CN112111409B - Penicillium oxalicum and application thereof - Google Patents
Penicillium oxalicum and application thereof Download PDFInfo
- Publication number
- CN112111409B CN112111409B CN202010933191.2A CN202010933191A CN112111409B CN 112111409 B CN112111409 B CN 112111409B CN 202010933191 A CN202010933191 A CN 202010933191A CN 112111409 B CN112111409 B CN 112111409B
- Authority
- CN
- China
- Prior art keywords
- penicillium oxalicum
- dichloromethane
- culture medium
- azo
- ethanol
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
- C12R2001/80—Penicillium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N45/00—Biocides, pest repellants or attractants, or plant growth regulators, containing compounds having three or more carbocyclic rings condensed among themselves, at least one ring not being a six-membered ring
- A01N45/02—Biocides, pest repellants or attractants, or plant growth regulators, containing compounds having three or more carbocyclic rings condensed among themselves, at least one ring not being a six-membered ring having three carbocyclic rings
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
- A01N63/36—Penicillium
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C251/00—Compounds containing nitrogen atoms doubly-bound to a carbon skeleton
- C07C251/72—Hydrazones
- C07C251/84—Hydrazones having doubly-bound carbon atoms of hydrazone groups being part of rings other than six-membered aromatic rings
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P15/00—Preparation of compounds containing at least three condensed carbocyclic rings
Abstract
The invention relates to the technical field of microorganisms, in particular to a fungus obtained from deep sea cold spring sediments, a natural azo steroid derivative obtained from the fungus, a preparation method of the natural azo steroid derivative and application of the natural azo steroid derivative in algae inhibition and bacteriostasis. The specific structural formula is shown as (I), and the preparation method comprises extracting deep sea cold spring sediment from Penicillium oxalicum (A)Penicillium oxalicum)13-37 is inoculated in a fungus culture medium for fermentation culture, and the fermentation product is separated and purified to obtain the azo steroid derivative shown in the formula (I). The azo steroid derivative obtained by the invention has the activities of resisting microalgae and bacteria.
Description
Technical Field
The invention relates to the technical field of microorganisms, in particular to a fungus obtained from deep sea cold spring sediments, a natural azo steroid derivative obtained from the fungus, a preparation method of the natural azo steroid derivative and application of the natural azo steroid derivative in algae inhibition and bacteriostasis.
Background
In recent years, the frequency of red tide generation in coastal areas of China is higher and higher, and the generation area is larger and larger. When red tide occurs, floating algae in the water body are propagated in a large quantity, shellfish toxin is secreted in a large quantity, aquatic organisms such as fish, shrimps and shellfish can be poisoned, and poisoning phenomena with different degrees can be generated after people eat aquatic products containing toxin by mistake. Marine pathogenic bacteria widely exist in marine water, such as vibrio, prawn and shellfish, and are harmful to human health. The vibrios are various in types and wide in distribution, large-area death of shrimps and shellfishes can be caused, various diseases can be caused when people infect the vibrios, and the topic of effectively inhibiting the proliferation of pathogenic bacteria becomes a hot topic at one time.
The known physical method, chemical method and biological method for treating red tide and marine pathogenic bacteria have small effect and great damage to the environment, so that at present, scientists find that secondary metabolites of some deep sea fungi have strong inhibition effect on red tide algae and pathogenic bacteria, have the characteristics of environmental friendliness and the like, and provide a new research idea for treating the red tide and the marine pathogenic bacteria.
Disclosure of Invention
The invention aims to provide fungi obtained from deep sea cold spring sediments, natural azo steroid derivatives obtained from the fungi, a preparation method of the derivatives and application of the derivatives in algae inhibition and bacteriostasis.
In order to achieve the purpose, the invention adopts the technical scheme that:
a strain of penicillium oxalicum, penicillium oxalicum (B)Penicillium oxalicum)13-37 is preserved in China general microbiological culture Collection center (CGMCC) at 6 months and 9 days in 2020, with the preservation number of CGMCC No.19913 and the preservation unit address of No. 3 Hospital No.1 of Xilu, North Chen, the south China, Beijing.
The application of the penicillium oxalicum, and the application of the strain as an algae inhibitor or a bacteriostatic agent.
The algae inhibitor or bacteriostatic agent is one or more of fermentation product, bacterial suspension, concentrate, separating medium and compound obtained after fermentation product purification of the strain.
The fermentation product is penicillium oxalicum (A)Penicillium oxalicum)13-37 is inoculated in a fungus culture medium and fermented.
An azo steroid derivative, the structure of which is shown in formula (I)
（I）。
A preparation method of azo steroid derivative comprises extracting Penicillium oxalicum (Penicillium) from deep sea cold spring sedimentPenicillium oxalicum)13-37 is inoculated in a fungus culture medium for fermentation culture, and the fermentation product is purified to obtain the azo steroid derivative shown in the formula (I); said penicillium oxalicum (A), (B)Penicillium oxalicum）13-37 is preserved in China general microbiological culture Collection center (CGMCC) in 6 months and 9 days in 2020, with the preservation number of CGMCC No. 19913;
（I）。
the preparation method comprises the following specific steps:
1) mixing Penicillium oxalicum (B)Penicillium oxalicum)13-37 are inoculated in a fungus culture medium and fermented for 10-90 days, and then extracted and concentrated by an organic solvent extracting solution to obtain a crude extract;
2) subjecting the crude extract obtained in the step 1) to silica gel column chromatography, performing gradient elution by using an organic solvent, collecting eluent, and detecting the eluent by thin layer chromatography;
3) collecting the eluted components in the step 2), and sequentially carrying out reversed phase silica gel column chromatography and gel column chromatography for separation and purification to obtain the azo steroid derivative shown in the formula (I).
The fungus culture medium in the step 1) is a rice solid culture medium, a jerusalem artichoke glucose liquid culture medium or a potato glucose liquid culture medium;
the organic solvent extract is one or more of ethyl acetate, petroleum ether, n-hexane, cyclohexane, dichloromethane, methanol, ethanol, propanol or isopropanol; wherein the several substances are mixed in any proportion.
The eluent in the step 2) is one or more of petroleum ether-ethyl acetate, petroleum ether-ethanol, petroleum ether-propanol, petroleum ether-isopropanol, dichloromethane-ethyl acetate, dichloromethane-methanol, dichloromethane-ethanol, dichloromethane-propanol and dichloromethane-isopropanol in a volume ratio of 50-0: 1;
the eluent of the reverse phase silica gel column chromatography in the step 3) is methanol aqueous solution or ethanol aqueous solution, wherein the volume fraction of methanol or ethanol in the aqueous solution accounts for 20-100% (when the methanol or the ethanol accounts for 100%, the eluent is the methanol or the ethanol); the eluent of the gel column chromatography is dichloromethane-methanol or dichloromethane-ethanol with the volume ratio of 2-0: 1.
The application of the azo steroid derivative in an algistat or a bacteriostatic agent.
The algistat is one or more of red tide bent algae, marine shield algae or prorocentrum donghaiense which can inhibit the harm caused by red tide; the bacteriostatic agent is one or more of pseudomonas citrosum, escherichia coli, staphylococcus aureus, vibrio harveyi and vibrio parahaemolyticus.
The invention has the following advantages: the azosteroid derivative of the invention is fungus penicillium oxalicum separated from deep sea cold spring sediment (B)Penicillium oxalicum)13-37 is obtained by fermentation, extraction, separation and purification, and the half inhibitory concentrations of the compounds to red tide heterocurvulus, marine shield algae and east sea Prorocentrum that can cause red tide are respectively 3.7 microgram/ml, 1.2 microgram/ml and 0.68 microgram/ml through an anti-microalgae activity experiment and an anti-bacterial experiment, and the sizes of the inhibition zones to pseudomonas citreus, escherichia coli, staphylococcus aureus, vibrio harveyi and vibrio parahaemolyticus are respectively 6.5, 8.3, 7.0, 11.3 and 11.7 millimeters.
The specific implementation mode is as follows:
the following examples are presented to further illustrate embodiments of the present invention, and it should be understood that the embodiments described herein are for purposes of illustration and explanation only and are not intended to limit the invention.
Example 1
Penicillium oxalicum (B)Penicillium oxalicum)13-37 acquisition:
1. separation of the strains:
performing gradient dilution on the deep-sea cold spring sediment sample by using sterile seawater, wherein the separation dilution degree adopts 10-4-10-60.2 ml, 0.4 ml, 0.6 ml and 0.8 ml of the culture medium are respectively smeared on a PDA culture medium, a PSA culture medium, a YM culture medium and a Chashi culture medium. Culturing at 28 deg.C for 5-30 days, and observing fungal colony. According to the difference of colony morphological characteristics on the plate, plate streaking purification culture is carried out.
2. Identification of the strains:
2.1, morphological and physiological and biochemical characteristic identification:
the strain grows fast, is in a dark green velvet shape, has dense spore blocks and is preliminarily identified as the penicillium.
2.2 ITS rDNA sequence homology analysis:
extracting and cloning the ribosome rDNA gene transcription spacer sequence of the strain to carry out gene sequencing, and obtaining the following gene sequence:
CCAACCTCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCCTCACGGCCGCCGGGGGGCATCCGCCCCCGGGCCCGCGCCCGCCGAAGACACACAAACGAACTCTTGTCTGAAGATTGCAGTCTGAGTACTTGACTAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCTCGCCCCCCGCTTCCGGGGGGCGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGTAGGCCCGGCCGGCGCCCGCCGGCGAACACCATCAATCTTAACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAAC, identifying Strain 13-37 as Penicillium oxalicum (B) ((R))Penicillium oxalicum）。
Example 2
The structure of the azosteroid derivative obtained by separating the fungi from the deep sea cold spring sediment source is shown as the formula (I).
The compound has the following physicochemical and spectral characteristics:
yellow crystals; specific optical rotation [ alpha ]]27 D 141.9 (c0.02, MeOH); nuclear magnetic resonance hydrogen spectrum (deuterium substituted chloroform as solvent)δ H 1.98 m, 1.90 m, 2.60 m, 2.40 m, 7.08 s ,2.61 d (16.1), 2.53 d (16.1), 2.85 t (9.4), 1.92 m , 1.81 m , 1.75 m, 1.62 dt (12.5,8.1), 2.56 m, 2.46 m, 1.86 m, 1.74 m,1.39 br d (12.7), 1.00 s, 1.16 s, 2.39 m,1.07 d (7.0), 5.25 dd (15.5,4.6), 5.28 dd (15.5,5.0), 1.87 m , 1.47 octet (6.8), 0.82 d (6.8), 0.84 d (6.8), 0.92 d (6.8), 11.07 s, 7.66 d (8.5), 7.45 dd (8.5,7.1), 6.84 dd (7.8,7.1), 7.98 d(7.8)；
Nuclear magnetic resonance carbon spectrum (deuterated chloroform as solvent)δ C 37.6 CH2, 20.9 CH2, 144.4 C, 131.7 CH, 141.6 C, 199.2 C, 41.3 CH2, 62.8 C, 49.5 CH, 35.6 C, 25.6 CH2, 39.2 CH2, 53.8 C, 215.9 C, 38.2 CH2, 23.2 CH2, 50.8 CH，17.3 CH3, 24.5 CH3, 37.5 CH, 23.6 CH3, 132.8 CH, 135.0 CH, 43.4 CH, 33.2 CH, 19.8 CH3, 20.2 CH3, 17.8 CH3147.3C, 114.1 CH, 135.8 CH, 119.1 CH, 131.7 CH, 109.4C, 172.4C; high resolution mass spectrum [ M + Na]+ m/z581.3357, calculated 581.3355.
Example 3
A preparation method of an azo steroid derivative shown as a formula (I):
collecting the good Penicillium oxalicum (B) on the platePenicillium oxalicum)13-37 strains, cutting into small pieces, inoculating into rice solid culture medium, adding 50 g of rice solid culture medium and 100 ml of semi-seawater (50 ml of distilled water and 50 ml of seawater) into each 1L of triangular flask, standing and fermenting for 30 days at room temperature, and then fermenting with a volume ratio of 1:1, extracting the mixture for three times by dichloromethane-methanol, concentrating the mixture under reduced pressure, and obtaining 536 g of crude extract of the metabolite of the penicillium oxalicum in total after concentration.
The rice solid medium comprises 500 g of rice, 20 g of glucose, 6 g of peptone, 5 g of yeast extract, 3 g of monosodium glutamate and 1 g of NaBr per liter.
Penicillium oxalicum (B)Penicillium oxalicum) The strain 13-37 is preserved in China general microbiological culture Collection center (CGMCC) at 6 months and 9 days in 2020, address: the collection number of the institute of microbiology of China academy of sciences is CGMCC No.19913, and the classification name isPenicillium oxalicumThe strain number is 13-37. .
Subjecting the crude extract of the metabolite of penicillium oxalicum to 100-200-mesh silica gel column chromatography, performing gradient elution by using petroleum ether-ethyl acetate and dichloromethane-methanol in volume ratios of 50:1, 20:1, 10:1, 5:1, 2:1, 1:1 to 0:1 and 20:1, 10:1, 5:1, 2:1 to 0:1 in sequence, collecting eluates of each section, detecting the collected components by Thin Layer Chromatography (TLC) (dichloromethane-methanol in volume ratio of 50-1:1 is developed, anisaldehyde-sulfuric acid is developed), judging and combining the same or similar parts according to a specific shift value (Rf value) to obtain 8 components (1-8).
Developing the component 5 with Rf value of 0.4-0.5 (petroleum ether-ethyl acetate with volume ratio of 1:2, developing anisaldehyde-sulfuric acid), that is, eluting the component with petroleum ether-ethyl acetate gradient with volume ratio of 1:1, sequentially passing through reversed phase C18Separating with silica gel column and Sephadex LH-20 gel column. Inverse phase C18The silica gel column chromatography eluent is 98% methanol aqueous solution (namely methanol aqueous solution, wherein the volume of methanol accounts for 98%), TLC detection (petroleum ether-ethyl acetate development in a volume ratio of 1:2, anisaldehyde-sulfuric acid color development) is carried out, and anisaldehyde-sulfuric acid orange-colored components are collected; and performing Sephadex LH-20 gel column chromatography with methanol as eluent, detecting by TLC (petroleum ether-ethyl acetate at volume ratio of 1:2 for development, and anisaldehyde-sulfuric acid for color development), and collecting component with Rf value of 0.4-0.5 to obtain compound (9.4 mg) shown in formula (I). And detecting by thin layer chromatography (petroleum ether-ethyl acetate at volume ratio of 1:2 developing, anisaldehyde-sulfuric acid developing), and determining as pure compound, wherein the spot appears as single orange-red spot. The structure of the derivative is identified as an azo steroid derivative through spectral analysis, and the structural formula is shown as (I).
Example 4
The difference from example 2 is that a good growth of Penicillium oxalicum (B) on a plate was obtainedPenicillium oxalicum)13-37 strains, cutting into small pieces, inoculating into Jerusalem artichoke glucose liquid culture medium, putting 300 ml of culture medium into each 1L triangular flask, fermenting for 45 days at room temperature, filtering, and collecting mycelium and fermentation liquid. The Jerusalem artichoke glucose liquid culture medium comprises 500 ml of Jerusalem artichoke tuber juice, 500 ml of aged seawater, 20 g of glucose, 5 g of peptone and 3 g of yeast extract per liter. Extracting with ethyl acetate for three timesVacuum concentrating, and concentrating to obtain 216 g of crude extract of the metabolite of the penicillium oxalicum.
Subjecting the crude extract of the penicillium oxalicum metabolite to 200-300-mesh silica gel column chromatography, sequentially performing gradient elution by using petroleum ether-ethanol with volume ratios of 50:1, 30:1, 20:1, 15:1, 10:1, 5:1, 2:1, and 1:1 to 0:1, respectively collecting eluates, detecting the collected components by thin layer chromatography (petroleum ether-ethanol with volume ratio of 50-0:1 is developed, and anisaldehyde-sulfuric acid is developed), judging and combining the same or similar parts according to Rf value, and obtaining 8 components (1-8).
Subjecting component 3 with Rf value of 0.5-0.6 (petroleum ether-ethanol with volume ratio of 30:1, anisaldehyde-sulfuric acid color) to gradient elution with petroleum ether-ethanol with volume ratio of 20:1, and sequentially subjecting to reversed phase C18Separating with silica gel column and Sephadex LH-20 gel column. Inverse phase C18The silica gel column chromatography eluent is 90% ethanol aqueous solution (namely, ethanol aqueous solution, wherein the volume of ethanol accounts for 90%), TLC detection (petroleum ether-ethanol with the volume ratio of 30:1, anisaldehyde-sulfuric acid color development) is carried out, and anisaldehyde-sulfuric acid orange-colored components are collected; collecting component, subjecting to Sephadex LH-20 gel column chromatography with ethanol as eluent, detecting by TLC (petroleum ether-ethanol with volume ratio of 30:1, and anisaldehyde-sulfuric acid for color development), and collecting component with Rf value of 0.5-0.6 to obtain azo steroid derivative shown in formula (I).
Example 5
Anti-microalgae activity experiment:
specifically, the monomer compound obtained in the above example is prepared into a 4 mg/ml compound solution or a crude extract solution of the metabolite of Penicillium oxalicum by using dimethyl sulfoxide (DMSO) as a sample, the microalgae to be tested is activated, the microalgae in the logarithmic growth phase is taken, and the sterilized f/2 culture medium is adopted to dilute the microalgae to about 5X 104Algal cell concentration per ml. And taking a 96-well plate, and adding 195 microliter of algae liquid into each well to obtain a test culture plate. The experimental group was supplemented with 5. mu.l of a 4 mg/ml compound solution or crude extract solution, the blank control group was supplemented with 5. mu.l of a solvent, and the positive control group was supplemented with 5. mu.l of K at a concentration of 4 mg/ml2Cr2O7The solution, experimental group, positive control group and blank control group are respectively provided withThree in parallel. The culture temperature is 20 ℃, the illumination intensity is 2000 Lux, and the light-dark ratio is 14:10 (hours), and the culture is carried out for 24 hours. Counting microalgae in each experimental group under a microscope by using a blood counting plate. Wherein the microalgae to be tested are red tide heterocurvula, marine dunaliella and prorocentrum donghaiense.
The experimental results are as follows: the obtained azosteroid derivative has the inhibition rates of 100%, 100% and 100% for Heterosigma akashiwo, Sclerodera oceanica and Prorocentrum donghaiense respectively under the concentration, and has the effect of inhibiting Heterosigma akashiwo, Sclerodera oceanica and Prorocentrum donghaiense. Meanwhile, under the concentration, the inhibition rates of the crude extract of the metabolite of the penicillium oxalicum on the isocurvulum rubescens, the marine dunaliella and the prorocentrum donghaiense are respectively 100%, 93% and 100%, so that the metabolite of the strain has the effect of inhibiting the isocurvulum rubescens, the marine dunaliella and the prorocentrum donghaiense.
