CN112094808A

CN112094808A - MiR-204-containing exosome and preparation method and application thereof

Info

Publication number: CN112094808A
Application number: CN202010973833.1A
Authority: CN
Inventors: 柳夏林; 何嫦; 周恬
Original assignee: Zhongshan Ophthalmic Center
Current assignee: Zhongshan Ophthalmic Center
Priority date: 2020-09-16
Filing date: 2020-09-16
Publication date: 2020-12-18
Anticipated expiration: 2040-09-16
Also published as: CN112094808B

Abstract

The invention provides an exosome loaded with miR-204, which can obviously improve symptoms and signs of xerophthalmia. By highly expressing miR-204 in L929 cells, the miR-204-loaded exosome with high safety and high yield and stable source is obtained, a plurality of limitations of difficult culture, poor stability and the like of the MSC source exosome in practical application are solved, and the problems of unstable liposome transfection efficiency, large difference among different cells, large toxicity of a liposome transfection reagent, short action time and poor stability are solved, so that clinical transformation is promoted.

Description

MiR-204-containing exosome and preparation method and application thereof

Technical Field

The invention belongs to the technical field of biological medicine and molecular biology, and particularly relates to an exosome containing miR-204, and a preparation method and application thereof.

Background

Dry eye (dry eye), also known as keratoconjunctival dryness syndrome (keratojunctional catassicca), refers to a general term for a variety of diseases characterized by abnormal quality or quantity of tear fluid, or abnormal kinetics, resulting in decreased tear film stability, and associated ocular discomfort and/or damage to ocular surface tissues. The xerophthalmia is caused by a plurality of reasons and is wide in the range of people, the treatment effect is limited at present, the life and work of a patient are greatly influenced, and the society is heavily burdened.

Exosomes (exosomes) are nanoscale membrane vesicles which are secreted by cells and carry cytoplasmic components, contain various bioactive substances such as proteins, mRNA (messenger ribonucleic acid), miRNA and the like, can transmit active ingredients such as miRNA and the like to other cells or regulate receptors of the cells in a membrane fusion mode, and serve as bridges for mutual communication between the cells. More importantly, potential safety problems such as tumorigenicity of cell therapy can be avoided by using the exosome.

In recent years, the therapeutic effect and potential clinical value of Mesenchymal Stem Cell (MSCs) exosomes (MSC-exo) in various diseases are discovered, the exosomes can relieve inflammation, regulate immune response and promote tissue regeneration, are considered as potential drug carriers, and are expected to be a substitute for mesenchymal stem cell therapy. But the outstanding problems currently exist include: difficulty in obtaining MSC cells; the culture difficulty is high; the passage is unstable, and the like, so that a stable exosome source is difficult to provide, and the progress of the result to the clinic is restricted.

Lipofection is a common technical means for recombinant expression plasmids of miRNA or synthetic mature miRNA sequences to enter cells. However, the transfection efficiency of the liposome transfection is unstable, different cells have differences, and the liposome transfection reagent has high toxicity, short action time and poor stability. In response, various viral vectors have been used to insert mirnas into the cell genome in an attempt to solve the problem of lipofection efficiency. However, viral vectors still pose a threat to the safety of the human genome, and have been controversial in a series of safety problems due to the possibility of immune responses, the risk of integration into the genome, the possibility of virus reactivation toxicity, and the like. Compared with artificially constructed nano-carriers, the exosome not only has the characteristics of small volume, stable structure, capability of protecting the content of the exosome from being degraded and the like, but also has the advantages of no cytotoxicity, low immunogenicity, high biocompatibility and the like naturally due to the fact that the exosome is derived from cells, and is an ideal gene delivery carrier.

Disclosure of Invention

Aiming at the problems and the defects, the plasmid for expressing miR-204 is introduced into the L929 cell, so that the exosome enrichment of the miR-204 with stable and high expression is realized, and the dry eye treatment effect similar to that of MSC-exo is realized on animal experiments, so that the limitations of the MSC-exo on clinical application are effectively broken through, and the problem of instability of direct application of miRNA in vivo is solved.

The invention is realized by the following technical scheme:

the invention provides an exosome for preventing and/or treating xerophthalmia, wherein miR-204 (which is totally called mmu-miR-204-5p, Gene ID: MIMAT0000237, miRNA mature body sequence (5'-3'): uucccuuugucauccuaugccu) is loaded in the exosome.

Preferably, the exosomes are selected from one or more of mesenchymal stem cell exosomes (MSC-exo), artificially engineered exosomes.

Preferably, the artificially modified exosome is prepared by the following steps:

(1) transfecting miR-204 into stably passaged fibroblasts through lentivirus;

(2) screening a cell strain with high miR-204 expression;

(3) and separating to obtain the exosome stably loaded with the miR-204.

Preferably, the fibroblast is an L929 cell in the step (1), namely the artificially modified exosome is an miR-204-loaded L929 exosome (L929-miR-204-exo).

The second aspect of the present invention provides a pharmaceutical composition for preventing and/or treating dry eye, comprising an exosome loaded with miR-204.

(1) transfecting miR-204 into stably passaged L929 cells through lentivirus transfection;

(2) screening a cell strain with high miR-204 expression;

(3) and separating to obtain the exosome stably loaded with the miR-204.

Preferably, the fibroblast cells in step (1) are L929 cells.

The third aspect of the invention provides an application of miR-204 in preparation of a medicine for preventing and/or treating dry eye.

The fourth aspect of the invention provides application of the exosome loaded with miR-204 in preparation of a medicine for preventing and/or treating dry eye.

Preferably, the artificially modified exosome is modified by the following steps:

(1) transfecting miR-204 into stably passaged fibroblasts through lentivirus;

(2) screening a cell strain with high miR-204 expression;

(3) and separating to obtain the exosome stably loaded with the miR-204.

Preferably, the fibroblast cells in step (1) are L929 cells.

Preferably, the mechanism for preventing and/or treating dry eye is: the expression of IL-6R on the surface of corneal macrophage is reduced through miR-204, STAT3 pathway activation is inhibited, proinflammatory phenotype macrophages are reduced, inflammation-inhibiting phenotype is increased, and the expression of various inflammatory factors is reduced, so that the xerophthalmia is prevented and/or treated.

Preferably, the prevention and/or treatment means the ability to alleviate, inhibit, ameliorate or alleviate any one or more of the following symptoms, signs:

(1) eye discomfort such as dry eye, foreign body sensation, burning sensation, photophobia, blurred vision, and visual fatigue;

(2) the lacrimal river is narrowed or interrupted, the corneal epithelium in the palpebral fissure area is dropped in a punctate way, and the fluorescein stains the corneal epithelium defect area;

(3) limbal epithelial cell dysfunction, corneal thinning, ulceration, and even perforation.

Compared with the prior art, the invention has the following beneficial effects:

(1) the invention discovers the outstanding effect of the MSC-derived exosome on improving dry eye symptoms, and further discovers that miR-204 in MSC-exo is a main action component of the MSC-exo. In view of a plurality of limitations of MSC-exo on clinical application, the invention constructs the L929 cells stably and highly expressing miR-204 by using lentivirus, collects the exosome rich in miR-204, and realizes the treatment effect similar to that of MSC-exo in the animal model of dry eye.

(2) The miR-204-entrapped exosome provided by the invention can obviously improve the symptoms and physical signs of xerophthalmia. By highly expressing miR-204 in L929 cells, the miR-204-loaded exosome with high safety and high yield and stable source is obtained, a plurality of limitations of difficult culture, poor stability and the like of the MSC source exosome in practical application are solved, and the problems of unstable liposome transfection efficiency, large difference among different cells, large toxicity of a liposome transfection reagent, short action time and poor stability are solved, so that clinical transformation is promoted.

Drawings

FIG. 1 is a graph showing the transfection efficiency of L929 cells with mmu-miR-204 precorsor.

FIG. 2 is a statistical chart of lacrimal secretion amount and fluorescein sodium staining score after treatment of L929 exosome of high expression miR-204 and other exosomes.

FIG. 3 is a graph of miR-204 levels in corneal tissue under the benzalkonium chloride model for fibroblast exosome and MSC exosome intervention.

FIG. 4 shows miR-204 levels in MSC and L929 cells.

FIG. 5 is a photograph of white light of an anterior segment of the eye and a cobalt blue light picture dyed by sodium fluorescein for comparing the treatment effects of L929 exosomes of high expression miR-204 with other exosomes

FIG. 6 is a graph showing macrophage typing results after corneal staining after treatment of L929 exosome highly expressing miR-204.

FIG. 7 is a qPCR result graph reflecting the expression level of inflammatory factors after treatment of L929 exosomes highly expressing miR-204.

Detailed Description

In order to make the objects, technical solutions and effects of the present invention clearer and clearer, the present invention is further described in detail below with reference to examples. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

The reagents and starting materials used in the present invention are commercially available or can be prepared according to literature procedures. The experimental procedures, for which specific conditions are not specified, in the following examples are generally in accordance with the conditions described in the instruction book (U.S. [ Mei ] J. SammBruke, Huang Petang translation, molecular cloning, laboratory Manual, scientific Press) or in accordance with the conditions recommended by the manufacturer.

Example 1 preparation of miR-204-loaded exosomes

An exosome loaded with miR-204, the preparation method of which comprises the following steps:

(1) synthesizing a double-stranded oligonucleotide sequence of the miR-204precursor, cloning the double-stranded oligonucleotide sequence into pHBLV plasmid to construct an expression vector, transfecting to 239T cells, collecting virus supernatant 72 hours after transfection, filtering by using a 0.45 mu m filter, and centrifuging for 120min at 72000 Xg to obtain concentrated lentiviruses; transfecting L929 cells with the prepared virus;

(2) culturing and amplifying, screening drugs by using puromycin, and screening the stable and high-expression miR-204L 929 cell strain by GFP fluorescence flow type sorting.

(3) Collecting the cell culture solution obtained in the step (2), and performing differential centrifugal separation and extraction on the exosome by using ultra-high speed centrifugation to obtain miR-204-loaded L929-exo.

The experimental results show that: the transfection efficiency of the L929 cells transfected by mmu-miR-204 precorsor is good, the successfully transfected cells express green fluorescence, and the L929 cells highly expressing miR-204 are obtained by flow screening of a group with the titer of 40 (shown in figure 1).

Example 2 mouse Dry eye model preparation and exosome intervention

(1) C57 mice of 6-8 weeks are selected, and no abnormality is detected by a slit lamp, and the lacrimal fluid secretion amount and the corneal fluorescein staining are not abnormal. Dividing the mixture into 2 groups by adopting a random grouping method, wherein each group comprises 15 fibers;

(2) groups 2 mice were each dosed with double eyedrops, with group 1 dosed with 0.2% benzalkonium chloride +0.2ug/uL L929-exo loaded with miR-204 (prepared from example 1), and group 2 dosed with 0.2% benzalkonium chloride +0.2ug/uL msc-exo, 5 uL/eye each, for 7 consecutive days.

Example 3 Dry eye indicator detection

After 7 days of eye drop treatment, 4.3% chloral hydrate was intraperitoneally injected to the two groups of mice on day 8 at an injection dose of 10ul/g to anesthetize the mice, and measurement of tear secretion after dry eye induction, anterior segment photography, tear film rupture time and corneal epithelial fluorescein staining score were measured.

(1) Detecting the amount of lacrimal secretion: placing phenol red cotton thread in the outer 1/3 position of conjunctival sac of lower eyelid of mouse with ophthalmological microscope forceps, taking out after 1min, and recording red part of phenol red cotton thread by millimeter unit measurement. Each eye was tested 2 times as described above, and the final result was the average of 2 measurements.

(2) Tear film break-up time: dripping 1 μ l of liquid fluorescein sodium 1% to conjunctival sac of mouse, and after 3 times of auxiliary winking, opening eyes from the last wink to the 1 st black spot of cornea is BUT. Each eye was tested 2 times as described above, and the final result was the average of 2 measurements.

(3) Corneal fluorescence staining score: after recording the tear film break-up time, the corneal epithelial lesion grade per eye was observed under a slit lamp using cobalt blue light. The cornea was divided into four regions, and the score for each region was recorded separately, with the final score being the sum of the scores for the 4 regions.

Grading standard: deficiency, 0 point;

slight punctate coloration of less than 30 points, 1 point;

dot-like coloring of more than 30 dots, 2 min;

the disperse dyeing is serious, but the disperse dyeing does not obviously form a sheet shape, 3 min;

obvious flake dyeing, 4 points.

The results of fluorescein staining scores after treatment are shown in figure 2. The experimental results show that the corneal epithelium of the dry eye group exhibits large-area schistose fluorescein staining; after MSC-exo treatment, corneal epithelium is slightly colored in a point shape, the area of fluorescein staining is obviously reduced, and the L929-exo treatment is not obviously improved; after the L929-exo loaded with miR-204 is treated, the staining area of fluorescein is obviously reduced compared with that of an L929-exo treatment group, and the staining score is similar to that of an MSC-exo treatment group.

Example 4 mechanism verification

On day 8, after the mice had died by breaking their necks, the eyeballs were taken out and the corneal tissue was separated in phosphate buffer, placed in trizol and crushed by ultrasonic waves. Extracting RNA by chloroform and isopropanol, washing for 1 time by 75% alcohol, centrifuging the RNA to the bottom of the tube, removing the alcohol, and adding a proper amount of molecular biological ultrapure water to dissolve the RNA after the alcohol is dried in the air. And (4) performing realtimePCR analysis after the RNA concentration is determined, and detecting the difference of miR-204. Meanwhile, an RNA sample is taken and sent to a company for sequencing analysis, and the miRNA enrichment condition is determined.

The experimental results show that: the sequencing and qPCR revealed that MSC-exo dried corneal tissue was elevated compared to miR-204 in L929exo or PBS-intervened benzalkonium chloride model corneal tissue (as shown in figure 2). MSC in qPCR is higher than miR-204 of L929, and MSC-exo in sequencing and qPCR is higher than miR-204 of L929 exo; thus, it was suggested that miR-204 is an active ingredient (shown in FIG. 4)

Example 5 Effect of miR-204-loaded L929-exo on Dry eye

(1) A mouse dry eye model was constructed as described in example 2, randomly divided into 5 groups of 15 animals each;

(2) each group of mice was given a double eyedrop, wherein: group 1 was given PBS, group 2 was given 0.2% benzalkonium chloride + PBS, group 3 was given 0.2% benzalkonium chloride +0.2ug/uL blank L929-exo, group 4 was given 0.2% benzalkonium chloride +0.2ug/uLMSC-exo, group 5 was given 0.2% benzalkonium chloride +0.2ug/uL L929-exo loaded with miR-204 (prepared from example 1). 5 ul/eye each time, continuously dropping for 7 days;

(3) on day 8, the mice were sacrificed by cervical dislocation, the eyeballs were collected and fixed in 4% paraformaldehyde for 60min, and after blocking with 5% BSA +0.3% Trition blocking solution, 1: diluting CD86 and CD206 antibodies by 100 ℃, laying overnight at 4 ℃, staining secondary antibodies and blocking after DAPI staining, evaluating the co-staining condition of CD86 or CD206 under a confocal microscope, and evaluating the polarization type of corneal macrophages;

(4) separating the corneal tissue in phosphate buffer; real-timePCR quantitatively detects the change of the expression levels of inflammatory factors such as IL-6, IL-1 beta and the like and proinflammatory phenotypic macrophage marker CD86 in the corneal tissue.

The experimental results show that: compared with the control group, the group 4 has the advantages of reduced proinflammatory corneal macrophages, increased inflammation-inhibiting macrophages and reduced inflammatory factors. Group 5 dry eye indexes are obviously improved, L929 cell exosomes with high miR-204 expression are extracted, the intervention effect is compared with other exosomes, and the effect is similar to that of MSC-exo. Anterior segment photography and fluorescein sodium staining cobalt blue light images show that the treatment effect of the L929 secreted exosome with high expression of miR-204 is similar to that of the MSC exosome (as shown in fig. 2 and fig. 5). Group 5 dry eye-related cytological and cytological indicators were significantly better. After the treatment of the L929 exosome with high miR-204 expression (group 5), the corneal staining shows that the macrophage activation is reduced, the number of macrophage proinflammatory phenotype (CD 86 +) is reduced, the number of macrophage inflammation inhibitory phenotype (CD 206 +) is increased (shown in figure 6), and qPCR (quantitative polymerase chain reaction) proves that the expression levels of inflammatory factors IL-6 and IL-1b are remarkably reduced after the treatment of the L929 exosome with high miR-204 expression (group 5) (shown in figure 7).

Therefore, the exosome loaded with miR-204 provided by the invention can obviously improve the symptoms and signs of dry eye. By highly expressing miR-204 in L929 cells, the miR-204-loaded exosome with high safety and high yield and stable source is obtained, a plurality of limitations of difficult culture, poor stability and the like of the MSC source exosome in practical application are solved, and the problems of unstable liposome transfection efficiency, large difference among different cells, large toxicity of a liposome transfection reagent, short action time and poor stability are solved, so that clinical transformation is promoted.

The above detailed description section specifically describes the analysis method according to the present invention. It should be noted that the above description is only for the purpose of helping those skilled in the art better understand the method and idea of the present invention, and not for the limitation of the related contents. The present invention may be appropriately adjusted or modified by those skilled in the art without departing from the principle of the present invention, and the adjustment and modification also fall within the scope of the present invention.

Claims

1. An exosome for preventing and/or treating dry eye, loaded with miR-204.

2. An exosome for preventing and/or treating dry eye condition according to claim 1, characterized in that it is selected from one or more of mesenchymal stem cell exosomes, artificially engineered exosomes.

3. An exosome for preventing and/or treating dry eye according to claim 2, characterized in that the artificially modified exosome is prepared by the following steps:

(1) transfecting miR-204 into stably passaged fibroblasts through lentivirus;

(2) screening a cell strain with high miR-204 expression;

(3) and separating to obtain the exosome stably loaded with the miR-204.

4. An exosome for preventing and/or treating dry eye according to claim 3, characterized in that the fibroblast cells in step (1) are L929 cells.

5. A pharmaceutical composition for preventing and/or treating dry eye comprising an exosome for preventing and/or treating dry eye according to any one of claims 1 to 4.

6. The pharmaceutical composition for preventing and/or treating dry eye according to claim 5, wherein the exosome is selected from one or more of mesenchymal stem cell exosome and artificially-engineered exosome.

Application of miR-204 in preparation of medicine for preventing and/or treating dry eye.

8. Application of the exosome loaded with miR-204 in preparation of medicine for preventing and/or treating dry eye.

9. The use according to claim 8, wherein the exosomes are selected from one or more of mesenchymal stem cell exosomes, artificially engineered exosomes.

10. The use according to any one of claims 7 to 9, wherein the mechanism for preventing and/or treating dry eye is: the expression of IL-6R on the surface of corneal macrophage is reduced through miR-204, STAT3 pathway activation is inhibited, proinflammatory phenotype macrophages are reduced, inflammation-inhibiting phenotype is increased, and the expression of various inflammatory factors is reduced, so that the xerophthalmia is prevented and/or treated.