CN112029897A - SNP marker closely linked with continuous multi-leaf-position leaf width main effect QTL under corn tassel and application thereof - Google Patents

Abstract

The invention relates to the technical field of genetic engineering and molecular biology, in particular to an SNP marker closely linked with a continuous multi-leaf-position leaf-width main effect QTL under a maize tassel and application thereof, wherein the SNP marker closely linked with the continuous multi-leaf-position leaf-width main effect QTL under the maize tassel is chr2_208336, the site is mutated into A/G, and the physical position refers to a reference genome B73RefGen _ v4 version of a maize inbred line B73. The auxiliary selection is carried out by the SNP marker, the width of the continuous four-leaf width character under the maize tassel in the mature period can be predicted only by detecting the SNP base of the specific site of the primer PCR amplification product, the identification method is simple, and the selection efficiency is high. The leaf width and leaf width corn single plants of the four continuous leaves under the tassel in the mature period can be identified before the corn is sowed or in the early growth stage, can be respectively used for narrow-leaf density-tolerant corn breeding and wide-leaf silage corn breeding, has clear selection target and is not influenced by the environment, and a feasible way is provided for molecular assisted breeding of the narrow-leaf density-tolerant and wide-leaf silage corn.

Description

SNP marker closely linked with continuous multi-leaf-position leaf width main effect QTL under corn tassel and application thereof

Technical Field

The invention relates to the technical field of genetic engineering and molecular biology, in particular to an SNP marker closely linked with a continuous multi-leaf-position leaf width major QTL under a corn tassel and application thereof.

Background

Corn is a major food and feed and industrial crop. The crop with the largest planting area in the country is obtained in 2014, and the crop plays a very important role in the agricultural production and the national economic development in China.

It has been demonstrated by breeding practice that the increase in yield per unit area of maize is due to an increase in the adaptive capacity of maize for tolerance to close planting (Duvick, D.,2005Genetic progression in yield of United States mail (Zea mays L.). Maydica 50: 193.). However, under high density planting conditions, the leaves are shielded from each other, especially with wider upper leaves, which severely affects ventilation transparency and reduces the efficiency of photosynthesis and efficient radiation utilization and thus yield (Stewart, D., C.Costa, L.Dwyer, D.Smith, R.Hamilton et al, 2003 cancer structure, light interpretation, and photosynthesis in mail. agricultural Journal 95:1465 + 1474).

The leaf type, especially the upper leaf type, is an important factor in the influence factors of the compact tolerant corn plant type, including leaf length, leaf width and leaf angle, wherein the leaf width can influence the leaf area size, and further directly influences the accumulation of photosynthetic products. The cultivation of the corn variety with narrow leaves, especially the narrow upper leaves can reduce the shielding effect of the upper leaves on the lower leaves and enhance the capture of light by photosynthesis (Guo, S., L.Ku, J.Qi, Z.Tian, T.Han et al, 2015Genetic analysis and major quantitative trap mapping of leaf width hs at differential positions in multiple locations. plos One 10: e0119095), thereby improving the compact planting resistance of the corn and increasing the population yield of the corn in unit area. On the other hand, the cultivation of silage maize varieties requires wide leaves to increase the biological yield of silage maize.

Using mutant genetic means, several mutants have been identified which affect leaf width, including rld1, rld2, ns1, ns2, etc. (TianF, Brand bury P J, Brown P J, et al, Genome-wide association study of leaf area in The main tissue association mapping project [ J ]. Nat Genet, 2011.43 (2): 159. 162; Scanlon M J, Schneiber RG, and freezing M, The main tissue damage to tissue array index in a molecular domain [ J ]. Development, 1996.122 (6): 1683. 1691; patent R N, wild kar A, sartorial, coding in a molecular domain [ J ]. 1. 3. transform of Plant area, 3. 16. 1. 3. 16. 3. 1. 3. 1. 3. 9. 3. 9. Plant of origin. 3. 1. 3. 9. of Plant of The same species, 3. 1. 3. The genes of these narrow-leaf mutants have revealed a molecular mechanism of leaf width to some extent, but it is difficult to directly utilize these mutant genes in breeding.

Since three leaves of the ear of corn (ear position leaves and upper and lower adjacent leaves) contribute significantly to the yield of corn, most of the research has focused on the three leaves of the ear of corn. The leaf width trait is typically a complex quantitative trait with a wide variety of genes controlling it. QTL positioning analysis is an effective method for analyzing complex quantitative traits. QTLs of unequal leaf widths have been investigated using Genetic mapping populations such as RIL and complex interval mapping (Li, C., Y.Li, Y.Shi, Y.Song, D.Zhang et al, 2015Genetic control of the leaf angle and leaf orientation values as transformed by ultra-high-purity maps in the same transformed mail order, plos One 10: e 0121624; Yang, C.Tang, J.Qu, L.Zhang et al, 2016Genetic mapping of QTL for the sites of the eye Genetic mapping tables, powder relating leaf angles in the same transformed mail order, Zea mapping L261, Z.E.J. Z.E. Z.E.J. Z.E.E.M. J.E.E.M. Z.E.E. Z.E.M. J.E.E.E.S. Z.E.E.E.S. 9. Z.E.E.E.E.E.S. Z.E. Z.E.E.S. Pat. No. 9. Z.E.E.E.E.E.E.E.S. Z. J. 4. J. Z. E.E.E.E.E.E.E.E.E.E.E.A. Z. A. integer mapping No. 9. E.E.E.E.E.E.A. Z. E.E.E.E.E.E.E.E.E.E.E. Some researches on the leaf width characters of different leaf positions of corn show that the leaf widths of different leaf positions are regulated and controlled by one or more common QTLs and are controlled by different QTLs, and the genetic basis is very complex. Tian (Tian, F., P.J. Bradbury, P.J. Brown, H.Hung, Q.Sun et al, 2011Genome-wide association study of leaf architecture in the main linked association publication. Nat Genet 43: 159. and Yang (Yang, N., Y.Lu, X.Yang, J.Huang, Y.ZHou et al, 2014Genome with association study a new anatomical model the genetic architecture of 17 grams in an amplified genetic architecture and plos Gene 10: e 4573) utilize correlation analysis methods such as the method to identify and map a wide distribution of multiple leaf chromosomes in a broad leaf area, but the broad leaf area of these maize ears is not a significant issue. In addition, the QTL analysis of the leaf width of the corn, particularly the leaf width of continuous leafy position under the tassel has no consistent result due to the limitation of the types of the positioned groups and the used markers, the precision of genetic linkage maps, environmental control and the like, and the QTL marker for controlling the leafy position under the tassel of the corn has not been applied.

The QTL and the marker for controlling the continuous leafy leaf width under the corn tassel are identified and explored, and the method has higher application value for molecular-assisted breeding and cultivation of narrow-leaf dense-planting-resistant varieties and wide-leaf silage corn varieties.

Disclosure of Invention

The invention aims to provide an SNP marker closely linked with a continuous multi-leaf-position leaf-width main effect QTL under a corn tassel and application thereof.

In order to achieve the purpose, the invention provides the following technical scheme:

an SNP marker closely linked with a continuous multi-leaf locus leaf width major QTL under a maize tassel, wherein the continuous multi-leaf locus leaf width major QTL under the maize tassel is positioned at 208336bp of a maize chromosome 2, the locus is mutated into A/G, and the physical position is referred to the B73RefGen _ v4 version of a reference genome of a maize inbred line B73. The sequences of a forward primer and a reverse primer of the amplified molecular marker are respectively SEQ ID NO: 1-2, respectively:

5’-tcatttcctaggacgcgact-3’，

5’-cgcaacaacctacacccatg-3’。

the sequence of the amplification product was:

tcatttcctaggacgcgactacatgtaaccac [ a/g ] cgagtatctagtcttgacacaataggatagggtacctagttacgggttatcaacgggtatcaacaaattgaatcacaagaaaacacttaatcgcagacagtggccacgaaaataagtacgaaccaatcatgggtgtaggttgttgcg. When the mutation is A, the amino acid sequence shown in SEQ ID NO: 3 is shown in the specification; when the mutation is G, the amino acid sequence shown in SEQ ID NO: 4, respectively.

The invention provides application of an SNP marker closely linked with a continuous multi-leaf-position broad main effect QTL under a maize tassel in germplasm innovation and hybrid breeding of narrow-leaf dense-tolerant and wide-leaf silage maize, which specifically comprises the following steps:

(1) extracting the genome DNA of a plant to be detected;

(2) taking the genome DNA of a plant to be detected as a template, and carrying out PCR amplification reaction by using a primer for amplifying the molecular marker;

(3) detecting the PCR amplification product;

(4) selecting an amplification product for sequencing, and according to a sequencing result, when the 33 th base of the amplification product is AA, continuously four leaves under a tassel are wider, so that the method is used for germplasm creation and variety breeding of wide-leaf silage maize materials; when the 33 th base is GG, four continuous leaves under the tassel are narrow, and the method is used for germplasm creation and variety breeding of narrow-leaf density-resistant corn materials.

Wherein, the step (3) adopts 1.5% agarose gel electrophoresis to detect whether a target 180bp PCR amplification product exists.

The invention provides application of the SNP marker closely linked with the continuous multi-leaf-position leaf width main effect QTL under the corn tassel in germplasm resource screening.

According to QTL analysis, 208336bp SNP of a No. 2 chromosome of corn is found to be closely linked with a main effect QTL locus stably expressed by four continuous leaves under a tassel. The SNP locus has variation of A/G, and can be detected simultaneously under four environments. The site has multiple effects, and simultaneously controls the leaf width of four continuous leaves under the tassel. Analysis shows that the SNP marker can be used for early prediction and auxiliary selection of narrow-leaf density-tolerant corn and wide-leaf silage corn.

The auxiliary selection is carried out by the SNP marker disclosed by the invention, the width of the continuous four-leaf width character under the maize tassel in the mature period can be predicted only by detecting the SNP base of the specific site of the primer PCR amplification product, the identification method is simple, and the selection efficiency is high. The leaf width and leaf width corn single plants of the four continuous leaves under the tassel in the mature period can be identified before the corn is sowed or in the early growth stage, can be respectively used for narrow-leaf density-tolerant corn breeding and wide-leaf silage corn breeding, has clear selection target and is not influenced by the environment, and a feasible way is provided for molecular assisted breeding of the narrow-leaf density-tolerant and wide-leaf silage corn.

Drawings

FIG. 1 shows the position and LOD value of continuous leafy broad stable expression major QTL on chromosome 2 of maize under control of maize tassel. Wherein, the horizontal axis is SNP mark position (bp), and the vertical axis is LOD value of four-leaf width detection under the tassel in 4 environments. L2W16HN, L3W16HN, L4W16HN and L5W16HN are the second, third, fourth and fifth leaf widths, respectively, under trilongrass in the south of the hainan year 2016; L2W17HN, L3W17HN, L4W17HN and L5W17HN are the second, third, fourth and fifth leaf widths under the trilongous tassel in the southern hai of 2017; L2W18HN, L3W18HN, L4W18HN and L5W18HN are the second, third, fourth and fifth leaf widths under the trilongous tassel in the southern hai of 2018; L2W19HN, L3W19HN, L4W19HN and L5W19HN are the second, third, fourth and fifth leaf widths under the trilongous ear in the southern hai of 2019.

FIG. 2 shows SNP marker Chr 2-208336 closely linked to major QTL for controlling continuous multi-leaf width under tassel, when bases are AA and GG, the difference of the continuous four-leaf width under tassel in four environments reaches significant level; L2W16HN, L3W16HN, L4W16HN and L5W16HN are the second, third, fourth and fifth leaf widths, respectively, under trilongrass in the south of the hainan year 2016; L2W17HN, L3W17HN, L4W17HN and L5W17HN are the second, third, fourth and fifth leaf widths under the trilongous tassel in the southern hai of 2017; L2W18HN, L3W18HN, L4W18HN and L5W18HN are the second, third, fourth and fifth leaf widths under the trilongous tassel in the southern hai of 2018; L2W19HN, L3W19HN, L4W19HN and L5W19HN are the second, third, fourth and fifth leaf widths under the trilongous ear in the southern hai of 2019.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The following examples, unless otherwise specified, are carried out according to conventional experimental conditions, such as the Molecular cloning handbook, Sambrook et al (Sambrook J & Russell DW, Molecular cloning: a laboratory Manual, 2001), or according to the manufacturer's instructions, software instructions.

Example 1 positional analysis of continuous Multi-leaf locus leaf Width major QTL under maize tassel

Construction of RIL genetic segregation-mapped populations

Through germplasm resource screening research, the L027 leaf is clear to be narrow and small, has excellent comprehensive properties, and can be used as a parent for mining and utilizing the excellent properties such as narrow leaves. After the combination of L027 and Su 95-1, continuous 7 generations of selfing and generation addition of Jiangsu Nanjing and Hainan III are carried out by a single-seed-transmission method, and an RIL genetic separation and positioning group is successfully constructed, wherein the group comprises 379 families in total.

2. Group phenotype analysis

The pedigrees including the group parents (L027 and Su 95-1) were sown in three (2 replicates) in Hainan in 2016, 2017, 2018 and 2019 in winter, each pedigree continuously investigated the second, third, fourth and fifth leaf positions under 5 tassels after pollination, and the leaf width value of each leaf position was calculated as the average number of pedigrees.

3. Group genotype analysis

The RIL population is genotyped by utilizing a probe capture-based targeted sequencing genotyping kit GenoBaits Maize 20K Panel of Shijiazhuang Boruidi biotechnology limited. After the sequencing data are subjected to quality control by FastQC (www.bioinformatics.babraham.ac.uk/projects/FastQC), the sequencing data are posted back to a reference genome by using default parameters of BWA (bio-bw. source. net), and SNP identification is carried out by using GATK (source. broadcast. org/GATK) software, so that 43839 differential SNPs are obtained in total.

QTL location analysis (shown in connection with FIG. 1)

The leaf widths at the second to fifth leaf positions under the tassel in the four environments were located in R (https:// www.r-project. org /) using the SBL package (Wang M, XuS, Valencia A.A coordinate dependent for sparse Bayesian learning in high dimensional QTL mapping and genome-wide association students [ J ]. Bioinformatics (21): 21.).

An RIL population pedigree constructed by L027 and Su 95-1 is taken as a material, leaf width phenotype data under 4 environments are combined, a QTL site which is expressed under 4 environments and simultaneously controls the width of four continuous leaves under a tassel is located at the position of a chromosome 2 Chr 2-208336 of a corn, and the maximum effect value can reach 0.35 (shown in a table 1).

TABLE 1 Chr _208336 continuous four-leaf Width Mark Effect values under tassel controlled in four environments

The locus stenotic allele is derived from the parent L027, and the second, third, fourth and fifth leaves under the tassel can be narrowed by 0.2, 0.19, 0.17 and 0.10cm on average under four circumstances. This site is located at 208336 th chromosome 2 (B73RefGen _ v4), and the SNP variation is A/G.

Example 2 application of SNP markers closely linked to continuous leafy position major QTL markers under maize tassel

The SNP marker closely linked with the continuous multi-leaf broad-effect QTL under the corn tassel is chr 2-208336, and the genome DNA of a material to be identified is used as a template to provide a primer for PCR amplification; wherein the nucleotide sequence of the primer is shown as SEQ ID NO: 1-2. The sequence of the amplification product is shown as SEQ ID NO: 3-4.

The specific steps of utilizing the SNP marker to assist in judging the continuous multi-leaf width under the corn tassel are as follows:

(1) extraction of genomic DNA of material to be identified by CTAB method

Rapidly grinding corn leaf under liquid nitrogen or vacuum drying into powder, transferring into a centrifuge tube of about 0.5-1g to 2ml, adding 800 μ L CTAB buffer solution preheated at 65 deg.C, and mixing; water bath at 65 deg.C for 1h, mixing for several times; equal volume of chloroform was added: isoamyl alcohol (24:1) is mixed evenly. Standing for 30min, then 13000rpm, centrifuging for 15 min; transferring the supernatant to another centrifuge tube, adding equal volume of precooled isopropanol, mixing uniformly, standing for 30min at-20 ℃, and picking out flocculent precipitate with a glass needle or centrifuging to remove the supernatant; washing with 70% ethanol for 1 time, and blow-drying; adding 200. mu.L of 1 XTE for dissolution; a small sample was taken and the quality of the DNA was determined by electrophoresis on 0.8% Agarose gel or the concentration and purity of the DNA was determined by using a NanoDrop 2000DNA concentration meter.

(2) PCR amplification and product detection

The PCR reaction was always 25. mu.L, containing 2mmol/L Mg²⁺100mol/L dNTP, 0.2mol/L primer, 1U enzyme, 100g DNA PCR program: 3min at 95 ℃; at 95 ℃ for 40s, at 58 ℃ for 40s, at 72 ℃ for 40s, for 37 cycles; the amplification product was electrophoresed on 1.5% agarose gel (containing ethidium bromide 0.5g/mL) at 80V for 45min at 72 ℃ for 5min, and it was determined on an ultraviolet transilluminator whether the target amplification product was 180bp in size.

3. And judging the width character of the lower leaves of the tassels according to the sequence comparison result.

And (3) sequencing and analyzing the amplified product, wherein the width of the second, third, fourth and fifth continuous leaves under the tassel is 0.3-0.5cm greater than that of the leaves under the tassel when the 33 th base at the 5' end of the amplified product is A, as shown in figure 2.

Therefore, the SNP marker Chr 2-208336 can be used as a molecular marker for the quantitative trait of the leafy width of the maize tassel.

Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.

Sequence listing

<110> agricultural science and academy of Jiangsu province

<120> SNP marker closely linked with continuous leafy leaf width major QTL under corn tassel and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tcatttccta ggacgcgact 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cgcaacaacc tacacccatg 20

<210> 3

<211> 180

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tcatttccta ggacgcgact acatgtaacc acacgagtat ctagtcttga cacaatagga 60

tagggtacct agttacgggt tatcaacggg tatcaacaaa ttgaatcaca agaaaacact 120

taatcgcaga cagtggccac gaaaataagt acgaaccaat catgggtgta ggttgttgcg 180

<210> 4

<211> 180

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcatttccta ggacgcgact acatgtaacc acgcgagtat ctagtcttga cacaatagga 60

tagggtacct agttacgggt tatcaacggg tatcaacaaa ttgaatcaca agaaaacact 120

taatcgcaga cagtggccac gaaaataagt acgaaccaat catgggtgta ggttgttgcg 180

Claims (6)

1. An SNP marker closely linked with a continuous multi-leaf-position leaf-width major QTL under a corn tassel is characterized in that: the SNP marker closely linked with the continuous multi-leaf broad-effect QTL under the maize tassel is chr 2-208336, the site is mutated into A/G, and the physical position is referred to the reference genome B73RefGen _ v4 version of a maize inbred line B73.

2. The SNP marker in close linkage with a QTL for continuous leafy leaf width under a maize tassel, according to claim 1, wherein: the sequences of a forward primer and a reverse primer of the amplified molecular marker are respectively SEQ ID NO: 1-2.

3. The use of the SNP markers of claim 1 or 2in close linkage with the continuous leafy wide major QTL under maize tassel for germplasm innovation of narrow-leaf dense-tolerant and wide-leaf silage maize and hybrid breeding.

4. The application of the SNP marker tightly linked with the continuous multi-leaf locus wide major QTL under the maize tassel in germplasm innovation and hybrid breeding of the narrow-leaf dense-tolerant and wide-leaf silage maize as claimed in claim 3, characterized by comprising the following steps:

(1) extracting the genome DNA of a plant to be detected;

(2) taking the genome DNA of a plant to be detected as a template, and carrying out PCR amplification reaction by using a primer of an amplification molecular marker;

(3) detecting the PCR amplification product;

(4) selecting an amplification product for sequencing, and according to a sequencing result, when the 33 th base of the amplification product is AA, continuously four leaves under a tassel are wider, so that the method is used for germplasm creation and variety breeding of wide-leaf silage maize materials; when the 33 th base is GG, four continuous leaves under the tassel are narrow, and the method is used for germplasm creation and variety breeding of narrow-leaf density-resistant corn materials.

5. The use of the SNP markers closely linked to the QTL for continuous leafy leaf width major effect under the maize tassel in germplasm resource screening, germplasm innovation of narrow-leaf density-resistant and wide-leaf silage maize and hybrid breeding according to claim 4, wherein the SNP markers comprise: and (3) detecting whether a target 180bp PCR amplification product exists or not by adopting 1.5% agarose gel electrophoresis.

6. The use of the SNP markers of claim 1 or 2 for closely linking with a continuous multi-leaf-position leaf-width major QTL under a maize tassel in germplasm resource screening.

Images