Further calculation of the median Inhibitory Concentration (IC) of the compound50Value). Diluting the prepared compound solution with the final concentration of 4 mg/ml to finally obtain 10 groups of solutions with sequentially reduced concentrations of components 400, 200, 100, 50, 25, 12.5, 6.25, 3.125, 1.5625, 0.78125, 0.390625, 0 and 1953125 micrograms/ml, wherein at least 3 groups of the solutions are arranged in parallel in each gradient, the method is the same as the method, the microalgae inhibition rate of the compound under each concentration gradient is observed and calculated by a microscope, at least 6 concentration gradients with the inhibition rate between 0 and 100 are taken, and the half inhibition concentration is calculated.
The experimental results are as follows: the obtained azo steroid derivative has IC effect on Heterosigma akashiwo, Scutellaria oceanica and Prorocentrum donghaiense50The values are respectively 3.7 micrograms/ml, 1.2 micrograms/ml and 0.68 micrograms/ml, and the product has the effects of inhibiting Heterocurus akashiwo, Scophthora ocellata and prorocentrum donghaiense.
Example 6
Experiment for antibacterial Activity
Activating the test strain, inoculating to LB culture medium or 2216E bacteria culture medium, and culturing at 37 deg.C for 24 hr. Then washing the culture medium with 0.85% NaCl solution, sucking out the bacterial suspension, and diluting the bacterial liquid to 1.5X 10 by using a turbidimetric method4CFU/ml. Wherein the test bacteria is lemon fake sheetBacillus, colibacillus, staphylococcus aureus, vibrio harveyi and vibrio parahaemolyticus. Then, each bacterial suspension is further diluted to 1.0X 10 by water6CFU/ml, and plated. The crude extracts of the monomeric compounds or metabolites of penicillium oxalicum obtained in the above examples were dissolved in dimethyl sulfoxide (DMSO) to prepare a solution of the monomeric compounds at a concentration of 4 mg/ml and a solution of the crude extract at a concentration of 20 mg/ml, respectively. 5 microliters of sample was then applied to a 5 mm diameter sterile filter paper sheet, and the filter paper sheet with the same volume of solvent added was used as a negative control and chloramphenicol as a positive control, each set being 3 replicates each. And finally, placing the plate added with the sample and the control in an incubator at 37 ℃, standing and culturing for 24 hours, and measuring the diameter of the inhibition zone by adopting a cross method.
The experimental results are as follows: the sizes of the inhibition zones of the obtained azo steroid derivative (20 micrograms per filter paper sheet) on the pseudomonas citrulline, the escherichia coli, the staphylococcus aureus, the vibrio harveyi and the vibrio parahaemolyticus are respectively 6.5 mm, 8.3 mm, 7.0 mm, 11.3 mm and 11.7 mm, so that the compound has the effect of inhibiting the pseudomonas citrulline, the escherichia coli, the staphylococcus aureus, the vibrio harveyi and the vibrio parahaemolyticus.
Meanwhile, the size of the inhibition zone of the crude extract (100 micrograms per filter paper sheet) of the metabolite of the penicillium oxalicum to vibrio parahaemolyticus and vibrio lautus is 6.6 mm and 6.3 mm respectively, so that the effect of inhibiting the vibrio parahaemolyticus and the vibrio lautus can be seen.
Sequence listing
<110> institute of tobacco pipe coastal zone of Chinese academy of sciences
<120> penicillium oxalicum and application thereof
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 515
<212> DNA
<213> Artificial design (Artificial Sequence)
<400> 1
ccaacctccc acccgtgttt atcgtacctt gttgcttcgg cgggcccgcc tcacggccgc 60
cggggggcat ccgcccccgg gcccgcgccc gccgaagaca cacaaacgaa ctcttgtctg 120
aagattgcag tctgagtact tgactaaatc agttaaaact ttcaacaacg gatctcttgg 180
ttccggcatc gatgaagaac gcagcgaaat gcgataagta atgtgaattg cagaattcag 240
tgaatcatcg agtctttgaa cgcacattgc gccccctggt attccggggg gcatgcctgt 300
ccgagcgtca ttgctgccct caagcacggc ttgtgtgttg ggctctcgcc ccccgcttcc 360
ggggggcggg cccgaaaggc agcggcggca ccgcgtccgg tcctcgagcg tatggggctt 420
cgtcacccgc tctgtaggcc cggccggcgc ccgccggcga acaccatcaa tcttaaccag 480
gttgacctcg gatcaggtag ggatacccgc tgaac 515
Claims (10)
1. A strain of penicillium oxalicum is characterized in that: penicillium oxalicum 13-37 is preserved in China general microbiological culture Collection center (CGMCC) at 6.9.2020, with the preservation number of CGMCC No.19913 and the preservation unit address of No. 3 Hospital No.1, North Cheng Xilu, the sunward area of Beijing.
2. The use of penicillium oxalicum according to claim 1, wherein: the application of the strain in preparing an algistat or a bacteriostatic agent.
3. The use of penicillium oxalicum according to claim 2, wherein: the algae inhibitor or bacteriostatic agent is one or more of fermentation product, bacterial suspension, concentrate, separating medium and compound obtained after fermentation product purification of the strain.
4. Use of penicillium oxalicum according to claim 3, wherein: the fermentation product is obtained by inoculating Penicillium oxalicum (Penicillium oxalicum)13-37 into a fungus culture medium for fermentation.
5. An azosteroid derivative characterized by: the structure of the azo steroid derivative is shown as the formula (I)
6. A process for the preparation of an azosteroid derivative according to claim 5, characterized in that: inoculating Penicillium oxalicum 13-37 from deep sea cold spring sediment into a fungus culture medium for fermentation culture, and purifying a fermentation product to obtain the azo steroid derivative shown in the formula (I); the Penicillium oxalicum (Penicillium oxalicum)13-37 is preserved in China general microbiological culture Collection center (CGMCC) at 6-9 th of 2020, with the preservation number of CGMCC No. 19913;
7. the process for the preparation of azosteroid derivatives according to claim 6, characterized by the particular preparation steps:
1) inoculating Penicillium oxalicum 13-37 into a fungus culture medium, fermenting for 10-90 days, extracting with an organic solvent extract, and concentrating to obtain a crude extract;
2) subjecting the crude extract obtained in the step 1) to silica gel column chromatography, performing gradient elution by using an organic solvent, collecting eluent, and detecting the eluent by thin layer chromatography;
3) collecting the eluted components in the step 2), and sequentially carrying out reversed phase silica gel column chromatography and gel column chromatography for separation and purification to obtain the azo steroid derivative shown in the formula (I).
8. A process for the preparation of an azosteroid derivative according to claim 7, wherein: the fungus culture medium in the step 1) is a rice solid culture medium, a jerusalem artichoke glucose liquid culture medium or a potato glucose liquid culture medium;
the organic solvent extract is one or more of ethyl acetate, petroleum ether, n-hexane, cyclohexane, dichloromethane, methanol, ethanol, propanol or isopropanol;
the eluent in the step 2) is one or more of petroleum ether-ethyl acetate, petroleum ether-ethanol, petroleum ether-propanol, petroleum ether-isopropanol, dichloromethane-ethyl acetate, dichloromethane-methanol, dichloromethane-ethanol, dichloromethane-propanol and dichloromethane-isopropanol in a volume ratio of 50-0: 1;
step 3), the reverse phase silica gel column chromatography eluent is methanol aqueous solution or ethanol aqueous solution, wherein the volume fraction of methanol or ethanol in the aqueous solution accounts for 20-100%; the eluent of the gel column chromatography is dichloromethane-methanol or dichloromethane-ethanol with the volume ratio of 2-0: 1.
9. Use of an azosteroid derivative according to claim 5, characterized in that: the azo steroid derivative is applied to the preparation of an algistat or a bacteriostatic agent.
10. Use of an azosteroid derivative according to claim 9, characterised in that: the algistat is one or more of red tide bent algae, marine shield algae or prorocentrum donghaiense which can inhibit the harm caused by red tide; the bacteriostatic agent is one or more of pseudomonas citrosum, escherichia coli, staphylococcus aureus, vibrio harveyi and vibrio parahaemolyticus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010933191.2A CN112111409B (en) | 2020-09-08 | 2020-09-08 | Penicillium oxalicum and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010933191.2A CN112111409B (en) | 2020-09-08 | 2020-09-08 | Penicillium oxalicum and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112111409A CN112111409A (en) | 2020-12-22 |
| CN112111409B true CN112111409B (en) | 2021-12-07 |
Family
ID=73803441
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010933191.2A Active CN112111409B (en) | 2020-09-08 | 2020-09-08 | Penicillium oxalicum and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112111409B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115521877B (en) * | 2022-01-25 | 2024-04-19 | 浙江中医药大学 | Penicillium strain and application thereof in preparation of brefeldin A |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107723246B (en) * | 2017-10-18 | 2019-12-27 | 湖北文理学院 | Endophytic penicillium oxalicum of ophiopogon japonicas and application of endophytic penicillium oxalicum of ophiopogon japonicas in preparation of steroid saponin |
-
2020
- 2020-09-08 CN CN202010933191.2A patent/CN112111409B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN112111409A (en) | 2020-12-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108467337B (en) | Sesquiterpene enol compound and preparation and application thereof | |
| CN108383707B (en) | Carotene sesquiterpene compound and preparation and application thereof | |
| CN108484363B (en) | Sesquiterpene triol compound and preparation and application thereof | |
| CN109503414B (en) | Nitrogenous ring nerolidine type sesquiterpene derivative and preparation and application thereof | |
| CN112111409B (en) | Penicillium oxalicum and application thereof | |
| CN108467398B (en) | Diketopiperazine compound and preparation and application thereof | |
| CN108373457B (en) | Epoxy sesquiterpenoids and preparation and application thereof | |
| CN109503535B (en) | Bicyclic ring nerolidine type sesquiterpene derivative and preparation and application thereof | |
| CN113621526B (en) | Marine fungus aspergillus versicolor M-7-SW9, mixed source terpenoid and extraction method and application thereof | |
| CN113444131B (en) | N-acetylglucosamine compounds, and preparation method and application thereof | |
| CN111072670A (en) | Diketopiperazine compound and preparation method and application thereof | |
| CN108586218B (en) | Chloro cyclopentenone compound and preparation and application thereof | |
| CN109956883B (en) | Acetylated nitrogenous ring nerolidine type sesquiterpene derivative and preparation and application thereof | |
| CN109988180B (en) | Diketopiperazine derivative and preparation and application thereof | |
| CN109503413B (en) | Monocyclic ring nerolidine type sesquiterpene derivative and preparation and application thereof | |
| CN108503534B (en) | Extraction method and application of p-hydroxybenzoic acid | |
| CN102786528A (en) | Polyoxybiotic alkali compound as well as preparation method and application thereof | |
| CN112107602B (en) | A pair of twin-nitrogen containing alkaloid enantiomers, preparation and application thereof | |
| CN112694406B (en) | Preparation method and application of two dimeric hexyl itaconic acid derivatives | |
| CN115247131B (en) | Trichoderma atroviride and metabolite and application thereof | |
| CN110003041B (en) | Cyclonerane acylated derivative and preparation and application thereof | |
| CN111606878B (en) | Cadinane derivative and preparation and application thereof | |
| CN114606135B (en) | Sponge coanda fungus and application thereof in preparation of sterols | |
| CN111662257B (en) | Benzencadinane derivative, and preparation and application thereof | |
| CN107629070B (en) | A kind of carbamate compound and its preparation and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |