CN112029867A - Method for positioning social genetic haplotype site of pig residual feed intake - Google Patents
Method for positioning social genetic haplotype site of pig residual feed intake Download PDFInfo
- Publication number
- CN112029867A CN112029867A CN202010652590.1A CN202010652590A CN112029867A CN 112029867 A CN112029867 A CN 112029867A CN 202010652590 A CN202010652590 A CN 202010652590A CN 112029867 A CN112029867 A CN 112029867A
- Authority
- CN
- China
- Prior art keywords
- social
- data
- feed intake
- pig
- haplotype
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
- G16B20/20—Allele or variant detection, e.g. single nucleotide polymorphism [SNP] detection
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
- G16B20/30—Detection of binding sites or motifs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Evolutionary Biology (AREA)
- Medical Informatics (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Theoretical Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for positioning a social inheritance haplotype site of the pig remaining feed intake, which identifies the key haplotype of the social inheritance effect of the pig remaining feed intake by utilizing chip data, whole genome re-sequencing data, genotype filling, whole genome haplotype construction and a haplotype-based GWAS means and has the advantages of accurate identification and high reliability.
Description
Technical Field
The invention relates to the field of SNP loci, in particular to a method for positioning a social inheritance haplotype locus of the remaining feed intake of a pig.
Background
The residual feed intake is a very important economic trait and has been paid special attention by breeding scientists and boar improvement companies. The residual feed intake trait depends on the expression result of the genome of the individual (direct genetic effect) on the one hand and on the expression result of the genome of the individual of the same group (social genetic effect) on the other hand. Early breeding work mainly focused on the research of direct genetic effect of the pig residual feed intake, and neglected the contribution of social genetic effect to the pig residual feed intake. With the continuous push of pig genome work and the wide research and development of molecular genetic markers, genome selection has become an effective means for pig important economic trait selection.
Social inheritance effect is a common phenomenon in livestock and poultry, and can exist as long as the individuals interact with each other regardless of wild, domestic or experimental groups. In the actual breeding of pigs, competition among individuals often occurs, and the competition among individuals can directly influence the feed reward, the growth performance, the carcass quality and the like of the pigs. The social genetic effect is optimized and selected, so that the competition among individuals can be avoided to a certain extent, and the cooperation is promoted, so that the genetic improvement speed of important economic traits is increased. The method aims at the characters of the residual feed intake of the pigs with the social genetic effect, selects the social genetic effect of the residual feed intake in the breeding process, and can improve the genetic improvement speed of the residual feed intake of the pigs to a great extent.
With the rapid development of high-throughput sequencing technology, it has become possible to analyze the molecular genetic basis of important economic traits of livestock and poultry. The causal relationship between DNA and phenotype is researched by using genome-wide association analysis (GWAS), so that important SNP sites influencing important economic traits can be rapidly identified, and the molecular genetic mechanism of the SNP sites can be further disclosed. However, almost all research has focused on the direct genetic effect of traits and little has been done on the social genetic effect of traits. Some breeding experts are actively exploring causal sites of social genetic effect selection of pig remaining feed intake within a herd using genomic information. However, the genetic mechanism of the social genetic effect of the remaining feed intake of pigs has not been clear so far. The haplotype-based GWAS fully considers linkage disequilibrium information among SNP loci, can provide greater association detection efficacy, and enables the excavated association result with obvious correlation of target traits to be more reliable. Therefore, the chip data, the whole genome re-sequencing data, the genotype filling, the whole genome haplotype construction and the haplotype-based GWAS (haplotype-based GWAS) means are utilized to identify the key haplotype of the social genetic effect of the pig residual feed intake, and an important theoretical basis is provided for the genome selective breeding of the pig residual feed intake.
Disclosure of Invention
Aiming at the problems, the invention provides a method for positioning the social inheritance haplotype site of the pig residual feed intake, which identifies the key haplotype of the social inheritance effect of the pig residual feed intake by utilizing chip data, genome-wide re-sequencing data, genotype filling, genome-wide haplotype construction and a haplotype-based GWAS means and has the advantages of accurate identification and high reliability.
The technical scheme of the invention is as follows:
a method for positioning a social inheritance haplotype locus of the remaining feed intake of a pig comprises the following steps:
s1, selecting experimental pigs;
s2, calculating the residual feed intake of the experimental pig;
s3, collecting an ear tissue sample of an experimental pig, and extracting genome DNA;
s4, detecting the quality and concentration of the extracted genome DNA, selecting qualified genome DNA to perform 50K SNP genotyping sequencing, and rejecting unqualified products;
s5, performing whole genome resequencing on the qualified genome DNA obtained in the step S4 to obtain high-quality whole genome resequencing data;
s6, taking the whole genome re-sequencing data obtained in the step S5 as reference data, carrying out genotype filling on the deletion genotypes of the 50K chip data of all experimental pigs to obtain the whole genome data of all experimental pigs, and screening to obtain high-quality SNPs sites as social genetic effect data of the residual feed intake of the pigs;
s7, carrying out haplotype detection in the whole genome by adopting PLINK based on the whole genome sequence information of all experimental pigs obtained after genotype filling to obtain qualified haplotype blocks, converting the haplotype blocks into multi-allele marks by adopting GHap software, and screening qualified haplotype alleles as whole genome haplotype data;
s8, adopting GEMMA software to perform HGWAS analysis on the filled whole genome haplotype data and the regressive value (regression SGE) data of the social genetic effect of the residual feed intake, wherein the analysis model is as follows: y is Xm + Wa + e, wherein y represents an inverse regression vector of the social genetic effect; m represents a mark effect value; a represents the residual multigene effect vector; e represents a residual effect vector; x and W represent the incidence matrixes of m and a respectively;
s9, adopting a Bonferroni correction method to control multiple tests to correct the HGWAS result, and determining the significance threshold value to be 3.64 multiplied by 10-6And obtaining a key haplotype locus which is obviously related to the social genetic effect of the residual feed intake according to the display result of the HGWAS.
In a further embodiment, the criteria for selecting experimental pigs in step S1 are as follows:
removing individuals whose starting date is determined to be inconsistent with the birth date of the individual;
removing individuals with the determination days less than 60 days;
setting the record that the single-day feed intake is less than 0.5kg or more than 4.5kg as a deletion value;
setting the record with the single-day ingestion times less than 2 or more than 20 as a deletion value;
and setting recorded data with the single-day ingestion time less than 5min or more than 2h as a missing value.
In a further technical scheme, in step S2, the remaining feed intake of the experimental pig is calculated by the following formula: RFI (ADFI-14.1 ADG-2.83BFT-110.9 AMW), wherein RFI is the residual feed intake; ADFI is average daily food intake; ADG is average daily gain; BFT is backfat thickness; AMW is the average metabolic body weight.
In a further technical scheme, in step S2, after the remaining feed intake data is obtained by calculation, a social genetic effect model is used to evaluate social genetic effect values of the remaining feed intake of all experimental pigs, and based on the estimation accuracy of the social genetic effect, an inverse regression value of the social genetic effect of each individual is obtained for subsequent HGWAS analysis, wherein the evaluation model is as follows: y ═ Xb + ZDaD+ZSaS+ Wl + Vg + e, where y represents a tabular value; b represents the fixation effect, including sex, year, month, year of birth, month; a isDAnd aSIs a vector of direct genetic effect and social genetic effect; l represents a random pit effect vector; g represents a random set effect vector; e, random residual error vector; x, ZD、ZSW and V represent b and a, respectivelyD、aSThe correlation matrix of l and g.
Evaluating the social genetic effect value of the remaining food consumption of each individual, obtaining the inverse regression value of the social genetic effect of each individual according to the estimation accuracy of the social genetic effect, and finally using the obtained inverse regression value of the social genetic effect of each individual for subsequent HGWAS analysis.
In a further embodiment, in step S3, the method for extracting genomic DNA is as follows:
s31, taking a soybean tissue sample, shearing the soybean tissue sample as much as possible, putting the soybean tissue sample into a centrifugal tube, and adding lysis solution and proteinase K;
s32, placing the sample in a thermostat at 55 ℃ for incubation until no tissue block exists in the tube;
s33, adding Tris saturated phenol, slightly mixing uniformly for 10min, and centrifuging at 4 ℃ at 12000r/min for 12 min;
s34, taking the supernatant, and adding the supernatant into the mixture according to the mass ratio of 25: 24: 1, mixing and shaking Tris saturated phenol, chloroform and isoamylol for 10min, and centrifuging at 4 ℃ and 12000r/min for 12 min;
s35, collecting supernatant, adding chloroform, mixing and shaking for 10min, centrifuging at 4 deg.C and 12000r/min for 12 min;
s36, taking the supernatant, adding absolute ethyl alcohol and 3M sodium acetate, mixing and shaking for 6min, and centrifuging for 8min at the temperature of 4 ℃ and at the speed of 1000 r/min;
s37, taking out the supernatant, leaving DNA precipitate, adding 75% ethanol, mixing for 5min, centrifuging at 4 deg.C and 1000r/min for 5 min;
s38, placing the centrifugal tube into a fume hood, and drying until no small drops exist in the tube;
s39, adding ultrapure water into the sample, slightly blowing and beating the sample until DNA is dissolved, detecting the quality and the concentration by a spectrophotometer, uniformly diluting the concentration to 50 ng/mu L, and storing the solution at the temperature of minus 20 ℃ for later use.
In a further embodiment, in step S4, the method for detecting the quality and concentration of the extracted genomic DNA is as follows:
s41, detecting the concentration and OD value of each genome DNA by using Nanodrop-2000, and selecting a genome DNA sample with the concentration of more than or equal to 50 ng/mu L and the OD260/OD280 of 1.8-2.0;
s42, detecting the integrity of DNA by using 1.0% agarose gel electrophoresis to the sample, selecting the genome DNA with single DNA band and obvious main band as a qualified sample, and storing the qualified sample in a refrigerator at the temperature of 80 ℃ below zero for later use.
In a further technical scheme, in the step S4, in the 50K SNP genotyping sequencing process of the qualified genome DNA, quality control is carried out on all sample 50K chip data by utilizing PLINK, the rejection detection rate is lower than 0.90, and the Harder-Weinberg equilibrium rate is more than 10-6And SNP markers having a minimum allele frequency of less than 0.05.
In a further embodiment, in step S5, the method for performing whole genome re-sequencing on qualified genomic DNA is as follows:
s51, re-sequencing the genome DNA on a HiSeq2000 platform, and converting the obtained original image data into sequence data through base calibration, wherein the average sequencing depth of each sample is 11.7X, and clear data of 3.0T is obtained;
s52, comparing the Clean data after quality control to a pig reference genome by adopting BWA software, sequencing the compared data by adopting samtools and removing a repetitive sequence;
s53, performing mutation detection by adopting a GATK software best practice;
and S54, filtering the mutation sites based on the GATK, and performing quality control on the mutation sites detected by all the sample re-sequencing data by utilizing PLINK.
In a further embodiment, in step S54, the conditions for filtering the mutation sites are:
QualByDepth is less than 2.0;
FisherStrand is less than 60.0;
RMSMappingQuality is less than 40.0;
MappingQualityRankSumTest is less than-12.5;
ReadPosRankSumTest is less than-8.0;
the quality control criteria for all the detected mutation sites in the sample re-sequencing data are as follows:
the deletion rate is lower than 0.1;
the P value of the Hardy-Weinberg equilibrium test of a single SNP locus is less than 10-6；
The minimum allele frequency is greater than 0.05.
In a further embodiment, in step S6, the criteria for screening SNPs sites with high quality are as follows:
r of Beagle at a single SNP site2Above 0.80;
the P value of the Hardy-Weinberg equilibrium test of a single SNP locus is less than 10-6；
The minimum allele frequency is greater than 0.01.
The invention has the beneficial effects that: the positioning method disclosed by the invention identifies the key haplotypes of the social genetic effect of the remaining feed intake of the pigs by utilizing chip data, whole genome re-sequencing data, genotype filling, whole genome haplotype construction and a haplotype-based GWAS means, and has the advantages of accuracy in identification and high reliability.
Drawings
FIG. 1 is an electrophoretogram of genomic DNA according to an embodiment of the present invention;
FIG. 2 is a schematic illustration of the results of HGWAS mapping on the genome of a pig that influences the social genetic effect of residual feed intake according to an embodiment of the present invention.
Detailed Description
The embodiments of the present invention will be further described with reference to the accompanying drawings.
Example (b):
a method for positioning a social inheritance haplotype locus of the remaining feed intake of a pig comprises the following steps:
s1, selecting 1244 pure white pigs and 20 pure long white pigs as experimental pigs;
s2, calculating the residual feed intake of the experimental pig;
s3, collecting an ear tissue sample of an experimental pig, and extracting genome DNA, wherein FIG. 1 is an electrophoresis chart of the genome DNA;
s4, detecting the quality and concentration of the extracted genome DNA, selecting qualified genome DNA to perform 50K SNP genotyping sequencing, and rejecting unqualified products;
s5, performing whole genome re-sequencing on the qualified genome DNA obtained in the step S4, detecting 21104245 SNPs in total, and after quality control, obtaining 14539997 high-quality SNPs as whole genome re-sequencing data for subsequent analysis and use;
s6, taking the whole genome re-sequencing data obtained in the step S5 as reference data, carrying out genotype filling on the deletion genotypes of the 50K chip data of all experimental pigs to obtain the whole genome data of all experimental pigs, and screening to obtain 3072572 high-quality SNPs sites as social genetic effect data of the residual feed intake of the pigs;
s7, carrying out haplotype detection in the whole genome by adopting PLINK (version 1.90) based on the whole genome sequence information of all experimental pigs obtained after genotype filling to obtain 33780 qualified haplotype blocks, converting the haplotype blocks into multi-allele markers by adopting GHap software, screening qualified haplotype alleles, and taking 274741 haplotype blocks as whole genome haplotype data;
s8, adopting GEMMA software to carry out HGWAS analysis on the filled whole genome haplotype data and the residual feed intake social genetic effect data, wherein the analysis model is as follows: y is Xm + Wa + e, wherein y represents a vector of social genetic effect values; m represents a mark effect value; a represents the residual multigene effect vector; e represents a residual effect vector; x and W represent the incidence matrixes of m and a respectively;
s9, adopting a Bonferroni correction method to control multiple tests to correct the HGWAS result, and determining the significance threshold value to be 3.64 multiplied by 10-6As shown in fig. 2, the HGWAS mapping results for the social genetic effect of the remaining feed intake of 1204 inbred large white pigs, wherein the X-axis represents 18 autosomes of the pigs, and the Y-axis represents the position of the haplotype locus and the log10(P-value) value of the correlation of the social genetic effect of the remaining feed intake of the pigs in terms of its position in the genome, wherein the blue line represents the significant level threshold.
According to the results of HGWAS, 1 key haplotype locus which is obviously related to the social genetic effect of the remaining feed intake exists on the pig chromosome 4 (SSC6:132774639-132786416, 'CCAACAGGGGCAGAAGTGTTGTCATAGTCGGTGCTCTTTTAG').
In another embodiment, the criteria for selecting experimental pigs in step S1 are as follows:
removing individuals whose starting date is determined to be inconsistent with the birth date of the individual;
removing individuals with the determination days less than 60 days;
setting the record that the single-day feed intake is less than 0.5kg or more than 4.5kg as a deletion value;
setting the record with the single-day ingestion times less than 2 or more than 20 as a deletion value;
and setting recorded data with the single-day ingestion time less than 5min or more than 2h as a missing value.
In another embodiment, in step S2, the remaining feed intake of the experimental pig is calculated by the following formula: RFI (ADFI-14.1 ADG-2.83BFT-110.9 AMW), wherein RFI is the residual feed intake; ADFI is average daily food intake; ADG is average daily gain; BFT is backfat thickness; AMW is the average metabolic body weight.
In another embodiment, in step S2, after the remaining feed intake data is calculated, a social genetic effect model is usedEstimating the social genetic effect values of the remaining feed intake of all experimental pigs, and obtaining the reverse regression value of the social genetic effect of each individual based on the estimation accuracy of the social genetic effect for subsequent HGWAS analysis, wherein the estimation model is as follows: y ═ Xb + ZDaD+ZSaS+ Wl + Vg + e, where y represents a tabular value; b represents the fixation effect, including sex, year, month, year of birth, month; a isDAnd aSIs a vector of direct genetic effect and social genetic effect; l represents a random pit effect vector; g represents a random set effect vector; e, random residual error vector; x, ZD、ZSW and V represent b and a, respectivelyD、aSThe correlation matrix of l and g.
Evaluating the social genetic effect value of the remaining food consumption of each individual, obtaining the inverse regression value of the social genetic effect of each individual according to the estimation accuracy of the social genetic effect, and finally using the obtained inverse regression value of the social genetic effect of each individual for subsequent HGWAS analysis.
In another embodiment, in step S3, the method for extracting genomic DNA is as follows:
s31, collecting 1264-head pig ear tissue samples, placing the samples in a centrifuge tube filled with 75% ethanol, preserving the samples in a refrigerator at-20 ℃ for later use, taking soybean-sized tissue samples, shearing the samples into 2mL centrifuge tubes as much as possible, and adding 800 μ L of lysate and 30 μ L (20mg/mL) of protease;
s32, placing the sample in a thermostat at 55 ℃ for incubation until no tissue block exists in the tube;
s33, adding 800 mu L of Tris saturated phenol, slightly mixing uniformly for 10min, and centrifuging at 4 ℃ at 12000r/min for 12 min;
s34, adding 650 mu L of supernatant into Tris saturated phenol: chloroform: 800 μ L of isoamyl alcohol (25: 24: 1), mixing and shaking for 10min, centrifuging at 4 ℃ and 12000r/min for 12 min;
s35, collecting 550 μ L supernatant, adding 800 μ L chloroform, mixing and shaking for 10min, centrifuging at 4 deg.C and 12000r/min for 12 min;
the 1.5mL centrifuge tube was replaced as follows.
S36, taking 450 mu L of supernatant, adding 800 mu L of absolute ethyl alcohol and 40 mu L of 3M sodium acetate, mixing and shaking for 6min, and centrifuging for 8min at the temperature of 4 ℃ and at the speed of 1000 r/min;
s37, removing the supernatant, leaving DNA precipitate, adding 75% ethanol, mixing for 5min, centrifuging at 4 deg.C and 1000r/min for 5 min;
s38, placing the centrifugal tube into a fume hood, and drying until no small drops exist in the tube;
s39, adding 100 mu L of ultrapure water into the sample, slightly blowing and beating the sample until DNA is dissolved, detecting the quality and the concentration by a Nanodrop-100 spectrophotometer, uniformly diluting the concentration to 50 ng/mu L, and storing the solution at the temperature of-20 ℃ for later use.
In another embodiment, the method for detecting the quality and concentration of the extracted genomic DNA in step S4 is as follows:
s41, detecting the concentration and OD value of each genome DNA by using Nanodrop-2000, and selecting a genome DNA sample with the concentration of more than or equal to 50 ng/mu L and the OD260/OD280 of 1.8-2.0;
s42, detecting the integrity of DNA of the sample by using 1.0% agarose gel electrophoresis, selecting the genome DNA with single DNA band and obvious main band in figure 1 as a qualified sample, and storing the qualified sample in a refrigerator at-80 ℃ for later use.
In another embodiment, in step S4, during the 50K SNP genotyping sequencing process for the qualified genomic DNA, the quality control is performed on all the sample 50K chip data by using PLINK, the rejection detection rate is lower than 0.90, and the hadamard-weinberg equilibrium rate is greater than 10-6And SNP markers having a minimum allele frequency of less than 0.05.
In another example, in step S5, the method for performing whole genome re-sequencing on qualified genomic DNA is as follows:
s51, re-sequencing the genome DNA on a HiSeq2000 platform, and converting the obtained original image data into sequence data through base calibration, wherein the average sequencing depth of each sample is 11.7X, and clear data of 3.0T is obtained;
s52, comparing the Clean data after quality control to a pig reference genome (Sscofia 11.1) by adopting BWA software (version 0.7.15), sequencing the compared data by adopting samtools (version1.19) and removing a repetitive sequence;
s53, adopting GATK software (version 3.7) best practice to perform mutation detection;
and S54, filtering the mutation sites based on the GATK, and performing quality control on the mutation sites detected by all the sample re-sequencing data by utilizing PLINK.
In another embodiment, in step S54, the conditions for filtering the mutation sites are:
QualByDepth is less than 2.0;
FisherStrand is less than 60.0;
RMSMappingQuality is less than 40.0;
MappingQualityRankSumTest is less than-12.5;
ReadPosRankSumTest is less than-8.0;
the quality control criteria for all the detected mutation sites in the sample re-sequencing data are as follows:
the deletion rate is lower than 0.1;
the P value of the Hardy-Weinberg equilibrium test of a single SNP locus is less than 10-6；
The minimum allele frequency is greater than 0.05.
In another example, in step S6, the criteria for screening high quality SNPs are as follows:
r of Beagle at a single SNP site2Above 0.80;
the P value of the Hardy-Weinberg equilibrium test of a single SNP locus is less than 10-6；
The minimum allele frequency is greater than 0.01.
The above-mentioned embodiments only express the specific embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention.
Claims (10)
1. A method for positioning a social inheritance haplotype locus of the remaining feed intake of a pig is characterized by comprising the following steps:
s1, selecting experimental pigs;
s2, calculating the residual feed intake of the experimental pig;
s3, collecting an ear tissue sample of an experimental pig, and extracting genome DNA;
s4, detecting the quality and concentration of the extracted genome DNA, selecting qualified genome DNA to perform 50K SNP genotyping sequencing, and rejecting unqualified products;
s5, performing whole genome resequencing on the qualified genome DNA obtained in the step S4 to obtain high-quality whole genome resequencing data;
s6, taking the whole genome re-sequencing data obtained in the step S5 as reference data, carrying out genotype filling on the deletion genotypes of the 50K chip data of all experimental pigs to obtain the whole genome data of all experimental pigs, and screening to obtain high-quality SNPs sites as social genetic effect data of the residual feed intake of the pigs;
s7, carrying out haplotype detection in the whole genome by adopting PLINK based on the whole genome sequence information of all experimental pigs obtained after genotype filling to obtain qualified haplotype blocks, converting the haplotype blocks into multi-allele marks by adopting GHap software, and screening qualified haplotype alleles as whole genome haplotype data;
s8, adopting GEMMA software to carry out HGWAS analysis on the filled whole genome haplotype data and the inverse regression value data of the social genetic effect of the remaining feed intake, wherein the analysis model is as follows: y is Xm + Wa + e, wherein y represents an inverse regression vector of the social genetic effect; m represents a mark effect value; a represents the residual multigene effect vector; e represents a residual effect vector; x and W represent the incidence matrixes of m and a respectively;
s9, adopting a Bonferroni correction method to control multiple tests to correct the HGWAS result, and determining the significance threshold value to be 3.64 multiplied by 10-6And obtaining a key haplotype locus which is obviously related to the social genetic effect of the residual feed intake according to the display result of the HGWAS.
2. The method for mapping the loci of the social genetic haplotypes of the pig remaining feed intake of claim 1, wherein the criteria for selecting the experimental pig in step S1 are as follows:
removing individuals whose starting date is determined to be inconsistent with the birth date of the individual;
removing individuals with the determination days less than 60 days;
setting the record that the single-day feed intake is less than 0.5kg or more than 4.5kg as a deletion value;
setting the record with the single-day ingestion times less than 2 or more than 20 as a deletion value;
and setting recorded data with the single-day ingestion time less than 5min or more than 2h as a missing value.
3. The method for locating the social inheritance haplotype site of the pig remaining feed intake according to claim 1, wherein in step S2, the remaining feed intake of the experimental pig is calculated by the following formula: RFI (ADFI-14.1 ADG-2.83BFT-110.9 AMW), wherein RFI is the residual feed intake; ADFI is average daily food intake; ADG is average daily gain; BFT is backfat thickness; AMW is the average metabolic body weight.
4. The method for positioning the social genetic haplotype sites of the remaining feed intake of pigs according to claim 3, wherein in step S2, after the data of the remaining feed intake are obtained by calculation, the social genetic effect value of the remaining feed intake of all experimental pigs is estimated by using a social genetic effect model, and based on the estimation accuracy of the social genetic effect, the inverse regression value of the social genetic effect of each individual is obtained for the subsequent HGWAS analysis, wherein the estimation model is as follows: y ═ Xb + ZDaD+ZSaS+ Wl + Vg + e, where y represents a tabular value; b represents the fixation effect, including sex, year, month, year of birth, month; a isDAnd aSIs a vector of direct genetic effect and social genetic effect; l represents a random pit effect vector; g represents a random set effect vector; e, random residual error vector; x, ZD、ZSW and V represent b and a, respectivelyD、aSThe correlation matrix of l and g.
5. The method for mapping the loci of the social genetic haplotypes of the pig remaining feed intake of claim 1, wherein in step S3, the method for extracting the genomic DNA comprises the following steps:
s31, taking a soybean tissue sample, shearing the soybean tissue sample as much as possible, putting the soybean tissue sample into a centrifugal tube, and adding lysis solution and proteinase K;
s32, placing the sample in a thermostat at 55 ℃ for incubation until no tissue block exists in the tube;
s33, adding Tris saturated phenol, slightly mixing uniformly for 10min, and centrifuging at 4 ℃ at 12000r/min for 12 min;
s34, taking the supernatant, and adding the supernatant into the mixture according to the mass ratio of 25: 24: 1, mixing and shaking Tris saturated phenol, chloroform and isoamylol for 10min, and centrifuging at 4 ℃ and 12000r/min for 12 min;
s35, collecting supernatant, adding chloroform, mixing and shaking for 10min, centrifuging at 4 deg.C and 12000r/min for 12 min;
s36, taking the supernatant, adding absolute ethyl alcohol and 3M sodium acetate, mixing and shaking for 6min, and centrifuging for 8min at the temperature of 4 ℃ and at the speed of 1000 r/min;
s37, removing the supernatant, leaving DNA precipitate, adding 75% ethanol, mixing for 5min, centrifuging at 4 deg.C and 1000r/min for 5 min;
s38, placing the centrifugal tube into a fume hood, and drying until no small drops exist in the tube;
s39, adding ultrapure water into the sample, slightly blowing and beating the sample until DNA is dissolved, detecting the quality and the concentration by a spectrophotometer, uniformly diluting the concentration to 50 ng/mu L, and storing the solution at the temperature of minus 20 ℃ for later use.
6. The method for mapping the loci of the social genetic haplotypes of the pig remaining feed intake of claim 1, wherein the method for detecting the quality and concentration of the extracted genomic DNA in step S4 is as follows:
s41, detecting the concentration and OD value of each genome DNA by using Nanodrop-2000, and selecting a genome DNA sample with the concentration of more than or equal to 50 ng/mu L and the OD260/OD280 of 1.8-2.0;
s42, detecting the integrity of DNA by using 1.0% agarose gel electrophoresis to the sample, selecting the genome DNA with single DNA band and obvious main band as a qualified sample, and storing the qualified sample in a refrigerator at the temperature of 80 ℃ below zero for later use.
7. The method of claim 6, wherein in step S4, in the process of performing 50K SNP genotyping sequencing on qualified genomic DNA, PLINK is used to perform quality control on all sample 50K chip data, the rejection detection rate is lower than 0.90, and the Harder-Weinberg equilibrium rate is higher than 10-6And SNP markers having a minimum allele frequency of less than 0.05.
8. The method of claim 1, wherein the step S5 of re-sequencing the genome DNA of qualified quality comprises the steps of:
s51, re-sequencing the genome DNA on a HiSeq2000 platform, and converting the obtained original image data into sequence data through base calibration, wherein the average sequencing depth of each sample is 11.7X, and clear data of 3.0T is obtained;
s52, comparing the Clean data after quality control to a pig reference genome by adopting BWA software, sequencing the compared data by adopting samtools and removing a repetitive sequence;
s53, performing mutation detection by adopting a GATK software best practice;
and S54, filtering the mutation sites based on the GATK, and performing quality control on the mutation sites detected by all the sample re-sequencing data by utilizing PLINK.
9. The method of claim 8, wherein in step S54, the conditions for filtering the variant loci are as follows:
QualByDepth is less than 2.0;
FisherStrand is less than 60.0;
RMSMappingQuality is less than 40.0;
MappingQualityRankSumTest is less than-12.5;
ReadPosRankSumTest is less than-8.0;
the quality control criteria for all the detected mutation sites in the sample re-sequencing data are as follows:
the deletion rate is lower than 0.1;
the P value of the Hardy-Weinberg equilibrium test of a single SNP locus is less than 10-6；
The minimum allele frequency is greater than 0.05.
10. The method for mapping sites of social genetic haplotypes of pig remaining food consumption according to claim 1, wherein in step S6, the criteria for screening sites of SNPs with high quality are as follows:
r of Beagle at a single SNP site2Above 0.80;
the P value of the Hardy-Weinberg equilibrium test of a single SNP locus is less than 10-6；
The minimum allele frequency is greater than 0.01.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010652590.1A CN112029867A (en) | 2020-07-08 | 2020-07-08 | Method for positioning social genetic haplotype site of pig residual feed intake |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010652590.1A CN112029867A (en) | 2020-07-08 | 2020-07-08 | Method for positioning social genetic haplotype site of pig residual feed intake |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112029867A true CN112029867A (en) | 2020-12-04 |
Family
ID=73578993
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010652590.1A Pending CN112029867A (en) | 2020-07-08 | 2020-07-08 | Method for positioning social genetic haplotype site of pig residual feed intake |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112029867A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113584181A (en) * | 2021-07-26 | 2021-11-02 | 温氏食品集团股份有限公司 | SNP molecular marker related to pig residual feed intake and application thereof |
| CN113699247A (en) * | 2021-07-26 | 2021-11-26 | 华南农业大学 | SNP molecular marker on pig No. 1 chromosome and related to pig remaining feed intake and application thereof |
| CN114196761A (en) * | 2021-11-22 | 2022-03-18 | 四川农业大学 | Method for manufacturing liquid chip for selecting reward of parent strain pig feed |
| CN116042849A (en) * | 2022-11-09 | 2023-05-02 | 佛山科学技术学院 | Genetic marker for assessing pig feed intake and screening method and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106591439A (en) * | 2016-12-01 | 2017-04-26 | 华中农业大学 | Molecular marker for eye muscle pH value-related gene SVEP1 within 24 hours after slaughter of pigs and application of molecular marker |
| WO2019075577A1 (en) * | 2017-10-20 | 2019-04-25 | The Governors Of The University Of Alberta | Single nucleotide polymorphisms and feeding efficiency in cattle |
| CN110191965A (en) * | 2017-12-13 | 2019-08-30 | 中国农业大学 | Pig full-length genome 50K SNP chip and application |
| CN111225986A (en) * | 2017-10-10 | 2020-06-02 | 中国农业科学院北京畜牧兽医研究所 | Chicken whole genome SNP chip and application thereof |
-
2020
- 2020-07-08 CN CN202010652590.1A patent/CN112029867A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106591439A (en) * | 2016-12-01 | 2017-04-26 | 华中农业大学 | Molecular marker for eye muscle pH value-related gene SVEP1 within 24 hours after slaughter of pigs and application of molecular marker |
| CN111225986A (en) * | 2017-10-10 | 2020-06-02 | 中国农业科学院北京畜牧兽医研究所 | Chicken whole genome SNP chip and application thereof |
| WO2019075577A1 (en) * | 2017-10-20 | 2019-04-25 | The Governors Of The University Of Alberta | Single nucleotide polymorphisms and feeding efficiency in cattle |
| CN110191965A (en) * | 2017-12-13 | 2019-08-30 | 中国农业大学 | Pig full-length genome 50K SNP chip and application |
Non-Patent Citations (2)
| Title |
|---|
| PINGXIAN WU等: "Whole-genome re-sequencing association study for direct genetic efects and social genetic efects of six growth traits in Large White pigs", 《SCIENTIFIC REPORTS》 * |
| SUNEEL K. ONTERU等: "Whole Genome Association Studies of Residual Feed", 《PLOS ONE》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113584181A (en) * | 2021-07-26 | 2021-11-02 | 温氏食品集团股份有限公司 | SNP molecular marker related to pig residual feed intake and application thereof |
| CN113699247A (en) * | 2021-07-26 | 2021-11-26 | 华南农业大学 | SNP molecular marker on pig No. 1 chromosome and related to pig remaining feed intake and application thereof |
| CN113699247B (en) * | 2021-07-26 | 2023-07-14 | 华南农业大学 | SNP molecular marker related to pig residual feed intake on pig chromosome 1 and application thereof |
| CN114196761A (en) * | 2021-11-22 | 2022-03-18 | 四川农业大学 | Method for manufacturing liquid chip for selecting reward of parent strain pig feed |
| CN116042849A (en) * | 2022-11-09 | 2023-05-02 | 佛山科学技术学院 | Genetic marker for assessing pig feed intake and screening method and application thereof |
| CN116042849B (en) * | 2022-11-09 | 2023-11-17 | 佛山科学技术学院 | Genetic marker for assessing pig feed intake and screening method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112029867A (en) | Method for positioning social genetic haplotype site of pig residual feed intake | |
| Pollinger et al. | Selective sweep mapping of genes with large phenotypic effects | |
| CN112322753B (en) | SNP molecular marker related to intramuscular fat of pork and application thereof | |
| CN110218798B (en) | SNP molecular marker located on pig chromosome 7 and related to eye muscle area and eye muscle thickness and application | |
| CN107937556B (en) | SNP (Single nucleotide polymorphism) site related to pig feed conversion rate and application thereof | |
| CN112885408A (en) | Method and device for detecting SNP marker locus based on low-depth sequencing | |
| CN116083597B (en) | SNP genetic marker affecting later egg yield of chickens and application thereof | |
| AU2021104302A4 (en) | Marker primer combination for molecular identification of quantitative traits of spines of apostichopus japonicus and use thereof | |
| CN114317779A (en) | SNP molecular marker related to pig carcass traits and application | |
| CN108676899A (en) | A kind of and the relevant SNP marker of Erhualian sow litter trait and its detection method | |
| CN111485026A (en) | Sheep birth weight related SNP (single nucleotide polymorphism) site, application, molecular marker and primer | |
| CN114196761A (en) | Method for manufacturing liquid chip for selecting reward of parent strain pig feed | |
| CN112176072B (en) | Reagent, primer, kit and application for detecting intramuscular fat content of beef cattle | |
| CN113249492B (en) | SNP marker for evaluating pig eye muscle area and application method thereof | |
| CN109762925B (en) | KASP molecular marker of rice blast-resistant broad-spectrum gene pi9, detection method and application thereof | |
| CN116286804A (en) | SNP molecular marker related to pig correction of backfat thickness of 115 kg body weight and application | |
| CN114250306B (en) | Method for evaluating pig age of 100kg body weight by GLRX3 gene and application | |
| CN104726577B (en) | A kind of SNP marker related to Erhualian sow litter trait and its detection method | |
| CN107815499A (en) | One SNP site related to the pig 100kg body weight thickness of backfats and its application | |
| CN110195116B (en) | Boar sperm motility related molecular genetic marker and application and acquisition method thereof | |
| CN107937558B (en) | SNP (Single nucleotide polymorphism) locus related to average daily feed intake of pig and application thereof | |
| Sukaryo et al. | Identification of 19-bp indel of the Pleomorphic adenoma gene 1 in Bali cattle population | |
| CN114134233A (en) | SNP (single nucleotide polymorphism) related to day age of 100kg and eye muscle area of pig | |
| CN116042849B (en) | Genetic marker for assessing pig feed intake and screening method and application thereof | |
| CN104651526B (en) | A kind of SNP marker related to Erhualian sow litter trait and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |