CN112048571A

CN112048571A - Grass carp reovirus II type nested RT-PCR detection primer group, kit and application thereof

Info

Publication number: CN112048571A
Application number: CN202010915296.5A
Authority: CN
Inventors: 王英英; 王庆; 曾伟伟; 李莹莹; 尹纪元; 吴斯宇; 石存斌
Original assignee: Pearl River Fisheries Research Institute CAFS
Current assignee: Pearl River Fisheries Research Institute CAFS
Priority date: 2020-09-03
Filing date: 2020-09-03
Publication date: 2020-12-08
Anticipated expiration: 2040-09-03
Also published as: CN112048571B

Abstract

The invention discloses a grass carp reovirus II type nested RT-PCR detection primer group, a kit and application thereof. The invention designs and obtains a grass carp reovirus type II nested RT-PCR primer group, and based on the primer group, the grass carp reovirus type II is detected by a specific method amplification system and conditions. The first amplification of the PCR reaction can detect 10³Diluted cDNA concentration, second amplification detectable 10⁴The concentration of the secondarily diluted cDNA is high in specificity, and the detection sensitivity of the secondarily diluted cDNA is higher than that of GCRV II viruses in the existing national standard.

Description

Grass carp reovirus II type nested RT-PCR detection primer group, kit and application thereof

Technical Field

The invention belongs to the field of gene detection, and particularly relates to a grass carp reovirus II type nested RT-PCR detection primer, a kit and application thereof.

Background

The grass carp culture is an important component of the freshwater aquaculture industry, and the total yield of the grass carp culture accounts for 20% in 2015.

Grass Carp Reovirus (GCRV) can cause Grass carp bleeding disease, which seriously affects the healthy development of Grass carp breeding industry and causes huge economic loss of Grass carp farmers. The grass carp reovirus has the characteristics of multiple harm types, wide epidemic range, long morbidity season, high mortality and the like, the bleeding disease of grass carps mainly damages grass carps of 1-2 years, and the mortality rate after infection can reach 60-100% at most. Besides grass carp, the goby, chub, crucian carp, pseudorasbora parva and other fishes can be infected, and the death rate of the goby rarus after infection reaches 100 percent.

The grass carp reovirus has a double-layer capsid, a genome of 11 segments (S1-S11) of double-stranded RNA, a non-cyst-membrane, a symmetric structure of icosahedron, and the diameter of a virus particle is 60-70 nm. More than 30 isolates of reovirus have been reported, and all strains can be classified into 3 genotypes as a whole, i.e. GCRV type I, II and III, representative strains being 873, HZ08 and 104, respectively. Epidemiological investigations carried out by researchers have shown that the major contributors to epidemics and outbreaks are currently grass carp reovirus type II. Therefore, the establishment of a rapid, specific and sensitive diagnostic method has important significance for the research and the prevention and the treatment of the grass carp hemorrhagic disease type II virus.

GCRV II type pathogenicity is strong, cell sensitivity is poor, and for monitoring technical specifications, a proper detection method is searched for so as to detect pathogeny to the maximum extent and reduce transmission risk. Immunoprophylaxis is currently the most effective method for preventing hemorrhagic disease in grass carp, and secondly to detect and isolate the source of infection as early as possible. Because the grass carp reovirus is highly infectious, the grass carp reovirus can be detected early, and the pathogeny can be isolated as early as possible, so that the occurrence and the spread of grass carp hemorrhagic disease can be reduced, and economic loss can be greatly recovered.

Currently, RT-LAMP, Polymerase Chain Reaction (PCR) and fluorescent quantitative PCR (qPCR) are commonly used as detection methods. RT-LAMP can be used in the field, but results are more false positives and unreliable. The fluorescent quantitative PCR has higher technical requirements on instruments and laboratory staff, has higher relative cost, and is not suitable for being used in a common laboratory. Polymerase Chain Reaction (PCR) is the most commonly used detection means, can be amplified millions of times for a certain gene in a short time, and has the characteristics of high specificity, strong sensitivity and quickness, but when the virus content in tissues is low, false negative judgment can be made due to low sensitivity. The real-time fluorescent quantitative PCR is more sensitive than the conventional PCR method, and can detect tissues with lower virus content, but because the cost of instruments and reagents is higher, a plurality of experiments are not provided with a fluorescent quantitative PCR instrument, and cannot be used as a conventional detection means.

The existing popular detection means cannot meet the requirement of detecting the grass carp reovirus II, a more sensitive and convenient detection method is urgently needed, a tool is provided for the quick detection of the grass carp reovirus II and epidemiological investigation, and the grass carp reovirus II is effectively prevented and controlled.

Disclosure of Invention

The invention aims to provide a grass carp reovirus II type nested RT-PCR primer group;

another object of the present invention is to provide a kit for detecting grass carp reovirus type II;

the invention also aims to provide a RT-PCR detection method for grass carp reovirus II;

the invention also aims to provide application of the primer group in preparation of a grass carp reovirus II type detection reagent;

the invention also aims to provide the application of the RT-PCR detection method in the prevention and epidemiological investigation of the grass carp reovirus II in grass carp breeding.

The technical scheme adopted by the invention is as follows:

in a first aspect of the present invention, there is provided:

the grass carp reovirus II type nested RT-PCR primer group has the nucleotide sequence as follows:

GCRV-II Nest-SP：5'-CGCGATTTCATACCCTTTCT-3'(SEQ ID NO.1)；

GCRV-II Nest-OutP：5'-TAGCTGCCGTACTTGGGATGA-3'(SEQ ID NO.2)；

GCRV-II Nest-InP：5'-CATACGATCGCTCCCAACTCC-3'(SEQ ID NO.3)。

the RT-PCR primer group in the invention is designed with a detection site positioned on the S2 segment of GCRV-II, and the protein VP2 coded by the S2 segment has the function of RNA-dependent RNA polymerase (RdRp) and has three functional motif amino acids (motif I, motif II and motif III (GDD) amino acids) specific to the RdRp. While RdRp is most conserved among the genera of the reoviridae family, the motif ii (SG) and motif iii (GDD) amino acids are completely conserved among reoviruses.

The nested RT-PCR primer group selects the most conservative S2 segment in all segments of GCRV-II type, and the specific detection sites are as follows:

5'-GTAACTTTTCTGATGATGGACCATGTGTACCAAGGCCTCTCTCAATCACTACGCGATTTCATACC CTTTCT(GCRV-II Nest-SP)CAGAGGCGAGAAAGACATAAATGACAATGATTTTTCACAAGCATCGGCAGATTGGCACGGTCATCAACGGTCTTACGCCACATCTCTGTTATCCAAAACACCGTTCACTACATGCATACGGGTATCCCATGAAATCTTTGTCAGACGCGACTGGCGAAAATATTACAGAATAGACGAGTCAGGCCGTGTTCGTCGAGTGCCCGTAATCGATGACGAAGACGTCTTTGTCCCAAATGCCGATATCAGTCCACTTCTGATTCCAATGAGGTCACAGCCAGATTACGGCATCCTACATCCAGATATTCAATCAGGCGCGGACGCGGGAGTTGGGAGCGATCGTATG(GCRV-II Nest- OutP)GCAGCAGCGTTCTTTAAGACAGCGTCATCCCAAGTACGGCAGCTA(GCRV-II Nest-InP)AAGATGGACGTCAGTCGGCCACTACTAGCACTACTACTGGCGTGGTGTA-3'(SEQ ID NO.4)。

in a second aspect of the present invention, there is provided:

a kit for detecting grass carp reovirus type II comprises the primer group, a cDNA template and an RT-PCR reaction reagent.

The RT-PCR reaction reagent includes reagents conventionally used in the art, such as reverse transcriptase, reverse transcriptase buffer, RNase inhibitor, etc.

Further, the kit also comprises a positive control; the positive control is cDNA of grass carp reovirus II type HZ08 strain. Of course, the vector, plasmid or sample can be selected from any vector, plasmid or sample containing the genome of grass carp reovirus type II HZ08 strain according to actual needs.

Further, the kit also comprises a negative control and a blank control; the negative control was a sample without grass carp reovirus type II.

In a third aspect of the present invention, there is provided:

a nested RT-PCR detection method for grass carp reovirus II comprises the following steps:

(1) extracting RNA in a sample to be detected, and synthesizing a cDNA template through reverse transcription;

(2) performing RT-PCR amplification on the cDNA template obtained in the step (1) by using GCRV-II Nest-SP and GCRV-II Nest-OutP to obtain an amplification product A;

(3) performing RT-PCR amplification on the amplification product A obtained in the step (2) by using GCRV-II Nest-SP and GCRV-II Nest-InP to obtain an amplification product B;

(4) and comparing the amplification product B with a positive control, and judging whether the sample to be detected contains the grass carp reovirus type II.

On the basis of the conventional PCR, the nested PCR is added with an inner primer for the second PCR amplification, so that the detection sensitivity is improved. The primers in the invention are nested PCR primers designed for conserved sequences of grass carp reovirus type II S2, provide a complete nested PCR detection system and conditions, and verify the specificity, sensitivity and repeatability of the primers. The conventional primer design is generally designed according to the S7 segment, and the problems of high experiment cost, long detection time consumption, need of expensive instruments and specific reagents and the like can also exist; the conventional triple PCR detection method is mainly designed according to a conserved sequence of the S6 gene of GCRV-II type, and the sensitivity and the specificity of the detection method are weaker than those of the nested RT-PCR detection method in the application.

Of course, the method is also applicable to commercial one-step RT-PCR kits with the same amplification efficiency.

Further, the step (1) of extracting RNA from the sample to be tested comprises extracting RNA from the sample by RNA extraction techniques conventional in the art or by using an existing RNA extraction kit.

Further, the cDNA template in step (1) above can be obtained by reverse transcription of RNA, direct synthesis, extraction using conventional DNA extraction techniques, or any means known in the art using conventional RNA extraction kits.

Further, the RT-PCR amplification system in the step (2) is as follows:

further, the RT-PCR amplification conditions in the step (2) are as follows: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30s, annealing at 56 ℃ for 30s, and extension at 72 ℃ for 30s, and circulating for 35 times; final extension at 72 ℃ for 10 min.

Further, the RT-PCR amplification system in step (3) above is:

further, the RT-PCR amplification conditions in the step (3) are as follows: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30s, annealing at 56 ℃ for 30s, and extension at 72 ℃ for 30s, and circulating for 35 times; final extension at 72 ℃ for 10 min.

In a fourth aspect of the present invention, there is provided:

the primer group is applied to preparation of a grass carp reovirus II type detection reagent.

In a fifth aspect of the present invention, there is provided:

the RT-PCR detection method is applied to prevention of the grass carp reovirus II type in grass carp breeding and epidemiological investigation.

The invention has the beneficial effects that:

1. the invention provides a nested RT-PCR (reverse transcription-polymerase chain reaction) detection primer group for grass carp reovirus II, wherein 10 can be detected by the first amplification of the PCR reaction³Diluted cDNA concentration, second amplification detectable 10⁴(ii) the concentration of sub-diluted cDNA; the specificity is strong, and the detection interference of GCRV-JX0901 strain and GCRV-104 strain is avoided.

2. The detection method adds secondary PCR amplification on the basis of conventional RT-PCR, has simple and easy operation, low detection cost, strong specificity, higher detection sensitivity and stronger reliability compared with the GCRV II type virus in the existing national standard.

Drawings

FIG. 1 is an electrophoretogram of the first amplification of PCR reaction, wherein M is DL1000 DNA marker (TaKaRa), and lanes 1-5 are templates 10¹To 10⁵Diluted cDNA, lane 6 negative control with DEPC water as template;

FIG. 2 is an electrophoretogram of the second amplification of PCR reaction, wherein M is DL1000 DNA marker (TaKaRa), and lanes 1-5 are templates 10¹To 10⁵cDNA in dilution multiple;

FIG. 3 is a diagram of electrophoresis of the first amplification specificity test in PCR reactions of KHV, CyHV-2, SVCV, SHRV, GCRV-JX0901 strain, GCRV-HZ08 strain, GCRV-104 strain, wherein M is DL1000 DNA marker (TaKaRa), lane 1 template is GCRV-0901 strain, lane 2 is GCRV-104 strain, lane 3 is KHV, lane 4 is SVCV, lane 5 is SHRV, lane 6 is CYHV 2;

FIG. 4 is a diagram of second amplification specificity test electrophoresis of PCR reaction of KHV, CyHV-2, SVCV, SHRV, GCRV-JX0901 strain, GCRV-HZ08 strain, GCRV-104 strain, wherein M is DL1000 DNA marker (TaKaRa), lane 1 template is GCRV-0901 strain, lane 2 is GCRV-104 strain, lane 3 is KHV, lane 4 is SVCV, lane 5 is SHRV, lane 6 is CYHV 2;

FIG. 5 is a first amplification specificity test electrophoresis of PCR reaction of clinical specimens, wherein M is DL1000 DNA marker (TaKaRa), lanes 1-20 are collected suspected grass carp hemorrhagic disease tissue samples, and lane 21 is a negative control;

FIG. 6 is a second amplification specificity test electrophoresis of PCR reaction of clinical specimens, wherein M is DL1000 DNA marker (TaKaRa), lanes 1-20 are collected suspected grass carp hemorrhagic disease tissue samples, and lane 21 is a negative control;

FIG. 7 shows the results of triple PCR amplification of GB/T37746-2019, wherein M is DL1000 DNA marker (TaKaRa), lanes 1-20 are collected tissue samples suspected of hemorrhagic disease of grass carp, and NC is negative control;

FIG. 8 shows the amplification results of gene II of GB/T36190-2018, wherein M is DL1000 DNA marker (TaKaRa), lanes 1-20 are collected tissue samples suspected of hemorrhagic disease of grass carp, and NC is negative control.

Detailed Description

In order to make the objects, technical solutions and technical effects of the present invention more clear, the present invention will be described in further detail with reference to specific embodiments. It should be understood that the detailed description and specific examples, while indicating the preferred embodiment of the invention, are intended for purposes of illustration only and are not intended to limit the scope of the invention.

The experimental materials and reagents used are, unless otherwise specified, all consumables and reagents which are conventionally available from commercial sources.

Test materials

Grass Carp Reovirus (GCRV), Koi Herpesvirus (KHV), carp spring viremia virus (SVCV), hybrid snakehead rhabdovirus (SHRV) and crucian herpes type 2 virus (CyHV-2) are all separated by the Zhujiang aquatic research institute, and are detected, confirmed and stored by a conventional method in the field.

RNA extraction: RNA in the sample is extracted by using an RNA extraction technology which is conventional in the field or by using an existing RNA extraction kit.

The specific method for RNA extraction in the following examples is:

placing 100mg or less of tissue sample to be detected in a homogenizer, adding 1mL Trizol reagent, fully grinding, and standing at room temperature for 5 min; adding 200 μ L of chloroform, mixing by vortex oscillation for 30s, standing at room temperature for 15 min; centrifuging at 12000g for 10 min; adding the upper water phase into a new centrifuge tube, adding isopropanol with the same volume, turning upside down for several times, mixing, and standing at-20 deg.C for 20 min; centrifuging at 12000g for 10min again; discarding the supernatant, and washing the precipitate with 1mL of 75% ethanol; centrifuging at 8000g for 10min, discarding supernatant, and drying precipitate at room temperature for 5 min; the RNA precipitate was dissolved by adding 20. mu.L of diethylpyrocarbonate water (DEPC water). And storing in a refrigerator at 4 ℃ for later use.

Preparation of cDNA template: can be obtained by reverse transcription of RNA, direct synthesis, extraction by existing DNA extraction techniques, or by any means known in the art using existing RNA extraction kits.

The specific method for cDNA template preparation in the following examples is:

mu.L of RNA extracted by the method is taken, 20 mu mol/L Nest-OutP 1 mu L is added, and water bath at 70 ℃ is carried out for 5 min. After ice bath for 2min, 5 Xg DNA Eraser Buffer 4. mu.L, 10n mol/L dNTPs 1. mu.L, 0.1mol/L Dithiothreitol (DTT) 2. mu.L, M-MLV reverse transcriptase (5U/. mu.L), RNase inhibitor 0.5. mu.L, DEPC water 5. mu.L are added in sequence. After mixing, the mixture is placed on a PCR instrument to react for 30min at 37 ℃ to synthesize cDNA, and after inactivation for 5min at 85 ℃, the cDNA is directly subjected to PCR operation in the following examples or stored at-20 ℃.

Design and Synthesis of primers

The nested RT-PCR primer group selects the S2 segment which is most conserved in all segments of GCRV-II type (Genbank number is:), and the specific detection sites are as follows:

and 3 primers are respectively designed for nested RT-PCR amplification.

The nucleotide sequence of the nested RT-PCR primer is as follows:

GCRV-II Nest-SP：5'-CGCGATTTCATACCCTTTCT-3'(SEQ ID NO.1)；

GCRV-II Nest-OutP：5'-TAGCTGCCGTACTTGGGATGA-3'(SEQ ID NO.2)；

GCRV-II Nest-InP：5'-CATACGATCGCTCCCAACTCC-3'(SEQ ID NO.3)。

nested RT-PCR (reverse transcription-polymerase chain reaction) detection method for grass carp reovirus II

And (3) carrying out reverse transcription on the RNA of the sample to be detected extracted by the method to synthesize a cDNA template.

The first step of reaction:

in a 0.2mL PCR thin-wall tube or an octal tube, the PCR thin-wall tube or the octal tube is configured according to an amplification system of 25 mu L per sample, and the PCR thin-wall tube or the octal tube comprises

Meanwhile, a blank control, a positive control and a negative control which do not contain a cDNA template are arranged, and the preparation method of the detection system is the same. And (3) amplification procedure: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30s, annealing at 56 ℃ for 30s, and extension at 72 ℃ for 30s, and circulating for 35 times; final extension at 72 ℃ for 10 min. Obtaining an amplification product A.

The second step of reaction:

in a 0.2mL PCR thin-wall tube or an octal-tube, the PCR thin-wall tube or the octal-tube is configured according to an amplification system of 25 mu L per sample and comprises

And (3) amplification procedure: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30s, annealing at 56 ℃ for 30s, and extension at 72 ℃ for 30s, and circulating for 35 times; final extension at 72 ℃ for 10 min.

This procedure can also be performed using a commercial one-step RT-PCR kit with the same amplification efficiency.

Sensitivity test

The RNA of the GCRV-II positive tissue determined to be infected is extracted by the method in the above example, then reverse transcription is carried out, the original concentration of the reverse transcription product is determined by the fluorescent quantitative PCR method, and then the reverse transcription product is carried out for 10^-1-10^-6Gradient dilution, RT-PCR using the amplification conditions in the above examples, and simultaneous determination of reverse transcription product concentration for each gradient using fluorescence quantification methods, the lowest RNA content detectable by the present method was explored.

In particular toComprises the following steps: collecting 200 μ L of GCRV-HZ08 strain cell sap, extracting RNA with OMEGA RNA extraction kit, and subjecting reverse transcription product to 10 steps¹To 10⁵Diluting by multiple concentration, and detecting the diluted product by using gel electrophoresis. As a result, it was found that 10 could be detected in the first amplification of PCR reaction³Dilution of cDNA concentration (FIG. 1), the second amplification of PCR reaction was detected at 10⁴Dilution fold cDNA concentration (figure 2).

Specificity test

The method comprises the steps of extracting total nucleic acid of KHV, CyHV-2, SVCV, SHRV, GCRV-JX0901 strain, GCRV-HZ08 strain and GCRV-104 strain by using a magnetic bead method total nucleic acid extractor of THERMO company, wherein KHV and CyHV2 are DNA viruses, directly carrying out PCR after extracting, carrying out reverse transcription by using a PrimeScript RT Reagent Kit (TAKARA) after extracting nucleic acid from other viruses, carrying out PCR detection, and analyzing the detection condition of the common viruses of fish by using the method.

The reaction conditions are as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 deg.C for 30s, annealing at 56 deg.C for 30s, extension at 72 deg.C for 1min, and circulating for 35 times; final extension at 72 ℃ for 10 min. As a result, it was found that the target fragments could not be obtained by using nucleic acids of GCRV-JX0901 and 104 strains and other common viruses of fish (KHV, CyHV-2, SVCV and SHRV) as templates (FIGS. 3 and 4).

Clinical sample testing

Suspected grass carp bleeding disease samples (20 samples) collected in Yangjiang province in Guangdong province are detected by using a grass carp reovirus II type nested RT-PCR method and a triple RT-PCR detection method (GB/T37746) in grass carp reovirus triple RT-PCR 2019 and a gene II type amplification primer PCR amplification method in grass carp bleeding disease diagnosis protocol (GB/T36190) 2018 in the embodiment of the invention, all the samples are not loaded with cells, and the RT-PCR detection is directly carried out, so that the detected positive samples are analyzed and compared.

In the detection results of 20 collected samples, the nested RT-PCR method in the embodiment of the invention has 12 positive amplification samples with a positive rate of 60% (FIG. 5) for the first time, 16 positive amplification samples with a positive rate of 80% (FIG. 6) for the second time; 13 positive samples are detected by a triple PCR method in a grass carp reovirus triple RT-PCR detection method (GB/T37746-2019), and the positive rate is 65 percent (figure 7); 14 positive samples were detected by PCR amplification using the gene II type amplification primer in the grass carp hemorrhage disease diagnosis protocol (GB/T36190-2018), with a positive rate of 70% (FIG. 8). And (3) the detection result is reliable by combining a fluorescent quantitative PCR method and sequencing result verification. The statistical results are shown in Table 1.

TABLE 1 amplification results of three detection methods

In summary, from the amplification results, the amplification effect of the nested RT-PCR method in the embodiment of the invention is better than that of the other two PCR methods, regardless of the specificity or the sensitivity.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> Zhujiang aquatic research institute of Chinese aquatic science research institute

<120> grass carp reovirus II type nested RT-PCR detection primer group, kit and application thereof

<130>

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence

<400> 1

cgcgatttca taccctttct 20

<210> 2

<211> 21

<212> DNA

<213> Artificial sequence

<400> 2

tagctgccgt acttgggatg a 21

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence

<400> 3

catacgatcg ctcccaactc c 21

<210> 4

<211> 508

<212> DNA

<213> GCRV-II

<400> 4

gtaacttttc tgatgatgga ccatgtgtac caaggcctct ctcaatcact acgcgatttc 60

ataccctttc tcagaggcga gaaagacata aatgacaatg atttttcaca agcatcggca 120

gattggcacg gtcatcaacg gtcttacgcc acatctctgt tatccaaaac accgttcact 180

acatgcatac gggtatccca tgaaatcttt gtcagacgcg actggcgaaa atattacaga 240

atagacgagt caggccgtgt tcgtcgagtg cccgtaatcg atgacgaaga cgtctttgtc 300

ccaaatgccg atatcagtcc acttctgatt ccaatgaggt cacagccaga ttacggcatc 360

ctacatccag atattcaatc aggcgcggac gcgggagttg ggagcgatcg tatggcagca 420

gcgttcttta agacagcgtc atcccaagta cggcagctaa agatggacgt cagtcggcca 480

ctactagcac tactactggc gtggtgta 508

Claims

1. The grass carp reovirus II type nested RT-PCR primer group is characterized in that the nucleotide sequence of the RT-PCR primer group is as follows:

GCRV-II Nest-SP：5'-CGCGATTTCATACCCTTTCT-3'；

GCRV-II Nest-OutP：5'-TAGCTGCCGTACTTGGGATGA-3'；

GCRV-II Nest-InP：5'-CATACGATCGCTCCCAACTCC-3'。

2. a kit for detecting grass carp reovirus type II, which is characterized by comprising the RT-PCR primer group, the cDNA template and the RT-PCR reaction reagent in claim 1.

3. The kit of claim 2, further comprising a positive control; the positive control is cDNA of grass carp reovirus II type HZ08 strain.

4. A nested RT-PCR detection method for grass carp reovirus II is characterized by comprising the following steps:

5. The RT-PCR detection method as claimed in claim 4, wherein the RT-PCR amplification system in step (2) is:

6. the RT-PCR detection method as claimed in claim 4, wherein the RT-PCR amplification conditions in step (2) are as follows: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30s, annealing at 56 ℃ for 30s, and extension at 72 ℃ for 30s, and circulating for 35 times; final extension at 72 ℃ for 10 min.

7. The RT-PCR detection method as claimed in claim 4, wherein the RT-PCR amplification system in step (3) is:

8. the RT-PCR detection method as claimed in claim 4, wherein the RT-PCR amplification conditions in step (3) are as follows: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30s, annealing at 56 ℃ for 30s, and extension at 72 ℃ for 30s, and circulating for 35 times; final extension at 72 ℃ for 10 min.

9. The application of the RT-PCR primer group in claim 1 in preparing a reagent for detecting the grass carp reovirus type II.

10. The use of the RT-PCR detection method of claim 4 in the prevention of grass carp reovirus type II in grass carp farming and in epidemiological investigations.