CN112067802A - H1N1 influenza virus detection method and kit thereof - Google Patents
H1N1 influenza virus detection method and kit thereof Download PDFInfo
- Publication number
- CN112067802A CN112067802A CN201910442618.6A CN201910442618A CN112067802A CN 112067802 A CN112067802 A CN 112067802A CN 201910442618 A CN201910442618 A CN 201910442618A CN 112067802 A CN112067802 A CN 112067802A
- Authority
- CN
- China
- Prior art keywords
- virus
- magnetic beads
- influenza virus
- aptamer
- mes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Virology (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Molecular Biology (AREA)
- Hematology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Biotechnology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for detecting H1N1 influenza virus and a kit thereof. The invention realizes the high-efficiency capture of the inactivated complete H1N1 influenza virus by using a simple and quick chemical coupling method; the DNA aptamer capable of specifically recognizing and inactivating the A-type H1N1 virus is used as a recognition probe to realize specific recognition of the virus, and finally, the quantitative detection of the inactivated complete H1N1 influenza virus is realized by real-time quantitative PCR. The detection limit of the invention is 1ng/L, and the invention has no response to other viruses and has good specificity. The nano gold is combined, the colorimetric detection of the H1N1 virus can be realized, and the detection limit is 1 ng/L. The method takes the complete inactivated virus as a target, takes the low-cost DNA aptamer as a recognition molecule, and has the advantages of good safety and low cost. And the kit has high sensitivity and good specificity, is successfully used for detecting H1N1 in a throat swab sample, and has good clinical application value.
Description
Technical Field
The invention relates to a low-cost high-safety detection method for influenza virus based on a DNA aptamer and a kit thereof, belonging to the technical field of biological analysis.
Background
The H1N1 influenza virus belongs to influenza A virus, and is a highly infectious human pathogen. Influenza a viruses have very frequent antigen drift and antigen conversion, and therefore, development of specific drugs, vaccines or diagnostic methods against influenza viruses is difficult. In order to protect public health and reduce infectious disease outbreaks, a high-safety, low-cost and high-sensitivity detection method for rapidly detecting H1N1 influenza virus is urgently needed.
Existing methods for virus detection can be divided into two categories: gene detection methods and antibody detection methods. Genetic assays utilize Polymerase Chain Reaction (PCR) to detect the DNA or RNA genetic material of the virus. These methods have high sensitivity, but have disadvantages in that they are complicated to handle and cross-contamination easily occurs during nucleic acid amplification, resulting in false positive results. The antibody-based detection method realizes the detection of viruses by detecting viral proteins or host antibodies, simplifies the test process and improves the test specificity. However, such methods use expensive and poorly stable antibodies as recognition molecules. Both methods require detection of live viruses, and thus have a biological safety problem.
Aptamers are single-stranded nucleotides obtained by in vitro screening techniques (ligand systems evolution (SELEX)), which can specifically recognize a variety of targets, from small molecules, proteins, whole cells, and even tissue sections. Aptamers are comparable to antibodies in terms of high affinity and specificity. Compared with an antibody, the aptamer has the advantages of low cost, good stability, good batch reproducibility, easy chemical synthesis, modification, marking and the like. The aptamers for various viruses have been successfully screened by taking viruses as targets at present, and virus detection methods based on the aptamers are reported, mainly electrochemical detection methods.
Recently, DNA aptamers with high affinity and specificity have been successfully screened against inactivated H1N1 virus (Biosens.Bioelectron.2018,110, 162-167). An electrochemical sensor based on an electrochemical impedance method is constructed by using the aptamer, and high sensitivity and specificity detection of the H1N1 virus are realized. However, the aptamer-based electrochemical sensor has poor reproducibility and interference resistance, and cannot detect H1N1 virus in actual clinical samples of throat swabs.
Disclosure of Invention
The invention aims to provide a method for detecting H1N1 influenza virus with low cost and high safety and a kit thereof. The method utilizes 1-ethyl-3- (3-dimethylaminopropyl) -carbodiimide (EDC) and N-hydroxysuccinimide (NHS) to activate carboxylic acid groups on carboxyl groups, and further realizes the high-efficiency capture of inactivated complete H1N1 influenza virus through the quick and high-efficiency coupling of the activated carboxylic acid and amino groups on virus surface protein; and then the DNA aptamer capable of specifically recognizing the inactivated A-type H1N1 virus is used as a recognition probe to realize the specific recognition of the virus, and finally the real-time quantitative PCR is used to realize the quantification of the aptamer combined with the inactivated complete H1N1 influenza virus, thereby realizing the high-sensitivity quantitative detection of H1N 1. The PCR product obtained by the method can be mixed with the nanogold, and the high-sensitivity colorimetric detection of H1N1 is realized by utilizing the correlation between the quantity of the double-chain PCR product and the stability of the nanogold.
The specific experimental steps of the invention are as follows:
1) activating the magnetic beads;
2) capturing the virus by a chemical coupling method;
3) sealing the magnetic beads;
4) incubating the magnetic beads coupled with the virus with the aptamer;
5) magnetically separating and washing the magnetic beads;
6) heat eluting the aptamer bound to the virus;
7) and detecting the quantity of the nucleic acid aptamers in the eluent by utilizing qPCR (quantitative polymerase chain reaction) or adding nano-gold for colorimetric detection.
In the above method, the sequence of the DNA aptamer (P-A8S) used is: 5'-GCAATGGTACGGTACTTCCATTCGACCTCTGTAACAGCCACGAAAACCCTATATC AAAAGTGCACGCTACTTTGCTAA-3' are provided.
In the above method, the step 1) of activating the magnetic beads comprises the steps of:
mixing magnetic beads uniformly: placing the magnetic beads coated with the carboxyl groups on a rotary blending instrument, and blending for 15min at the rotating speed of 7 rpm;
washing magnetic beads: putting the uniformly mixed 10 mu L of magnetic beads into a 1.5ml centrifuge tube, adding 50 mu L of 2-morpholine ethanesulfonic acid (MES) buffer solution for cleaning, rotating at 7rpm at room temperature, fully mixing for 10min, then carrying out magnetic separation, discarding supernatant, and cleaning for 3 times in total;
activating magnetic beads: preparing 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) solutions with a concentration of 50mg/mL by MES, adding 25 μ L of each solution into magnetic beads, uniformly mixing by rotation at room temperature at a rotation speed of 7rpm, activating for 30min, performing magnetic separation, discarding the supernatant, and washing 3 times by 50 μ L of MES.
Step 2) the chemical coupling method for capturing the virus comprises the following steps of adding 50 mu L of virus solution with different concentrations prepared by MES into corresponding centrifuge tubes for incubation, and taking an experimental group added with 50 mu L of MES buffer solution as a blank control. After the incubation, the beads were washed 3 times with MES.
Step 3) the closed magnetic beads comprise the following steps of adding 50 microliter of a closed solution prepared by 5mM MgCl2PB into a centrifuge tube, wherein the final concentration of yeast tRNA is 1mg/mL, the final concentration of salmon sperm DNA is 100 micrograms/mL, 0.1% Tween80 is shaken at low speed at room temperature, and the mixture is incubated for 30 min.
Step 4) incubation of virus-coupled magnetic beads with aptamers comprises the steps of adding 50. mu.L of 50nM P-A8S aptamer solution in 5mM MgCl2PB to a centrifuge tube and incubating at 6rpm for 2h at room temperature.
Step 5) magnetically separating and washing the magnetic beads further comprises the following steps: washing 3 times with 5mM MgCl2PB, 50 μ L each time, at 6rpm for 5min, and retaining the supernatant of the 3 rd washing (wash 3); step 6) thermal elution of aptamers that bind to viruses further comprises the steps of: 50 μ L of 95 ℃ 5mM MgCl2PB was added to the centrifuge tube, the centrifuge tube was incubated in a 95 ℃ water bath for 5min, and the supernatant was taken out and stored while hot.
The invention also provides an H1N1 influenza virus detection kit, which is an H1N1 influenza virus detection kit in a pharyngeal swab based on a real-time quantitative PCR technology, and comprises: carboxylic acid modified magnetic beads, 2-morpholine ethanesulfonic acid (MES), a magnetic bead activating agent, a confining liquid, an H1N1 specific aptamer and a real-time quantitative PCR reagent. Or, it is H1N1 influenza virus detect reagent box in pharynx swab based on nanometer gold color comparison, includes: carboxylic acid modified magnetic beads, 2-morpholine ethanesulfonic acid (MES), magnetic bead activating agents, confining liquid, H1N1 specific aptamer, common PCR reagents and nanogold.
The method of the invention has the following advantages: 1) the detection object of the method is inactivated complete virus, so that the problem of biological safety is solved; 2) the method of the invention uses the aptamer to carry out specificity identification on the virus, and has low detection cost and high reproducibility; 3) the method disclosed by the invention is combined with a convenient magnetic separation technology, particularly realizes efficient capture of the virus by using a chemical crosslinking technology, and has the advantages of high capture efficiency, low price and convenience in operation. 4) The method of the invention combines the real-time quantitative PCR technology, and can realize high-sensitivity quantitative detection; 4) the method provided by the invention can further reduce the cost by combining with the nano-gold colorimetry, and has the advantage of visualization.
Drawings
FIG. 1 is a schematic diagram of the method of the present invention.
Fig. 2 is a test result diagram of the present invention verifying the feasibility of H1N1 virus detection based on the qPCR method, showing test results of high concentration H1N1 influenza virus detection and selectivity test.
FIG. 3 is a graph showing the test results of the effect of the blocking conditions of the magnetic bead interface of the present invention on the detection of H1N1 virus.
FIG. 4 is a graph of the results of the test with optimized incubation times of activated magnetic beads with a virus sample according to the present invention.
FIG. 5 is a graph showing the results of the sensitivity test for detecting H1N1 virus by the method of the present invention.
FIG. 6 is a graph showing the results of the selectivity test for detecting H1N1 virus according to the present invention.
FIG. 7 is a schematic diagram of the colorimetric method of nanogold for detecting influenza virus according to the invention.
FIGS. 8A-8D are UV-VIS absorption spectra of H1N1 influenza virus detected by nanogold colorimetric method of the present invention.
FIG. 9 is a graph showing the results of a test for detecting H1N1 virus in pharyngeal swabs using qPCR according to the method of the present invention.
FIGS. 10A-10D are UV-VIS spectra of the detection of H1N1 virus in throat swabs using nanogold colorimetric detection according to the methods of the invention.
Detailed Description
FIG. 1 is a schematic diagram of the method of the present invention. As shown in the figure, (1) carboxyl modified magnetic beads are activated by EDC and NHS; (2) then adding a virus sample, and carrying out chemical crosslinking reaction between carboxyl on the surface of the magnetic bead and amino of the virus surface protein so as to couple the virus on the surface of the magnetic bead; (3) sealing the surface of the magnetic beads; (4) then adding a specific aptamer of H1N1 influenza virus to incubate with the magnetic beads coupled with the virus; (5) magnetic beads are magnetically separated and washed, and the nucleic acid aptamer which is non-specifically adsorbed on the interface is eluted; (6) then the nucleic acid aptamer specifically adsorbed on the surface of the virus is dissociated from the virus by thermal elution and enters an eluent; (7) carrying out qPCR quantification on the hot elution liquid, wherein the higher the concentration of the H1N1 influenza virus is, the more the quantity of DNA in the hot elution liquid is; or adding nano gold for colorimetric detection. Thereby realizing the quantitative detection of the virus.
Fig. 2 is a test result diagram of the present invention verifying the feasibility of H1N1 virus detection based on the qPCR method, showing test results of high concentration H1N1 influenza virus detection and selectivity test.
FIG. 3 is a graph showing the test results of the effect of the blocking conditions of the magnetic bead interface of the present invention on the detection of H1N1 virus. As shown, the effect of the bead interface blocking conditions on H1N1 virus detection is shown. "blank" represents incubation of the sample with magnetic beads without virus and without Tween80 in the blocking agent; "blank/Tween 80" means that the sample incubated with the magnetic beads is virus-free and the blocking agent contains Tween 80; "H1N 1/Tween 80" represents that the sample contains 10. mu.g/L H1N1 influenza virus, and the blocking agent contains Tween 80.
FIG. 4 is a graph of the results of the test with optimized incubation times of activated magnetic beads with a virus sample according to the present invention.
FIG. 5 is a graph showing the results of the sensitivity test for detecting H1N1 virus by the method of the present invention. As shown, the sealant: the final concentration of yeast tRNA is 1mg/mL, the final concentration of salmon sperm DNA is 100 mug/mL, and 0.1% Tween80
FIG. 6 is a graph showing the results of the selectivity test for detecting H1N1 virus according to the present invention. FIG. 7 is a schematic diagram of the colorimetric method of nanogold for detecting influenza virus according to the invention. As shown in the figure, the double-stranded PCR product cannot stabilize the nano-gold, but the single nucleotide and the primer can be adsorbed on the nano-gold, so that the nano-gold can be well stabilized.
FIGS. 8A-8D are UV-VIS absorption spectra of H1N1 influenza virus detected by nanogold colorimetric method of the present invention. FIG. 9 is a graph showing the results of a test for detecting H1N1 virus in pharyngeal swabs using qPCR according to the method of the present invention. FIGS. 10A-10D are UV-VIS spectra of the detection of H1N1 virus in throat swabs using nanogold colorimetric detection according to the methods of the invention.
Example 1. method for detecting H1N1 influenza virus based on qPCR technology
The sequence of the DNA aptamer P-A8S used in all the following examples was: 5'-GCAATGGTACGGTACTTCCATTCGACCTCTGTAACAGCCACGAAAACCCTATATC AAAAGTGCACGCTACTTTGCTAA-3' are provided.
As shown in fig. 1, the present embodiment includes the following specific experimental steps:
1) activated magnetic bead
Mixing magnetic beads uniformly: the carboxyl-coated magnetic beads were placed on a spin mixer and mixed for 15 minutes (min) at 7 revolutions per minute (rpm).
Washing magnetic beads: and (3) putting the uniformly mixed 10 microliter (mu L) of magnetic beads into a 1.5 milliliter (ml) centrifuge tube, adding 50 mu L of 2-morpholine ethanesulfonic acid (MES) buffer solution for cleaning, rotating at 7rpm at room temperature, fully mixing for 10min, then carrying out magnetic separation, and discarding supernatant. The washing was performed 3 times in total.
Activating magnetic beads: a solution of 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (EDC), N-hydroxysuccinimide (NHS) at a concentration of 50mg/mL was prepared with MES. Add 25. mu.L of each solution to the beads, mix them together by spinning at room temperature and 7 rpm. After 30min of activation, magnetic separation was carried out, the supernatant was discarded and washed 3 times with 50. mu.L MES.
2) Capturing viruses by a chemical coupling method: add 50. mu.L virus solution at different concentrations in MES formulation to corresponding centrifuge tubes for incubation, and use the experimental group with 50. mu.L MES buffer solution as a blank. After the incubation, the beads were washed 3 times with MES.
3) Sealing the magnetic beads: add 50. mu.L of blocking solution prepared with PB (5mM MgCl2) to the tube with a final concentration of 1mg/mL yeast tRNA, 100. mu.g/mL salmon sperm DNA, 0.1% Tween 80. Shaking at low speed at room temperature, and incubating for 30 min.
4) Incubating the magnetic beads coupled with the virus with the aptamer: add 50. mu.L of 50nM P-A8S aptamer solution in PB (5mM MgCl2) and incubate at room temperature at 6rpm for 2 h.
5) Magnetic separation and washing of magnetic beads: wash3 times with PB (5mM MgCl2) 50. mu.L each time at 6rpm for 5 min. The supernatant of the 3 rd wash was retained (wash 3).
6) Hot elution of aptamers bound to the virus: 50 μ L of PB (5mM MgCl2) at 95 ℃ is added into a centrifuge tube, the centrifuge tube is placed in a water bath at 95 ℃ for incubation for 5min, and the supernatant is taken out for storage while the supernatant is hot.
7) The number of nucleic acid aptamers in the eluate was detected using qPCR:
parameter setting for qPCR experiments: at 95 ℃ for 59s, 1 cycle of circulation; a circulation stage: 30s at 95 ℃; 30s at 50 ℃; 30s at 72 ℃ and 30 cycles. All qPCR experiments were 20 μ L in volume and commercial qPCR kits were used.
Example 2 validation of the feasibility of H1N1 virus detection based on qPCR method: detection and selectivity test of high concentration H1N1 virus
This example was carried out following the procedure in example 1, but without 3) blocking, and step 4) using different incubation conditions: different concentrations of H1N1 or H5N1 influenza virus (1mg/L, 100. mu.g/L, 10. mu.g/L) were incubated with activated magnetic beads at room temperature at 6rpm for 2H, after which the centrifuge tubes were placed in a 4 ℃ freezer for further incubation for 12H.
The results show (FIG. 2) that 1mg/L of H1N1 influenza virus can be specifically detected by the method shown in example 1 of the present invention, and the number of aptamers binding to H1N1 is greater than that of blank and equivalent concentration of H5N 1. The blank was found to be high, and the coupling of H5N1 to the surface of the magnetic beads could significantly reduce the nonspecific adsorption of the aptamer to the magnetic bead interface, so H5N1 was used as a negative control in the following experiments. When H5N1 is used as a negative control group, the detection limit of the H1N1 influenza virus is 100 mug/L.
Example 3 optimization of bead interface blocking conditions
In order to reduce non-specific adsorption of aptamers at the interface to lower the detection limit, we optimized the interface blocking conditions of the magnetic beads. In addition to yeast tRNA and salmon sperm DNA, we added 0.1% by mass volume of Tween80 to the blocking reagent. The whole detection process was carried out according to the procedure shown in example 1. As shown in FIG. 3, the blocking agent and Tween80 are used together to significantly reduce the nonspecific adsorption of the aptamer at the interface.
Example 4 optimization of incubation time of activated magnetic beads with Virus
A10 ng/L H1N1 solution was prepared, incubated at room temperature for 2 hours (H) at 6rpm with 10ng/L H5N1 and MES buffer as controls, the beads were washed 3 times after incubation, then incubated for 30min with Tween 80-containing blocking solution, the supernatant was removed by magnetic separation, and the experiment was performed according to the experimental procedure of example 1. As can be seen from FIG. 4, the experiment results of incubation of the magnetic beads with the activated virus for 2h and 12h at room temperature are almost the same. Thus, it can be shown that under the closed condition, the virus can reach the detection requirement after being incubated with the activated magnetic beads for 2h, and the virus does not need to be incubated for 12h in a refrigerator at 4 ℃.
Example 5 testing the sensitivity of the method of the invention to detect H1N1
Under the optimized blocking conditions, the detection of H1N1 influenza virus at concentrations of 10. mu.g/L, 1. mu.g/L, 0.1. mu.g/L, 0.01. mu.g/L and 0.001. mu.g/L was performed with reference to the procedure of example 1, with 0.1. mu.g/L H5N1 and MES buffer as controls. The detection result is shown in fig. 5, and the DNA content in the hot eluate is in positive correlation with the concentration of the H1N1 influenza virus. Under these conditions, 1ng/L H1N1 influenza virus was detected using H5N1 as a reference.
Example 6 testing the Selectivity of the method of the invention for detecting H1N1 Virus
H1N1 and H3N2 solutions with the concentrations of 100ng/L, 10ng/L and 1ng/L are prepared, and 10ng/L H5N1 and MES buffer solution are used as controls. The experiment was carried out according to the experimental procedure of example 1. As shown in FIG. 6, since the amount of aptamer in the thermal elution solution revealed that this method also did not respond to H3N2, the method of the present invention was able to specifically detect H1N1 influenza virus, and the sensitivity was very high, meeting the requirement of the detection sensitivity of pharyngeal swab samples.
Example 7 colorimetric detection of H1N1 influenza Virus
The principle of nanogold colorimetric detection of influenza virus is shown in fig. 7. When H1N1 virus exists, a large amount of double-stranded PCR products are generated in qPCR according to the method, and the double-stranded PCR products cannot be adsorbed on the surface of the nanogold to stabilize the nanogold due to the wrapping of the base between the two strands. Without H1N1 virus, PCR reaction can not be carried out, mononucleotide and primer in PCR reaction liquid can be adsorbed on nano gold, so nano gold can be stabilized well.
The detection of 10ng/L and 1ng/L H1N1 influenza virus was carried out according to the optimized experimental conditions, and the hot eluate was obtained by using MES buffer solution and 10ng/L H5N1 as controls. And (3) carrying out 15-round PCR reaction on the hot elution solution, adding 5 mu L of PCR product into 50 mu L of nano gold solution, adding 15 mu L H2O, vortex uniformly mixing, immediately adding 20 mu L of PBS (0.5M NaCl) and starting timing, and measuring the ultraviolet-visible absorption spectrum at 1min, 2min, 5min and 10 min.
The detection results are shown in fig. 8A-D, as the standing time is prolonged, the agglomeration of the nano-gold is gradually serious, the color is changed from red to purple, the absorption peak generated by nano-gold plasma resonance is gradually red-shifted, and the absorbance is reduced. Comparing the color and the absorbance of different samples at the same time, wherein the color of the H1N1 virus sample is purple and the absorbance is lower, and the higher the H1N1 concentration is, the more purple the color is and the absorbance is lower; the blank control group and the H5N1 control group were reddish and had higher absorbance, and the H5N1 control group was the most reddish and highest absorbance. When the standing time is 2-5 minutes, the nanogold colorimetric method is most sensitive and can detect 1ng/L H1N1 influenza virus.
Example 8 real-time quantitative PCR detection and Nanogold colorimetric detection of H1N1 influenza Virus in throat swabs
The buffer solution of throat swab culture used in this experiment was Hanks buffer solution of pH 7.4 (137.93mM NaCl,5.33mM KCl,4.17mM NaHCO3,0.441mM KH2PO4,0.338mM Na2HPO4,5.56mM glucose). First, 5. mu.L of 1% formaldehyde solution was added to 50. mu.L of throat swab culture to inactivate the virus. Diluting concentrated hydrochloric acid by 20 times, adding 1.5 μ L diluted hydrochloric acid into inactivated throat swab culture solution, mixing with light vortex, and adjusting pH to about 5. The samples were incubated with the activated magnetic beads for 2h at room temperature, followed by 3 washes with MES buffer solution, and the experiment was continued as described in example 1. As shown in FIG. 9, all of the H1N1 influenza viruses in the throat swab culture were detected using 100ng/L H5N1 as a control or using a complete blank as a control. Taking the pharyngeal swab sample 1 with the lowest content as an example, the detection results of the H1N1 influenza virus detection method based on nanogold colorimetry are shown in FIGS. 10A-D, and all pharyngeal swab samples with H1N1 positive can be detected within the incubation time of 1 to 10 minutes.
Example 9 detection kit for H1N1 influenza Virus in pharyngeal swab based on real-time quantitative PCR technology
The kit for detecting H1N1 by utilizing qPCR comprises: carboxylic acid modified magnetic beads, 2-morpholine ethanesulfonic acid (MES), a magnetic bead activating agent, a confining liquid, an H1N1 specific aptamer and a real-time quantitative PCR reagent.
Example 10 Nanogold colorimetric-based kit for detecting H1N1 influenza Virus in pharyngeal swabs
The kit for detecting H1N1 by utilizing qPCR comprises: carboxylic acid modified magnetic beads, 2-morpholine ethanesulfonic acid (MES), magnetic bead activating agents, confining liquid, H1N1 specific aptamer, common PCR reagents and nanogold.
The above description is only for the specific embodiments of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art can easily conceive of the changes or substitutions within the technical scope of the present invention, and all the changes or substitutions should be covered within the scope of the present invention.
Claims (10)
1. The method for detecting the H1N1 influenza virus is characterized in that 1-ethyl-3- (3-dimethylaminopropyl) -carbodiimide (EDC) and N-hydroxysuccinimide (NHS) are used for activating carboxylic acid groups on carboxyl, and then the activated carboxylic acid and amino groups on virus surface protein are quickly and efficiently coupled to realize efficient capture of inactivated complete H1N1 influenza virus; and then, the DNA aptamer capable of specifically recognizing the inactivated A-type H1N1 virus is used as a recognition probe to realize specific recognition of the virus, and finally, the real-time quantitative PCR is used for realizing the quantification of the aptamer combined with the inactivated complete H1N1 influenza virus, so that the high-sensitivity quantitative detection of the H1N1 influenza virus is realized.
2. A method for detecting H1N1 influenza virus, which is characterized by comprising the following steps:
step 1) activating magnetic beads;
step 2) capturing viruses by a chemical coupling method;
step 3), sealing the magnetic beads;
step 4), incubating the magnetic beads coupled with the virus and the aptamer;
step 5) magnetically separating and cleaning magnetic beads;
step 6) heat-eluting the aptamer bound to the virus;
and 7) detecting the quantity of the nucleic acid aptamers in the eluent by utilizing qPCR (quantitative polymerase chain reaction) or adding nano-gold for colorimetric detection.
3. The method according to claim 1 or 2, wherein the DNA aptamer (P-A8S) used has the sequence: 5'-GCAATGGTACGGTACTTCCATTCGACCTCTGTAACAGCCACGAAAACCCTATATCAAAAGTGCACGCTACTTTGCTAA-3' are provided.
4. The method of claim 3, wherein the step 1) of activating the magnetic beads comprises the steps of:
mixing magnetic beads uniformly: placing the magnetic beads coated with the carboxyl groups on a rotary blending instrument, and blending for 15min at the rotating speed of 7 rpm;
washing magnetic beads: putting the uniformly mixed 10 mu L of magnetic beads into a 1.5ml centrifuge tube, adding 50 mu L of 2-morpholine ethanesulfonic acid (MES) buffer solution for cleaning, rotating at 7rpm at room temperature, fully mixing for 10min, then carrying out magnetic separation, discarding supernatant, and cleaning for 3 times in total;
activating magnetic beads: preparing 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) solutions with a concentration of 50mg/mL by MES, adding 25 μ L of each solution into magnetic beads, uniformly mixing by rotation at room temperature at a rotation speed of 7rpm, activating for 30min, performing magnetic separation, discarding the supernatant, and washing 3 times by 50 μ L of MES.
5. The method of claim 4, wherein the step 2) of capturing the virus by chemical coupling comprises the steps of adding 50 μ L of virus solution with different concentrations in MES preparation into corresponding centrifuge tubes for incubation, taking the experimental group added with 50 μ L of MES buffer solution as a blank control, and washing the magnetic beads with MES for 3 times after the incubation is finished.
6. The method of claim 5, wherein the step of blocking the magnetic beads in step 3) comprises adding 50 μ L of blocking solution prepared from 5mM MgCl2PB to the centrifuge tube, wherein the final concentration of yeast tRNA is 1mg/mL, the final concentration of salmon sperm DNA is 100 μ g/mL, 0.1% Tween80, shaking at low speed at room temperature, and incubating for 30 min.
7. The method of claim 6, wherein the step 4) of incubating the virus-coupled magnetic beads with the aptamer comprises adding 50 μ L of 50nM P-A8S aptamer solution in 5mM MgCl2PB to the centrifuge tube, and incubating at room temperature and 6rpm for 2 h.
8. The method of claim 7, wherein the step 5) of magnetically separating and washing the magnetic beads further comprises the steps of: washing 3 times with 5mM MgCl2PB, 50 μ L each time, at 6rpm for 5min, and retaining the supernatant of the 3 rd wash (wash 3); step 6) thermal elution of aptamers that bind to viruses further comprises the steps of: 50 μ L of 95 deg.C 5mM MgCl2PB was added into the centrifuge tube, the centrifuge tube was incubated in a water bath at 95 deg.C for 5min, and the supernatant was taken out and stored while it was hot.
9. The H1N1 influenza virus detection kit is characterized by being an H1N1 influenza virus detection kit in a pharyngeal swab based on a real-time quantitative PCR technology, and comprising: carboxylic acid modified magnetic beads, 2-morpholine ethanesulfonic acid (MES), a magnetic bead activating agent, a confining liquid, an H1N1 specific aptamer and a real-time quantitative PCR reagent.
10. An H1N1 influenza virus detection kit is characterized in that the kit is an H1N1 influenza virus detection kit in a pharyngeal swab based on nanogold colorimetric, and comprises: carboxylic acid modified magnetic beads, 2-morpholine ethanesulfonic acid (MES), magnetic bead activating agents, confining liquid, H1N1 specific aptamer, common PCR reagents and nanogold.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910442618.6A CN112067802B (en) | 2019-05-25 | 2019-05-25 | H1N1 influenza virus detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910442618.6A CN112067802B (en) | 2019-05-25 | 2019-05-25 | H1N1 influenza virus detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112067802A true CN112067802A (en) | 2020-12-11 |
| CN112067802B CN112067802B (en) | 2022-09-30 |
Family
ID=73658126
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910442618.6A Active CN112067802B (en) | 2019-05-25 | 2019-05-25 | H1N1 influenza virus detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112067802B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112462061A (en) * | 2020-12-15 | 2021-03-09 | 武汉大学 | Kit for detecting H1N1, RSV-A and ADV3 and application thereof |
| CN112980850A (en) * | 2021-04-21 | 2021-06-18 | 华侨大学 | Influenza A H1N1 virus nucleic acid aptamer and application thereof |
| CN114854760A (en) * | 2022-06-27 | 2022-08-05 | 华侨大学 | DNA aptamer of mouse antibody and application thereof |
| CN114958860A (en) * | 2022-06-27 | 2022-08-30 | 华侨大学 | Respiratory syncytial virus nucleic acid aptamer and application thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120295811A1 (en) * | 2009-11-23 | 2012-11-22 | Jean-Jacques Toulme | Aptamers directed against the matrix protein-1 of type a influenza viruses and uses thereof |
| CN103543275A (en) * | 2013-11-07 | 2014-01-29 | 中国人民解放军第三军医大学第一附属医院 | Method for rapidly detecting PP65 based on magnetic bead |
| CN105861746A (en) * | 2016-04-14 | 2016-08-17 | 西北农林科技大学 | Method for rapidly detecting early-stage PEDV infection based on nanogold label amplification technology |
| CN106399315A (en) * | 2015-07-31 | 2017-02-15 | 中国人民解放军军事医学科学院基础医学研究所 | Sequences and application of oligonucleotide aptamer for specific recognition of H1N1-type and H3N2-type influenza A virus |
| CN109280667A (en) * | 2018-10-30 | 2019-01-29 | 廖世奇 | Two-way thermal cycle abatement SELEX quickly screens the method and kit of aptamer |
| CN109321564A (en) * | 2018-10-30 | 2019-02-12 | 廖世奇 | A kind of fusion protein aptamer screening technique and kit |
| CN109666765A (en) * | 2019-01-25 | 2019-04-23 | 华侨大学 | A kind of kit of quick diagnosis H1N1 influenza virus |
-
2019
- 2019-05-25 CN CN201910442618.6A patent/CN112067802B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120295811A1 (en) * | 2009-11-23 | 2012-11-22 | Jean-Jacques Toulme | Aptamers directed against the matrix protein-1 of type a influenza viruses and uses thereof |
| CN103543275A (en) * | 2013-11-07 | 2014-01-29 | 中国人民解放军第三军医大学第一附属医院 | Method for rapidly detecting PP65 based on magnetic bead |
| CN106399315A (en) * | 2015-07-31 | 2017-02-15 | 中国人民解放军军事医学科学院基础医学研究所 | Sequences and application of oligonucleotide aptamer for specific recognition of H1N1-type and H3N2-type influenza A virus |
| CN105861746A (en) * | 2016-04-14 | 2016-08-17 | 西北农林科技大学 | Method for rapidly detecting early-stage PEDV infection based on nanogold label amplification technology |
| CN109280667A (en) * | 2018-10-30 | 2019-01-29 | 廖世奇 | Two-way thermal cycle abatement SELEX quickly screens the method and kit of aptamer |
| CN109321564A (en) * | 2018-10-30 | 2019-02-12 | 廖世奇 | A kind of fusion protein aptamer screening technique and kit |
| CN109666765A (en) * | 2019-01-25 | 2019-04-23 | 华侨大学 | A kind of kit of quick diagnosis H1N1 influenza virus |
Non-Patent Citations (2)
| Title |
|---|
| 伦永志: "《现代医学检验进展》", 31 October 2018, 厦门大学出版社 * |
| 吕世静等: "《临床免疫学检验》", 31 August 2015, 中国医药科技出版社 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112462061A (en) * | 2020-12-15 | 2021-03-09 | 武汉大学 | Kit for detecting H1N1, RSV-A and ADV3 and application thereof |
| CN112980850A (en) * | 2021-04-21 | 2021-06-18 | 华侨大学 | Influenza A H1N1 virus nucleic acid aptamer and application thereof |
| CN112980850B (en) * | 2021-04-21 | 2023-08-29 | 华侨大学 | Influenza A H1N1 virus nucleic acid aptamer and application thereof |
| CN114854760A (en) * | 2022-06-27 | 2022-08-05 | 华侨大学 | DNA aptamer of mouse antibody and application thereof |
| CN114958860A (en) * | 2022-06-27 | 2022-08-30 | 华侨大学 | Respiratory syncytial virus nucleic acid aptamer and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112067802B (en) | 2022-09-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112067802B (en) | H1N1 influenza virus detection kit | |
| CN103852460B (en) | Based on the method that how residual the magnetic nano fluorescent sensor detection of antibiotics of aptamers is | |
| EP1563100B1 (en) | Displacement sandwich immuno-pcr | |
| CN112852921B (en) | Nucleic acid detection method, detection probe and kit based on instant detection test strip | |
| WO2017181339A1 (en) | Method and kit for simultaneous detection of protein ligand and gene | |
| CN105018590B (en) | Protein ligands and gene detection kit and application at the same time | |
| Gao et al. | Rolling circle amplification integrated with suspension bead array for ultrasensitive multiplex immunodetection of tumor markers | |
| CN104360077A (en) | Aptamer nucleic acid probe kit for detecting doxycycline residue as well as preparation method and application thereof | |
| CN104278079A (en) | Test strip and method for detecting nucleic acid through nucleic acid chromatographic technique | |
| CN112415205A (en) | Kit for detecting EB virus/HCMV and application thereof | |
| Chen et al. | A sandwich sensor based on imprinted polymers and aptamers for highly specific double recognition of viruses | |
| CN114807397A (en) | Method for detecting salmonella and drug-resistant bacteria by non-amplification time-resolved fluorescence lateral chromatography detection | |
| CN117187251B (en) | Nucleic acid aptamer of pentamethyltetrahydrofolate and application of nucleic acid aptamer in animal product detection | |
| Wang et al. | A CRISPR/Cas12a-SERS platform for amplification-free detection of African swine fever virus genes | |
| Cao et al. | Detection of avian influenza virus by fluorescent DNA barcode-based immunoassay with sensitivity comparable to PCR | |
| An et al. | Detection of tyrosine hydroxylase in dopaminergic neuron cell using gold nanoparticles-based barcode DNA | |
| CN105296644A (en) | Isothermal amplification detection kit for chicken derived component nucleic acid and detection method | |
| CN111763713A (en) | Method and kit for detecting miRNA-21 based on target isothermal cycle amplification and nucleic acid test strip technology for non-diagnosis purpose | |
| Chen et al. | Automated and ultrasensitive detection of methyl-3-quinoxaline-2-carboxylic acid by using gold nanoparticles probes SIA-rt-PCR | |
| WO2021185034A1 (en) | Novel coronavirus nucleic acid rapid hybridization capture immunofluorescence detection kit, and preparation method and detection method | |
| CN104498602B (en) | A kind of nucleic acid detection method based on magnetic bead Yu ultrasonic Separation luminous marker | |
| CN108362876B (en) | Immunomagnetic bead chromatography test strip for detecting Cronobacter sakazakii and rapid detection method | |
| WO2021114040A1 (en) | Non-amplified nucleic acid molecule detection kit and use method therefor | |
| Jiang et al. | A Study of the Detection of SARS-CoV-2 by the Use of Electrochemiluminescent Biosensor Based on Asymmetric Polymerase Chain Reaction Amplification Strategy | |
| CN110819632A (en) | Nucleic acid aptamers for binding to trastuzumab antibodies |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |