CN112029853B

CN112029853B - Sudden cardiac death susceptibility detection kit based on HSPA1B gene insertion deletion polymorphic site

Info

Publication number: CN112029853B
Application number: CN202011085450.7A
Authority: CN
Inventors: 何艳; 杨真真; 陈雪坤; 于欢; 高玉振
Original assignee: Suzhou University
Current assignee: Suzhou University
Priority date: 2020-10-12
Filing date: 2020-10-12
Publication date: 2022-03-01
Anticipated expiration: 2040-10-12
Also published as: CN112029853A

Abstract

The invention discloses a sudden cardiac death susceptibility detection kit based on HSPA1B gene insertion deletion polymorphism sites. The specific primer pair contained in the kit is designed aiming at the rs3036297 insertion deletion site on the HSPA1B gene, can specifically amplify a DNA fragment containing the site and identify different genotypes by detecting the mobility of the fragments with different lengths in capillary electrophoresis, and the case contrast research shows that the person with the detected DNA carrying the deletion allele at the rs3036297 insertion deletion site on the HSPA1B gene is SCD susceptible. Therefore, the technology can play a role in predicting the susceptibility of individual SCD by detecting the genotype of the rs3036297 insertion deletion site on the HSPA1B gene of an individual.

Description

Sudden cardiac death susceptibility detection kit based on HSPA1B gene insertion deletion polymorphic site

Technical Field

The invention relates to a sudden cardiac death susceptibility detection kit based on HSPA1B gene insertion deletion polymorphic sites, and belongs to the technical field of detection.

Background

Sudden Cardiac Death (SCD) refers to sudden unexpected death caused by cardiac causes, manifested by sudden loss of consciousness and circulatory and respiratory arrest occurring in a short period of time. "short-term" is defined as less than 1 hour for witnesses and 24 hours for no witnesses. Epidemiology shows that 40.7 people die of SCD in 10 million people every year in China, and the number of SCD cases is very large in consideration of the huge population base in China. Numerous previous studies have shown that the cause of death of SCD is usually coronary atherosclerotic heart disease or fatal arrhythmia. The former is often found in the elderly, while the latter is often found in young people. Considering that it is difficult to find accurate cause of death by autopsy and histological examination after death, it is urgent to uncover the molecular mechanism of SCD generation and search for genetic markers of SCD in order to accurately diagnose SCD.

The past research aiming at the SCD diagnosis field mainly focuses on the correlation analysis of coding region mutation and sudden death of important protein coding genes, however, the related mutations are not only limited in number, but the relatively high sudden death incidence rate is difficult to completely explain by the extremely low gene frequency of the general population. With the development of genome-wide association studies and second-generation sequencing technologies, more and more genetic markers are found to be involved in the regulation of SCD. The identification of the SCD genetic marker can further understand the potential mechanism of the SCD genetic marker, optimize the risk stratification of the SCD and provide a powerful theoretical basis for molecular diagnosis and prevention. Considering that the 3'UTR plays an important role in regulating and controlling gene expression, the attention is paid to genetic polymorphism in the region, and the correlation between the genetic polymorphism of the 3' UTR in related genes and SCD susceptibility is analyzed through case contrast research, so that the possibility is provided for establishing a gene polymorphism detection system for SCD risk assessment.

The heat shock 70 family member 1B (Hsp70) family A (HSPA 1B) gene is located in the human histocompatibility complex III region, and due to the high degree of conservation of the gene sequence and the similarity of the encoded products, the extracellular HSPA1B protein is recognized by the immune system in vivo and causes immune response, initiates or aggravates the atherosclerosis process, and is a potential risk factor for sudden cardiac death.

In the prior art, no research report on the correlation of rs3036297 insertion deletion polymorphism and SCD is reported, and no correlation report on predicting SCD susceptibility by detecting the insertion deletion polymorphic site of 3' UTR of HSPA1B gene is reported.

Disclosure of Invention

In order to solve the problems, the invention provides a kit for detecting SCD susceptibility, which is based on the polymorphism of the rs3036297 insertion deletion site on the HSPA1B gene and can be used for evaluating the susceptibility of an individual to SCD.

The first purpose of the invention is to provide a sudden cardiac death susceptibility detection kit based on the polymorphic site of HSPA1B gene insertion deletion, which is used for detecting the genotype of the rs3036297 site of the HSPA1B gene.

Further, the sudden cardiac death susceptibility detection kit comprises a specific primer pair for detecting the rs3036297 site of the HSPA1B gene and components for PCR amplification and capillary electrophoresis.

Further, the specific primer pair comprises a sense primer and an antisense primer, wherein the nucleotide sequence of the sense primer is shown as SEQ ID NO.1, the nucleotide sequence of the antisense primer is shown as SEQ ID NO. 2:

SEQ ID No.1：5’-ACTGTTGGGACTCAAGGACT-3’；

SEQ ID No.2：5’-TACAAAAATAATGAAGCCAGCTAAT-3’。

further, the Tm value of the nucleotide sequence of the sense primer is 58 ℃.

Further, the Tm value of the nucleotide sequence of the antisense primer is 56 ℃.

Furthermore, the 5' end of the specific primer pair is provided with a fluorescent label.

In the invention, a specific primer of a fluorescent marker is designed aiming at the rs3036297 insertion deletion site on the HSPA1B gene, a fragment containing the insertion deletion can be specifically amplified, a fluorescent dye is marked at the 5' end of an oligonucleotide primer by a fluorescent marking technology, and one strand of a product after PCR amplification carries the fluorescent dye for marking the primer. Principle of experiment one skilled in the art will appreciate that specific primer pairs can be synthesized using conventional synthetic techniques. In a preferred technical scheme, the kit for detecting SCD comprises a primer pair with sequences shown in SEQ ID No.1 and SEQ ID No.2, but the primer of the invention is not limited to the primer pair.

Further, the components for PCR amplification and capillary electrophoresis comprise: taq DNA polymerase, dNTP mixed solution, MgCl₂Solution, PCR reaction buffer and deionized water.

Further, the PCR amplification product was analyzed for genotype by capillary electrophoresis.

The second purpose of the invention is to provide the application of the sudden cardiac death susceptibility detection kit in detecting the rs3036297 locus genotype of the HSPA1B gene.

Further, the application is that a PCR amplification product is obtained by adopting fluorescence labeling PCR amplification, and the genotype analysis is carried out on the amplification product by a capillary electrophoresis typing method.

Through molecular biological research, different allelic types of one insertion deletion polymorphism rs3036297 in the 3' UTR of the HSPA1B gene can affect the transcriptional activity of the HSPA1B gene, and the transcriptional activity of an individual carrying the insertion type allele HSPA1B is relatively low; in addition, it was found from the SCD case control study of a certain size population that the insertional allele of the insertion deletion polymorphism is negatively correlated with SCD occurrence, and this correlation is present even after adjusting factors such as age and sex. This indel polymorphism is therefore considered useful for assessing the susceptibility of an individual to SCD.

The invention has the beneficial effects that:

the specific primer pair contained in the kit is designed aiming at the rs3036297 insertion deletion site on the HSPA1B gene, can specifically amplify a DNA fragment containing the site and identify different genotypes by detecting the mobility of the fragments with different lengths in capillary electrophoresis, and the case contrast research shows that the person with the detected DNA carrying the deletion allele at the rs3036297 insertion deletion site on the HSPA1B gene is SCD susceptible. Therefore, the technology can play a role in predicting the susceptibility of individual SCD by detecting the genotype of the rs3036297 insertion deletion site on the HSPA1B gene of an individual. The subject group demonstrated for the first time that a five base (AAGTT) indel polymorphism (rs3036297) located in the 3' UTR of the HSPA1B gene was significantly associated with a risk of SCD development; the frequency distribution of this polymorphism in the asian population was insertion 0.655 and deletion 0.355.

Drawings

FIG. 1 is a diagram of gene sequencing and a diagram of SDS-PAGE gel electrophoresis typing.

Detailed Description

The present invention is further described below in conjunction with specific examples to enable those skilled in the art to better understand the present invention and to practice it, but the examples are not intended to limit the present invention.

Example 1: use of the detection kit

Step 1: extraction of DNA template

Genomic DNA of peripheral blood was extracted using a blood genomic DNA extraction system (non-centrifugal column type).

Step 2: PCR reaction-replication of the fragment of interest

A PCR detection kit capable of detecting SCD susceptibility is used, wherein the kit comprises the following primers:

SEQ ID No. 1: 5'-ACTGTTGGGACTCAAGGACT-3', Tm value is 58 ℃;

SEQ ID No. 2: 5'-TACAAAAATAATGAAGCCAGCTAAT-3', Tm value is 56 ℃;

the primer pair can specifically amplify a fragment containing the rs3036297 insertion deletion site polymorphism in the HSPA1B gene.

The total volume of the PCR reaction system is 10ul, and the PCR reaction system comprises: mu.l of DNA template, 0.04 mu.l of each of two 50 mu M specific primer pairs and 0.08 mu.l of 2.5U/. mu.l of Taq DNA polymerase; 0.2. mu.l of 2.5mM dNTP mixture; 25mM MgCl₂Solution 0.6 μ l; 10 XPCR reaction buffer 1. mu.l; supplementing deionized water; the reaction was carried out on an Eppendorf Mastercycler nexus PCR amplification apparatus under the following conditions: 3min at 94 ℃; another 30 PCR cycles were performed: 30s at 94 ℃, 30s at 57 ℃ and 1min at 72 ℃; finally 5min at 72 ℃.

And step 3: indel genotype analysis

After the amplification is finished, products are subjected to capillary electrophoresis separation by using an ABI 3500 gene sequencer to obtain the genotype of the detected individual, and the genotype is explained by professional staff.

The gene frequency difference and the disease risk OR value at the site between the control group and the SCD case group are shown in Table 1.

The gene sequencing diagram and the SDS-PAGE gel electrophoresis typing diagram are shown in FIG. 1. Wherein FIG. 1A is an example of the sequencing result of a template strand, the five base insertion deletion at rs3036297 of the corresponding coding strand is underlined; FIG. 1B is a schematic diagram showing electrophoresis of 14 DNA samples from different individuals obtained by using the PCR amplification system of the present invention, wherein 1, 3, 4, 6, and 11 are deletion homozygotes, 2 and 13 are insertion homozygotes, and the rest are heterozygotes.

TABLE 1 Association between polymorphic site rs3036297 and SCD Risk

Note:^aOR is corrected according to age and gender likelihood ratio (risk ratio); CI: confidence interval

As shown in table 1, in the co-dominant model, the risk of SCD development was 69% for the insertion/insertion type individuals and 45% for the insertion/deletion type individuals compared to the deletion/deletion type individuals at the 95% confidence interval; in the dominant model, the risk of SCD in an individual with genotype insertion/insertion or insertion/deletion is reduced by 49% compared to an individual with genotype deletion/deletion; finally, additive model analysis showed that individuals carrying the deletion allele had a 42% reduced risk of developing SCD compared to individuals carrying the insertion allele.

The above-mentioned embodiments are merely preferred embodiments for fully illustrating the present invention, and the scope of the present invention is not limited thereto. The equivalent substitution or change made by the technical personnel in the technical field on the basis of the invention is all within the protection scope of the invention. The protection scope of the invention is subject to the claims.

Sequence listing

<110> Suzhou university

<120> sudden cardiac death susceptibility detection kit based on HSPA1B gene insertion deletion polymorphic site

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 20

<212> DNA

<213> (Artificial sequence)

<400> 1

actgttggga ctcaaggact 20

<210> 2

<211> 25

<212> DNA

<213> (Artificial sequence)

<400> 2

tacaaaaata atgaagccag ctaat 25

Claims

1. A sudden cardiac death susceptibility detection kit based on HSPA1B gene insertion deletion polymorphic site is characterized in that the kit is used for detecting the genotype of rs3036297 site of HSPA1B gene;

the sudden cardiac death susceptibility detection kit comprises a specific primer pair for detecting rs3036297 site of HSPA1B gene and components for PCR amplification and capillary electrophoresis;

the specific primer pair comprises a sense primer and an antisense primer, wherein the nucleotide sequence of the sense primer is shown as SEQ ID NO.1, and the nucleotide sequence of the antisense primer is shown as SEQ ID NO. 2:

SEQ ID No.1：5’- ACTGTTGGGACTCAAGGACT -3’；

SEQ ID No.2：5’- TACAAAAATAATGAAGCCAGCTAAT -3’。

2. the reagent kit for detecting susceptibility to sudden cardiac death as set forth in claim 1, wherein the nucleotide sequence of the sense primer has a Tm value of 58 ℃ and the nucleotide sequence of the antisense primer has a Tm value of 56 ℃.

3. The sudden cardiac death susceptibility detection kit of claim 1, wherein the 5' end of the specific primer pair is labeled with a fluorescent label.

4. The sudden cardiac death susceptibility detection kit of claim 1, wherein the components for PCR amplification and capillary electrophoresis comprise: taq DNA polymerase, dNTP mixed solution, MgCl₂Solution, PCR reaction buffer and deionized water.

5. The sudden cardiac death susceptibility detection kit of claim 1, wherein the sudden cardiac death susceptibility detection kit specifically comprises a 50 μ M specific primer pair, 2.5U/μ l Taq DNA polymerase; 2.5mM dNTP mix; 25mM MgCl₂A solution; 10 × PCR reaction buffer; deionized water.

6. The sudden cardiac death susceptibility test kit of claim 1, wherein the PCR amplification product is used to analyze the genotype by capillary electrophoresis.