctc 1920

tcctccaacc ccaccctcta ttctgtttct tcctcctcac atgggggtac acatacacag 1980

cttcctcttt tggttccatc cttaccacca caccacacgc acactccaca tgcccagcag 2040

agtggcactt ggtggccaga aagtgtgagc ctcatgatct gctgtctgta gttctgtgag 2100

ctcaggtccc tcaaaggcct cggagcaccc ccttccttgt gactgagcca gggcctgcat 2160

ttttggtttt ccccacccca cacattctca accatagtcc ttctaacaat accaatagct 2220

aggacccggc tgctgtgcac tgggactggg gattccacat gtttgccttg ggagtctcaa 2280

gctggactgc cagcccctgt cctcccttca cccccattgc gtatgagcat ttcagaactc 2340

caaggagtca caggcatctt tatagttcac gttaacatat agacactgtt ggaagcagtt 2400

ccttctaaaa gggtagccct ggacttaata ccagccggat acctctggcc cccaccccat 2460

tactgtacct ctggagtcac tactgtgggt cgccactcct ctgctacaca gcacggcttt 2520

ttcaaggctg tattgagaag ggaagttagg aagaagggtg tgctgggcta accagcccac 2580

agagctcaca ttcctgtccc ttgggtgaaa aatacatgtc catcctgata tctcctgaat 2640

tcagaaatta gcctccacat gtgcaatggc tttaagagcc agaagcaggg ttctgggaat 2700

tttgcaagtt acctgtggcc aggtgtggtc tcggttacca aatacggtta cctgcagctt 2760

tttagtcctt tgtgctccca cgggtctaca gagtcccatc tgcccaaagg tcttgaagct 2820

tgacaggatg ttttcgatta ctcagtctcc cagggcacta ctggtccgta ggattcgatt 2880

ggtcggggta ggagagttaa acaacattta aacagagttc tctcaaaaat gtctaaaggg 2940

attgtaggta gataacatcc aatcactgtt tgcacttatc tgaaatcttc cctcttggct 3000

gcccccaggt atttactgtg gagaacattg cataggaatg tctggaaaaa gcttctacaa 3060

cttgttacag ccttcacatt tgtagaagct tt 3092

<210> 2

<211> 3092

<212> DNA

<213> Artificial Sequence

<220>

<223> CMV + MTS sequence optimization 1+ ND4 sequence optimization 1+ UTR

<400> 2

gtgatgcggt tttggcagta catcaatggg cgtggatagc ggtttgactc acggggattt 60

ccaagtctcc accccattga cgtcaatggg agtttgtttt gcaccaaaat caacgggact 120

ttccaaaatg tcgtaacaac tccgccccat tgacgcaaat gggcggtagg cgtgtacggt 180

gggaggtcta tataagcaga gctatggccg ccagccccca caccctgagc agccgcctgc 240

tgaccggctg cgtgggcggc agcgtgtggt acctggagcg ccgcaccatg ctgaagctga 300

tcgtgcccac catcatgctg ctgcccctga cctggctgag caagaagcac atgatctgga 360

tcaacaccac cacccacagc ctgatcatca gcatcatccc cctgctgttc ttcaaccaga 420

tcaacaacaa cctgttcagc tgcagcccca ccttcagcag cgaccccctg accacccccc 480

tgctgatgct gaccacctgg ctgctgcccc tgaccatcat ggccagccag cgccacctga 540

gcagcgagcc cctgagccgc aagaagctgt acctgagcat gctgatcagc ctgcagatca 600

gcctgatcat gaccttcacc gccaccgagc tgatcatgtt ctacatcttc ttcgagacca 660

ccctgatccc caccctggcc atcatcaccc gctggggcaa ccagcccgag cgcctgaacg 720

ccggcaccta cttcctgttc tacaccctgg tgggcagcct gcccctgctg atcgccctga 780

tctacaccca caacaccctg ggcagcctga acatcctgct gctgaccctg accgcccagg 840

agctgagcaa cagctgggcc aacaacctga tgtggctggc ctacaccatg gccttcatgg 900

tgaagatgcc cctgtacggc ctgcacctgt ggctgcccaa ggcccacgtg gaggccccca 960

tcgccggcag catggtgctg gccgccgtgc tgctgaagct gggcggctac ggcatgatgc 1020

gcctgaccct gatcctgaac cccctgacca agcacatggc ctaccccttc ctggtgctga 1080

gcctgtgggg catgatcatg accagcagca tctgcctgcg ccagaccgac ctgaagagcc 1140

tgatcgccta cagcagcatc agccacatgg ccctggtggt gaccgccatc ctgatccaga 1200

ccccctggag cttcaccggc gccgtgatcc tgatgatcgc ccacggcctg accagcagcc 1260

tgctgttctg cctggccaac agcaactacg agcgcaccca cagccgcatc atgatcctga 1320

gccagggcct gcagaccctg ctgcccctga tggccttctg gtggctgctg gccagcctgg 1380

ccaacctggc cctgcccccc accatcaacc tgctgggcga gctgagcgtg ctggtgacca 1440

ccttcagctg gagcaacatc accctgctgc tgaccggcct gaacatgctg gtgaccgccc 1500

tgtacagcct gtacatgttc accaccaccc agtggggcag cctgacccac cacatcaaca 1560

acatgaagcc cagcttcacc cgcgagaaca ccctgatgtt catgcacctg agccccatcc 1620

tgctgctgag cctgaacccc gacatcatca ccggcttcag cagctaagag cactgggacg 1680

cccaccgccc ctttccctcc gctgccaggc gagcatgttg tggtaattct ggaacacaag 1740

aagagaaatt gctgggttta gaacaagatt ataaacgaat tcggtgctca gtgatcactt 1800

gacagttttt ttttttttta aatattaccc aaaatgctcc ccaaataaga aatgcatcag 1860

ctcagtcagt gaatacaaaa aaggaattat ttttcccttt gagggtcttt tatacatctc 1920

tcctccaacc ccaccctcta ttctgtttct tcctcctcac atgggggtac acatacacag 1980

cttcctcttt tggttccatc cttaccacca caccacacgc acactccaca tgcccagcag 2040

agtggcactt ggtggccaga aagtgtgagc ctcatgatct gctgtctgta gttctgtgag 2100

ctcaggtccc tcaaaggcct cggagcaccc ccttccttgt gactgagcca gggcctgcat 2160

ttttggtttt ccccacccca cacattctca accatagtcc ttctaacaat accaatagct 2220

aggacccggc tgctgtgcac tgggactggg gattccacat gtttgccttg ggagtctcaa 2280

gctggactgc cagcccctgt cctcccttca cccccattgc gtatgagcat ttcagaactc 2340

caaggagtca caggcatctt tatagttcac gttaacatat agacactgtt ggaagcagtt 2400

ccttctaaaa gggtagccct ggacttaata ccagccggat acctctggcc cccaccccat 2460

tactgtacct ctggagtcac tactgtgggt cgccactcct ctgctacaca gcacggcttt 2520

ttcaaggctg tattgagaag ggaagttagg aagaagggtg tgctgggcta accagcccac 2580

agagctcaca ttcctgtccc ttgggtgaaa aatacatgtc catcctgata tctcctgaat 2640

tcagaaatta gcctccacat gtgcaatggc tttaagagcc agaagcaggg ttctgggaat 2700

tttgcaagtt acctgtggcc aggtgtggtc tcggttacca aatacggtta cctgcagctt 2760

tttagtcctt tgtgctccca cgggtctaca gagtcccatc tgcccaaagg tcttgaagct 2820

tgacaggatg ttttcgatta ctcagtctcc cagggcacta ctggtccgta ggattcgatt 2880

ggtcggggta ggagagttaa acaacattta aacagagttc tctcaaaaat gtctaaaggg 2940

attgtaggta gataacatcc aatcactgtt tgcacttatc tgaaatcttc cctcttggct 3000

gcccccaggt atttactgtg gagaacattg cataggaatg tctggaaaaa gcttctacaa 3060

cttgttacag ccttcacatt tgtagaagct tt 3092

<210> 3

<211> 203

<212> DNA

<213> Artificial Sequence

<220>

<223> CMV sequence

<400> 3

gtgatgcggt tttggcagta catcaatggg cgtggatagc ggtttgactc acggggattt 60

ccaagtctcc accccattga cgtcaatggg agtttgtttt gcaccaaaat caacgggact 120

ttccaaaatg tcgtaacaac tccgccccat tgacgcaaat gggcggtagg cgtgtacggt 180

gggaggtcta tataagcaga gct 203

<210> 4

<211> 84

<212> DNA

<213> Artificial Sequence

<220>

<223> MTS sequence optimization 1

<400> 4

atggccgcca gcccccacac cctgagcagc cgcctgctga ccggctgcgt gggcggcagc 60

gtgtggtacc tggagcgccg cacc 84

<210> 5

<211> 1380

<212> DNA

<213> Homo sapiens

<400> 5

atgctaaaac taatcgtccc aacaattatg ttactaccac tgacatggct ttccaaaaaa 60

cacatgattt ggatcaacac aaccacccac agcctaatta ttagcatcat ccctctacta 120

ttttttaacc aaatcaacaa caacctattt agctgttccc caaccttttc ctccgacccc 180

ctaacaaccc ccctcctaat gctaactacc tggctcctac ccctcacaat catggcaagc 240

caacgccact tatccagtga accactatca cgaaaaaaac tctacctctc tatgctaatc 300

tccctacaaa tctccttaat tatgacattc acagccacag aactaatcat gttttatatc 360

ttcttcgaaa ccacacttat ccccaccttg gctatcatca cccgatgggg caaccagcca 420

gaacgcctga acgcaggcac atacttccta ttctacaccc tagtaggctc ccttccccta 480

ctcatcgcac taatttacac tcacaacacc ctaggctcac taaacattct actactcact 540

ctcactgccc aagaactatc aaactcctgg gccaacaact taatgtggct agcttacaca 600

atggctttta tggtaaagat gcctctttac ggactccact tatggctccc taaagcccat 660

gtcgaagccc ccatcgctgg gtcaatggta cttgccgcag tactcttaaa actaggcggc 720

tatggtatga tgcgcctcac actcattctc aaccccctga caaaacacat ggcctacccc 780

ttccttgtac tatccctatg gggcatgatt atgacaagct ccatctgcct acgacaaaca 840

gacctaaaat cgctcattgc atactcttca atcagccaca tggccctcgt agtaacagcc 900

attctcatcc aaaccccctg gagcttcacc ggcgcagtca ttctcatgat cgcccacggg 960

cttacatcct cattactatt ctgcctagca aactcaaact acgaacgcac tcacagtcgc 1020

atcatgatcc tctctcaagg acttcaaact ctactcccac taatggcttt ttggtggctt 1080

ctagcaagcc tcgctaacct cgccttaccc cccactatta acctactggg agaactctct 1140

gtgctagtaa ccacgttctc ctggtcaaat atcactctcc tacttacagg actcaacatg 1200

ctagtcacag ccctatactc cctctacatg tttaccacaa cacaatgggg ctcactcacc 1260

caccacatta acaacatgaa accctcattc acacgagaaa acaccctcat gttcatgcac 1320

ctatccccca ttctcctcct atccctcaac cccgacatca ttaccgggtt ttcctcttaa 1380

<210> 6

<211> 1425

<212> DNA

<213> Homo sapiens

<400> 6

gagcactggg acgcccaccg cccctttccc tccgctgcca ggcgagcatg ttgtggtaat 60

tctggaacac aagaagagaa attgctgggt ttagaacaag attataaacg aattcggtgc 120

tcagtgatca cttgacagtt tttttttttt ttaaatatta cccaaaatgc tccccaaata 180

agaaatgcat cagctcagtc agtgaataca aaaaaggaat tatttttccc tttgagggtc 240

ttttatacat ctctcctcca accccaccct ctattctgtt tcttcctcct cacatggggg 300

tacacataca cagcttcctc ttttggttcc atccttacca ccacaccaca cgcacactcc 360

acatgcccag cagagtggca cttggtggcc agaaagtgtg agcctcatga tctgctgtct 420

gtagttctgt gagctcaggt ccctcaaagg cctcggagca cccccttcct tgtgactgag 480

ccagggcctg catttttggt tttccccacc ccacacattc tcaaccatag tccttctaac 540

aataccaata gctaggaccc ggctgctgtg cactgggact ggggattcca catgtttgcc 600

ttgggagtct caagctggac tgccagcccc tgtcctccct tcacccccat tgcgtatgag 660

catttcagaa ctccaaggag tcacaggcat ctttatagtt cacgttaaca tatagacact 720

gttggaagca gttccttcta aaagggtagc cctggactta ataccagccg gatacctctg 780

gcccccaccc cattactgta cctctggagt cactactgtg ggtcgccact cctctgctac 840

acagcacggc tttttcaagg ctgtattgag aagggaagtt aggaagaagg gtgtgctggg 900

ctaaccagcc cacagagctc acattcctgt cccttgggtg aaaaatacat gtccatcctg 960

atatctcctg aattcagaaa ttagcctcca catgtgcaat ggctttaaga gccagaagca 1020

gggttctggg aattttgcaa gttacctgtg gccaggtgtg gtctcggtta ccaaatacgg 1080

ttacctgcag ctttttagtc ctttgtgctc ccacgggtct acagagtccc atctgcccaa 1140

aggtcttgaa gcttgacagg atgttttcga ttactcagtc tcccagggca ctactggtcc 1200

gtaggattcg attggtcggg gtaggagagt taaacaacat ttaaacagag ttctctcaaa 1260

aatgtctaaa gggattgtag gtagataaca tccaatcact gtttgcactt atctgaaatc 1320

ttccctcttg gctgccccca ggtatttact gtggagaaca ttgcatagga atgtctggaa 1380

aaagcttcta caacttgtta cagccttcac atttgtagaa gcttt 1425

<210> 7

<211> 934

<212> DNA

<213> Artificial Sequence

<220>

<223> CAG promoter

<400> 7

attgacgtca ataatgacgt atgttcccat agtaacgcca atagggactt tccattgacg 60

tcaatgggtg gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat 120

gccaagtacg ccccctattg acgtcaatga cggtaaatgg cccgcctggc attatgccca 180

gtacatgacc ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat 240

taccatggtc gaggtgagcc ccacgttctg cttcactctc cccatctccc ccccctcccc 300

acccccaatt ttgtatttat ttatttttta attattttgt gcagcgatgg gggcgggggg 360

gggggggggg cgcgcgccag gcggggcggg gcggggcgag gggcggggcg gggcgaggcg 420

gagaggtgcg gcggcagcca atcagagcgg cgcgctccga aagtttcctt ttatggcgag 480

gcggcggcgg cggcggccct ataaaaagcg aagcgcgcgg cgggcgggag tcgctgcgcg 540

ctgccttcgc cccgtgcccc gctccgccgc cgcctcgcgc cgcccgcccc ggctctgact 600

gaccgcgtta ctcccacagg tgagcgggcg ggacggccct tctcctccgg gctgtaatta 660

gcgcttggtt taatgacggc ttgtttcttt tctgtggctg cgtgaaagcc ttgaggggct 720

ccgggagggc cctttgtgcg gggggagcgg ctcggggctg tccgcggggg gacggctgcc 780

ttcggggggg acggggcagg gcggggttcg gcttctggcg tgtgaccggc ggctctagag 840

cctctgctaa ccatgttcat gccttcttct ttttcctaca gctcctgggc aacgtgctgg 900

ttattgtgct gtctcatcat tttggcaaag aatt 934

<210> 8

<211> 1380

<212> DNA

<213> Artificial Sequence

<220>

<223> ND4 sequence optimization 1

<400> 8

atgctgaagc tgatcgtgcc caccatcatg ctgctgcccc tgacctggct gagcaagaag 60

cacatgatct ggatcaacac caccacccac agcctgatca tcagcatcat ccccctgctg 120

ttcttcaacc agatcaacaa caacctgttc agctgcagcc ccaccttcag cagcgacccc 180

ctgaccaccc ccctgctgat gctgaccacc tggctgctgc ccctgaccat catggccagc 240

cagcgccacc tgagcagcga gcccctgagc cgcaagaagc tgtacctgag catgctgatc 300

agcctgcaga tcagcctgat catgaccttc accgccaccg agctgatcat gttctacatc 360

ttcttcgaga ccaccctgat ccccaccctg gccatcatca cccgctgggg caaccagccc 420

gagcgcctga acgccggcac ctacttcctg ttctacaccc tggtgggcag cctgcccctg 480

ctgatcgccc tgatctacac ccacaacacc ctgggcagcc tgaacatcct gctgctgacc 540

ctgaccgccc aggagctgag caacagctgg gccaacaacc tgatgtggct ggcctacacc 600

atggccttca tggtgaagat gcccctgtac ggcctgcacc tgtggctgcc caaggcccac 660

gtggaggccc ccatcgccgg cagcatggtg ctggccgccg tgctgctgaa gctgggcggc 720

tacggcatga tgcgcctgac cctgatcctg aaccccctga ccaagcacat ggcctacccc 780

ttcctggtgc tgagcctgtg gggcatgatc atgaccagca gcatctgcct gcgccagacc 840

gacctgaaga gcctgatcgc ctacagcagc atcagccaca tggccctggt ggtgaccgcc 900

atcctgatcc agaccccctg gagcttcacc ggcgccgtga tcctgatgat cgcccacggc 960

ctgaccagca gcctgctgtt ctgcctggcc aacagcaact acgagcgcac ccacagccgc 1020

atcatgatcc tgagccaggg cctgcagacc ctgctgcccc tgatggcctt ctggtggctg 1080

ctggccagcc tggccaacct ggccctgccc cccaccatca acctgctggg cgagctgagc 1140

gtgctggtga ccaccttcag ctggagcaac atcaccctgc tgctgaccgg cctgaacatg 1200

ctggtgaccg ccctgtacag cctgtacatg ttcaccacca cccagtgggg cagcctgacc 1260

caccacatca acaacatgaa gcccagcttc acccgcgaga acaccctgat gttcatgcac 1320

ctgagcccca tcctgctgct gagcctgaac cccgacatca tcaccggctt cagcagctaa 1380

<210> 9

<211> 84

<212> DNA

<213> Homo sapiens

<400> 9

atggccgcca gcccccacac cctgagcagc cgcctgctga ccggctgcgt gggcggcagc 60

gtgtggtacc tggagcgccg cacc 84

<210> 10

<211> 84

<212> DNA

<213> Artificial Sequence

<220>

<223> MTS sequence optimization 2

<400> 10

atggccgcct ctccacacac actgagtagc agactgctga ccggctgtgt tggcggctct 60

gtgtggtatc tggaacggcg gaca 84

<210> 11

<211> 1380

<212> DNA

<213> Artificial Sequence

<220>

<223> ND4 sequence optimization 2

<400> 11

atgctgaagc tgatcgtgcc caccatcatg ctgctgcctc tgacctggct gagcaagaaa 60

cacatgatct ggatcaacac caccacgcac agcctgatca tcagcatcat ccctctgctg 120

ttcttcaacc agatcaacaa caacctgttc agctgcagcc ccaccttcag cagcgaccct 180

ctgacaacac ctctgctgat gctgaccacc tggctgctgc ccctcacaat catggcctct 240

cagagacacc tgagcagcga gcccctgagc cggaagaaac tgtacctgag catgctgatc 300

tccctgcaga tctctctgat catgaccttc accgccaccg agctgatcat gttctacatc 360

tttttcgaga caacgctgat ccccacactg gccatcatca ccagatgggg caaccagcct 420

gagagactga acgccggcac ctactttctg ttctacaccc tcgtgggcag cctgccactg 480

ctgattgccc tgatctacac ccacaacacc ctgggctccc tgaacatcct gctgctgaca 540

ctgacagccc aagagctgag caacagctgg gccaacaatc tgatgtggct ggcctacaca 600

atggccttca tggtcaagat gcccctgtac ggcctgcacc tgtggctgcc taaagctcat 660

gtggaagccc ctatcgccgg ctctatggtg ctggctgcag tgctgctgaa actcggcggc 720

tacggcatga tgcggctgac cctgattctg aatcccctga ccaagcacat ggcctatcca 780

tttctggtgc tgagcctgtg gggcatgatt atgaccagca gcatctgcct gcggcagacc 840

gatctgaagt ccctgatcgc ctacagctcc atcagccaca tggccctggt ggtcaccgcc 900

atcctgattc agaccccttg gagctttaca ggcgccgtga tcctgatgat tgcccacggc 960

ctgacaagca gcctgctgtt ttgtctggcc aacagcaact acgagcggac ccacagcaga 1020

atcatgatcc tgtctcaggg cctgcagacc ctcctgcctc ttatggcttt ttggtggctg 1080

ctggcctctc tggccaatct ggcactgcct cctaccatca atctgctggg cgagctgagc 1140

gtgctggtca ccacattcag ctggtccaat atcaccctgc tgctcaccgg cctgaacatg 1200

ctggttacag ccctgtactc cctgtacatg ttcaccacca cacagtgggg aagcctgaca 1260

caccacatca acaatatgaa gcccagcttc acccgcgaga acaccctgat gttcatgcat 1320

ctgagcccca ttctgctgct gtccctgaat cctgatatca tcaccggctt ctccagctga 1380

<210> 12

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> 1F

<400> 12

atctccgcac actctctcct ca 22

<210> 13

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> 1R

<400> 13

gaggaaaacc cggtaatgat gtc 23

<210> 14

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> 2F

<400> 14

cagcccccac accctgagca gc 22

<210> 15

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> 2R

<400> 15

ctgctgaagc cggtgatgat gtc 23

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Rabbit-actin-F

<400> 16

ccttctacaa cgagctgcgc 20

<210> 17

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Rabbit-actin-R

<400> 17

tacagggaca gcacggcc 18

<210> 18

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> H-ND4-1F

<400> 18

ctgcctacga caaacagac 19

<210> 19

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> H-ND4-1R

<400> 19

agtgcgttcg tagtttgag 19

<210> 20

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> H-ND4-2F

<400> 20

ctgcctgcgc cagaccgac 19

<210> 21

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> H-ND4-2R

<400> 21

tccagggggt ctggatcag 19

Claims (10)

1. A recombinant adeno-associated virus vector comprising an ND4 gene expression cassette, wherein the framework of the recombinant adeno-associated virus vector is pAAV8, and the ND4 gene expression cassette comprises a human ND4 gene or an optimized human ND4 gene.

2. The recombinant adeno-associated viral vector according to claim 1 wherein the ND4 gene expression cassette comprises in order from N-terminus to C-terminus a promoter, a mitochondrial targeting sequence, a human ND4 gene or an optimized human ND4 gene, and/or a UTR sequence.

3. The recombinant adeno-associated viral vector according to claim 2 wherein the promoter is a CMV promoter or a CAG promoter; the nucleotide sequence of the promoter is preferably shown as SEQ ID NO. 3 or SEQ ID NO. 7.

4. The recombinant adeno-associated viral vector according to claim 2, wherein the mitochondrial targeting sequence has the nucleotide sequence shown in SEQ ID No. 4, SEQ ID No. 9 or SEQ ID No. 10; and/or the nucleotide sequence of the UTR sequence is shown as SEQ ID NO 6.

5. The recombinant adeno-associated virus vector according to claim 2, wherein the nucleotide sequence of the human ND4 gene is shown in SEQ ID NO. 5, and the nucleotide sequence of the optimized human ND4 gene is shown in SEQ ID NO. 8 or SEQ ID NO. 11.

6. The recombinant adeno-associated virus vector according to claim 2, wherein the nucleotide sequence of the ND4 gene expression cassette is shown in SEQ ID NO 1 or SEQ ID NO 2; or the nucleotide sequence of the ND4 gene expression cassette is sequentially SEQ ID NO 7, SEQ ID NO 4, SEQ ID NO 5 and SEQ ID NO 6 from N end to C end, or sequentially SEQ ID NO 7, SEQ ID NO 4, SEQ ID NO 8 and SEQ ID NO 6, or sequentially SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 11 and SEQ ID NO 6, or sequentially SEQ ID NO 7, SEQ ID NO 4, SEQ ID NO 11 and SEQ ID NO 6, or sequentially SEQ ID NO 3, SEQ ID NO 9, SEQ ID NO 5 and SEQ ID NO 6, or sequentially SEQ ID NO 3, SEQ ID NO 9, SEQ ID NO 8 and SEQ ID NO 6, or sequentially SEQ ID NO 7, SEQ ID NO 9, SEQ ID NO 6, 5 and 6 or in sequence, 7, 9, 8, and 6 or 3, 9, 11, and 6 or 7, 9, 11, and 6 or 6, 3, 10, 5, and 6 or 3, 10, 8, and 6 or 3, 10, 8, and 6 or 5, 10, 8, and 6 or 7, 10, 8, and 6 in sequence, or 5, 6 in sequence, or 7, 10, 8, and 6 in sequence, or 7, 10, 5, 6 in sequence, or 7, 10, 8, and 6 in sequence, SEQ ID NO. 6, or SEQ ID NO. 3, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 6 in that order, or SEQ ID NO. 7, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 6 in that order.

7. A transformant obtained by introducing the recombinant adeno-associated virus vector according to any one of claims 1 to 6 into a host and integrating the vector into the genome of the host; preferably, the host is a mammalian cell; more preferably, the mammalian cell is a HEK293 cell.

8. A method for preparing the recombinant adeno-associated viral vector according to any one of claims 1 to 6, wherein the method comprises the steps of: and (3) inserting the ND4 gene expression cassette into an adeno-associated virus vector pAAV8 to obtain the gene.

9. A method of preparing ND4 fusion protein, comprising the steps of:

(1) preparing the transformant according to claim 7;

(2) screening recombinants to obtain positive clones, expressing and purifying ND4 fusion protein.

10. Use of the recombinant adeno-associated virus vector according to any one of claims 1 to 6 in the manufacture of a medicament for the treatment of Leber's hereditary optic neuropathy.

Images