CN112029845A

CN112029845A - Application of 5-HTR7 gene and expression product thereof as target in preparation of anti-liver fluke infection product

Info

Publication number: CN112029845A
Application number: CN202010815458.8A
Authority: CN
Inventors: 沈辉; 刘春英
Original assignee: Guilin Medical University
Current assignee: Guilin Medical University
Priority date: 2020-08-14
Filing date: 2020-08-14
Publication date: 2020-12-04

Abstract

The invention discloses an application of a 5-HTR7 gene and an expression product thereof as targets in preparation of a product for resisting liver fluke infection, belonging to the technical field of biological medicine. According to the invention, through research, the expression level of the 5-HTR7 gene is obviously increased in the cyst removal process of the coenuruses after the host swallows the coenuruses of the liver fluke, and the 5-HTR7 plays a key role in the cyst removal process of the coenuruses. Therefore, the 5-HTR7 gene and the expression product thereof can be used as targets for preparing products for resisting the liver fluke infection, not only opens up new application fields of the 5-HTR7 gene and the expression product thereof, but also opens up new products for resisting the liver fluke infection, and has wide application space.

Description

Application of 5-HTR7 gene and expression product thereof as target in preparation of anti-liver fluke infection product

Technical Field

The invention relates to an application of a 5-HTR7 gene and an expression product thereof as a target in preparation of a product for resisting liver fluke infection, belonging to the technical field of biological medicine.

Background

The liver trematosis caused by the liver trematode imagoes parasitizing in the hepatobiliary ducts of human beings and mammals is the most serious food-borne zoonosis in China at present. People are infected by eating raw fish and shrimp food and swallowing the fasciola hepatica metacercaria by mistake, so that serious diseases and complications such as hepatomegaly, cholangitis, cholecystitis, cholelithiasis, obstructive jaundice, hepatobiliary system tumor and the like can be caused, and the risk of bile duct cancer is obviously increased.

The life history of the liver fluke is a typical life history of the counterworm, and comprises stages of adult flukes, worm eggs, larva, coenurses, leicaria, cercaria, coenurses, metacercaria and the like. Adults live within the bile ducts of humans or mammals. The eggs enter the digestive tract along with the bile and are mixed with the feces to be discharged, after being swallowed by a first intermediate host fresh water snail in water, the larvae hatch in the digestive tract of the snail body and pass through the intestinal wall to develop in the snail body, and 3 stages of the larvae, the miracidiums and the cercaria are carried out. Mature cercariae escapes from the snail body, and when the mature cercariae meets a second intermediate host, namely freshwater fish, the mature cercariae invades tissues such as muscle in the fish body and develops into cysticercosis.

After the cysticercus in fish body is swallowed by final host (human, cat, dog, etc.), under the action of digestive juice, the cyst wall is softened, the larva in the cyst is activated, the larva activity is intensified, and the cyst is broken in duodenum. The excystation process is mainly stimulated by pancreatin, the excystated larva flows along the reverse flow of bile, and a small part of larva can reach the intrahepatic bile duct within a few hours.

At present, a preventive medicine for blocking the early infection process (bursal removal) of the liver fluke is lacked, and the broad-spectrum anthelmintics mainly used for clinically treating the liver fluke disease, namely praziquantel and albendazole, cannot realize the function. In view of the above, there is a need to provide a new drug for preventing or treating liver trematosis to overcome the deficiencies of the prior art.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides an application of a 5-HTR7 gene and an expression product thereof as a target in preparing a product for resisting liver fluke infection. According to the invention, through research, the expression level of the 5-HTR7 gene is obviously increased in the cyst removal process of the coenuruses after the host swallows the coenuruses of the liver fluke, and the 5-HTR7 plays a key role in the cyst removal process of the coenuruses. Therefore, the 5-HTR7 gene and the expression product thereof can be used as targets for preparing products for resisting the liver fluke infection, not only opens up new application fields of the 5-HTR7 gene and the expression product thereof, but also opens up new products for resisting the liver fluke infection, and has wide application space.

The technical scheme for solving the technical problems is as follows: 5-HTR7 gene and application of expression product thereof as target in preparation of products for resisting liver fluke infection.

The invention has the beneficial effects that:

according to the invention, through research, the expression level of the 5-HTR7 gene is obviously increased in the cyst removal process of the coenuruses after the host swallows the coenuruses of the liver fluke, and the 5-HTR7 plays a key role in the cyst removal process of the coenuruses. Therefore, the 5-HTR7 gene and the expression product thereof can be used as targets for preparing products for resisting liver fluke infection, not only opens up new application fields of the 5-HTR7 gene and the expression product thereof, but also opens up new drugs for resisting liver fluke infection, and has wide application space.

On the basis of the technical scheme, the invention can be further improved as follows.

Furthermore, the nucleotide sequence of the 5-HTR7 gene is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO. 2.

The adoption of the further beneficial effects is as follows: the 5-HTR7 gene, designated herein as 5-hydroxytryptamine receptor 7, is a subtype of the 5-hydroxytryptamine receptor family. The 5-hydroxytryptamine receptor is a group of G protein coupled receptors and ligand-gated ion channels which are present in the central part of the central nervous system and at the periphery of the peripheral nervous system, and widely participates in and influences the behaviors and various physiological functions of organisms. At present, in the prior art, no report that the 5-HTR7 gene and an expression product thereof are used as a drug control target of liver flukes is provided.

Further, the product is any one of a product for diagnosing liver fluke infection by RT-PCR, a product for detecting liver fluke infection by real-time quantitative PCR, a product for diagnosing liver fluke infection by immunodetection, a product for diagnosing liver fluke infection by in-situ hybridization, a product for diagnosing liver fluke infection by a chip and a product for detecting liver fluke infection by a high-throughput sequencing platform.

The adoption of the further beneficial effects is as follows: the stage of liver fluke infection can be detected by various types of products. The user can select flexibly according to the actual conditions.

Furthermore, the RT-PCR product for diagnosing the liver fluke infection at least comprises a pair of primers for specifically amplifying the 5-HTR7 gene, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 4.

Furthermore, the product for detecting the liver fluke infection by real-time quantitative PCR at least comprises a pair of primers for specifically amplifying the 5-HTR7 gene, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 4.

Still further, the immunoassay product for diagnosing liver fluke infection comprises an antibody specifically binding to 5-HTR7 protein.

Still further, the product for diagnosing liver fluke infection by in situ hybridization comprises a probe hybridized with a nucleic acid sequence of 5-HTR7 gene.

Furthermore, the products for diagnosing liver fluke infection by the chip comprise a protein chip and a gene chip; wherein the protein chip comprises an antibody which is specifically combined with the 5-HTR7 protein, and the gene chip comprises a probe which is hybridized with the nucleic acid sequence of the 5-HTR7 gene.

Drawings

FIG. 1 shows the results of RT-PCR detection of the expression level of 5-HTR7 gene in example 6 of the present invention.

Detailed Description

The principles and features of this invention are described below in conjunction with the following detailed drawings, which are given by way of illustration only and are not intended to limit the scope of the invention.

Example 1: collection of Clonorchis sinensis metacercaria sample

Collecting positive pseudorasbora parva infected by clonorchis sinensis from some reservoir in Guangxi in 2019, 8-1019 and 10, and collecting coenuruses by artificial digestion. The specific method comprises the steps of mincing the infected fish meat into paste, adding the artificial digestive juice according to the mass ratio of 1:5, and placing in a 37 ℃ incubator overnight. Wherein the artificial digestive juice is prepared by dissolving pepsin 10g and concentrated hydrochloric acid 9ml in physiological saline 1000 ml. Pouring out the supernatant, placing in a 40-mesh inspection sieve, adding normal saline, cleaning, filtering, standing for precipitation, and discarding the supernatant. Adding normal saline to wash repeatedly for 4-5 times until the supernatant is clear. Pouring the sediments into a culture dish in several times, and separating the cysticercus under a dissecting mirror. Finally, the cysticercus is placed in normal saline and stored at 4 ℃ for later use.

Example 2: in vitro excystation experiment

The collected coenuruses of example 1 were divided into two groups, a control group and an experimental group. Placing the cyst removal solution (0.5% trypsin solution by mass percentage concentration) in a water bath kettle at 37 ℃, balancing for 15min, then adding 1ml of cysticercus (2500 cysticercus 2000) into each of the experimental group and the control group, gently mixing, placing in a water bath at 37 ℃ for 30min, observing under an inverted microscope, and counting the cyst removal condition. And collecting other samples, placing the samples in liquid nitrogen, and performing RNA extraction and subsequent experiments.

Example 3: extraction and detection of coenurus sample RNA

Extracting total RNA of a control group and an experimental group by a TRIZOL method, and specifically comprising the following steps:

collecting coenurium samples of control group and experimental group, respectively washing with RNase Free Water, placing in a treated grinder, and fully grinding in 1ml TRIzol, wherein the whole grinding process needs to be completed under ice bath condition. Centrifuge at 12,000 Xg for 15min at 4 ℃ and transfer the supernatant to another centrifuge tube. Standing the supernatant at room temperature for 5min to fully crack nucleoprotein complex, adding 0.2ml chloroform, shaking for 10-15s to obtain white color, and standing for 2 min. The RNA was centrifuged at 13,000 Xg for 10min at 4 ℃ while in the upper colorless aqueous phase and the supernatant was transferred to another centrifuge tube. 0.5ml of isopropanol was added to the supernatant, and the mixture was inverted several times and mixed well, left to stand at 4 ℃ for 10min, and centrifuged at 13,000 Xg for 10min, whereby RNA precipitates were observed as white colloidal particles on the tube wall. After discarding the supernatant, 1ml of 75% by volume ethanol was added, and the mixture was washed by pipetting several times, and then centrifuged at 13,000 Xg for 5min at 4 ℃ to discard the supernatant. Placing the washed centrifuge tube containing RNA in an ultra-clean bench, air-drying for 15min-20min, adding 20-100 μ L RNase-free Water according to the precipitation amount of RNA to dissolve RNA, repeatedly blowing and sucking by a pipette to fully dissolve RNA, and bathing at 60 deg.C for 10 min. The dissolved RNA sample was aspirated to 2. mu.L for concentration detection, and the remaining samples were stored at-70 ℃.

Example 4: construction and quality inspection of RNA-seq sequencing library of cysticercus RNA

The construction and sequencing of cDNA library are completed by Shanghai Meiji Biotech Co. Sequencing data of samples of a control group and an experimental group are subjected to sequencing error rate detection, GC content distribution detection and original data filtration to obtain Clean reads used for subsequent analysis.

It is generally accepted that RNA-seq data are analyzed for differential gene expression across different libraries with a total library read of at least 10M, with the overall GC content of the data being kept between 40% and 60%, and it is reasonable to have a percentage of Q30 bases above 80%. Clear Data of each group of samples sequenced at this time all reach more than 4Gb, the GC content is about 43.8%, the samples are kept stable, the percentage of Q30 base is more than 94%, and the sequencing quality is good, so that the subsequent analysis can be carried out. The integrity of the statistical information and the assembly result is high.

Example 5: sequencing data results analysis

1. Alignment and functional Annotation

The Unigene sequence obtained by sequencing was aligned with the databases NR, Swiss-Prot, GO, COG, KOG, KEGG using BLAST software to finally obtain 22099 Unigenes with annotated information.

2. Screening for expressed genes

By screening the sequencing result of the transcriptome (setting the expression difference multiple to be 2 and the P value to be 0.1), the control group has 151 genes with significant difference expression compared with the experimental group, wherein the expression of the genes with significant up-regulation is 59, and the expression of the genes with significant down-regulation is 92. Specific results are shown in table 1.

TABLE 1 statistical Table of differentially expressed genes

In the table, the unknown protein refers to a functionally unknown gene sequence that cannot be functionally annotated by a known database.

3. Functional enrichment analysis of expression differential genes

The function enrichment is carried out on the differentially expressed genes, and the most main signal pathway enriched by the differentially expressed genes of the experimental group and the control group is a 5-hydroxytryptamine synaptic signal pathway (serotonergic synapse). At the transcription level, the important role of the signal path in the cyst removal process of clonorchis sinensis is proved. Wherein the 5-HTR7 is an up-regulated gene in the process of cyst removal of clonorchis sinensis bladder.

KEGG enrichment analysis is carried out on the screened differentially expressed genes, and when the corrected P value (Padjust) is less than 0.05, the KEGG PATHWAY function is considered to have a significant enrichment condition. The differentially expressed genes are functionally enriched, and the main signal pathways for enriching the differentially expressed genes of an experimental group and a control group are a 5-hydroxytryptamine synaptic signal pathway (serologic synapse) and a neural activity ligand-receptor interaction signal pathway (Neuroactive ligand-receptor interaction).

Through KEGG functional enrichment analysis, the invention discovers that in the process of cyst removal of clonorchis sinensis, a 5-hydroxytryptamine energy synaptic signal pathway and a nerve activity ligand-receptor interaction signal pathway are two pathways with most concentrated differential expression genes. The two pathways were further analyzed for specific differentially expressed genes. In the 5-hydroxytryptamine synaptic signaling pathway and the neural activity ligand-receptor interaction signaling pathway, the 5-hydroxytryptamine synaptic signaling pathway differential expression genes mainly comprise 5-hydroxytryptamine receptor (5-HTR), Guanine nucleotide-binding protein G subunit alpha (GNAZ), and Small conductance calcium-activated potassium channel protein 3 (KCNN 3).

Differentially expressed genes in the large class of neuronal activity ligand-receptor interactions include, in addition to 5-HTR, the purinoceptor P2RX5, the neuroleptic receptor BZRP. The 5-hydroxytryptamine receptor (5-HTR7) is finally determined to be a candidate target gene by combining the functions of different differential expression genes.

The nucleotide sequence of the 5-HTR7 gene is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO. 2.

Example 6: screening out target gene, and verifying by RT-PCR

1. Sample RNA was obtained as in example 3.

2. Reverse transcription to synthesize cDNA

According to the protocol of the first strand cDNA Kit (HiFiScript gDNA Removal cDNA Synthesis Kit) in the Kangshi century, 10. mu.L of RNA was reverse transcribed to synthesize first strand cDNA.

(1) Reactions for removing genomic DNA

The reaction system of table 2 was formulated on ice. In order to ensure the accuracy of the preparation of the reaction solution, a premixing system is prepared firstly, then the premixed system is subpackaged into each reaction tube, and finally an RNA sample is added.

TABLE 2 reaction System

Reagent	Volume (μ L)
		10×gDNA Eraser Buffer	1
gDNA Erase	0.5
		RNA	2
Sterilized distilled water	6.5
		Total volume	10

Vortex, shake, mix well, centrifuge briefly, collect the solution on the tube wall to the tube bottom, incubate for 2min at 42 ℃. After the reaction was completed, the reaction mixture was centrifuged at 12,000 Xg for 30 seconds and cooled on ice to obtain a genome-free RNA template.

(2) Reverse transcription reaction

A reaction system was prepared on ice according to Table 3, and 10. mu.L of the premix was added to the genome-removed RNA template obtained in step (1).

TABLE 3 reaction System

Reagent	Volume (μ L)
		Degenomic group obtained in step (1)	10
RNAHiFiScript，200U/μL	1
		Primer Mix	1
5×ScriptRT Buffer	4
		Sterilized distilled water	4
Total volume	20

Mix well and centrifuge at 12,000 Xg for 30s to collect the solution on the tube wall to the bottom. cDNA Synthesis reaction conditions: incubate at 42 ℃ for 15min and 85 ℃ for 5 min. After the reaction is finished, the mixture is placed on ice after being centrifuged for a short time, and then the subsequent fluorescent quantitative PCR is carried out.

RT-PCR detection

Designing a primer: and (3) adopting online primer design software, selecting beta-actin for the reference gene according to a 5-HTR7 gene sequence (SEQ ID NO.2), and synthesizing the primer by Shenzhen Huada gene company. Specific primer sequences are shown in table 4.

TABLE 4 RT-PCR primer sequences

Gene	Numbering	Sequence of
			5-HTR7 gene upstream primer	SEQ ID NO.3	acaacattggacacggcaac
5-HTR7 gene downstream primer	SEQ ID NO.4	tattgttgccaccgcgattg
			Beta-actin gene upstream primer	SEQ ID NO.5	ggtgacgctgaagtatcctattga
Beta-actin gene downstream primer	SEQ ID NO.6	ccaaagcatagccctcgtagat

The operation process is as follows:

using fluorescent quantitative PCR kit (

Premix Ex Taq^TMII) (TaKaRa) and the experimental procedures were performed according to the relevant instructions. The amplification procedure was: the pre-reaction was carried out at 95 ℃ for 3min, and 40 cycles (95 ℃, 3s, 60 ℃, 30s) of amplification were carried out.

The reaction system is shown in Table 5.

TABLE 5 reaction System

In the embodiment, the RT-PCR result is stable, the expression level of the 5-HTR7 gene in the liver fluke cyst-removal group is about 3.2 times of the expression level of the control group (see figure 1), the results prove that the 5-HTR7 gene obtained by high-throughput transcriptome expression data analysis is highly expressed in the liver fluke cyst-removal process, and the 5-HTR7 gene is proved to be involved in the cyst-removal process at the transcription level.

Therefore, the 5-HTR7 gene and the expression product thereof can be used as targets for preparing products for resisting the liver fluke infection, not only opens up new application fields of the 5-HTR7 gene and the expression product thereof, but also opens up new products for resisting the liver fluke infection, and has wide application space.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Sequence listing

<110> Guilin medical college

Application of <120> 5-HTR7 gene and expression product thereof as target in preparation of anti-liver fluke infection product

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1593

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgatttctg ccgccattat tattttgttt cagtccattg tatcattagg ggcggataaa 60

ctgataacag ttatttcgga tggtgaaccg gatcaattca ttcgcagtca cccaattgac 120

cgtatgcgac ggctatatgc taccgaaaac catcacaaca ttggacacgg caacattaca 180

catgacatga ccgcgtactc tccggcgatc tctgctattc tgtcaattat tttaccatca 240

atcgcggtgg caacaatagg cggaaatttt ctcgtgattt tggcagttac cttggtgaaa 300

aagttgcaaa ccccaagcaa cattctcatt gttagtttgg catttagcga tttctttgtc 360

ggtttactgg tattaccctt cgccattctt gatctcttga aaggatactg gccatttaat 420

gaaccgctct gtgatatgta catctcattt gatgtacttt tgtgtaccgc gtctattttg 480

aacttatgtg caatctccat tgaccgatat ttagtgataa ccagaccact gacctatgtg 540

agcaaaagga ctccgtgtcg catggcacag atgattgctg ccacatggat tatttcagct 600

ctcatctgca ttccaccaaa tattgggtgg aagtccccct ttcaagaagg cagatgtgaa 660

tacagtgagg atgtcggcta tcaaatctat gccacgtttt gtgcatttta ccttccgcta 720

ctagtcatgc tcgtcttgta tgggaaaatt ttcaaactag ccagagaaat gtctcgtaat 780

gagcaacggc agatgatgcc ttgcacgcaa aataatctac agcatcagac atcgcagacg 840

gcagatgacc cgaataattt gaattcacga acctgtttgc ctagacaagt cgaatctcct 900

tcagaaaagt gcgataacga tgcattcgtg aatagtgttc ctagtggccc tattccggga 960

ccggtcgaca caacgggtcc acatccactg acaaacggca agtcagagga agatacaatt 1020

cgacggcaaa cggcaaacac agtgaccttt tctgaagatg aatctcgtac aagaacgtca 1080

ttttggaaac ctccttctaa cccggattta gttcggagaa ggtccaagaa cagctcggaa 1140

accaaagtta ttaagacact aggaattata atgggatgct tttgtctctg ttggctacca 1200

tttttcatgg ttcagctctt acttgctcta ctgaaagctg gtaaggtgaa aacagacggg 1260

ctcgttccaa aagcttgctt ccaatttctt caatggctgg gttatatcaa cagctctctg 1320

aacccactga tctacgcgaa attcaaccaa gaattccgtt tgccgttcaa attaattttg 1380

ctgtgtcact gccgaaatat caatgcccgg ttgcgctcag ccgcattcag tgctcaatat 1440

ggtctgtcgt cgtctggaag tcgtcgatca aattctgttc ttctctctgt atctacacgc 1500

gcagatcgta gttctcgaat agattcgggt agacgccgac ctccttccca accgcacata 1560

gtacattctg gtgcttcgac ctttggtaac tga 1593

<210> 2

<211> 530

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Ile Ser Ala Ala Ile Ile Ile Leu Phe Gln Ser Ile Val Ser Leu

1 5 10 15

Gly Ala Asp Lys Leu Ile Thr Val Ile Ser Asp Gly Glu Pro Asp Gln

20 25 30

Phe Ile Arg Ser His Pro Ile Asp Arg Met Arg Arg Leu Tyr Ala Thr

35 40 45

Glu Asn His His Asn Ile Gly His Gly Asn Ile Thr His Asp Met Thr

50 55 60

Ala Tyr Ser Pro Ala Ile Ser Ala Ile Leu Ser Ile Ile Leu Pro Ser

65 70 75 80

Ile Ala Val Ala Thr Ile Gly Gly Asn Phe Leu Val Ile Leu Ala Val

85 90 95

Thr Leu Val Lys Lys Leu Gln Thr Pro Ser Asn Ile Leu Ile Val Ser

100 105 110

Leu Ala Phe Ser Asp Phe Phe Val Gly Leu Leu Val Leu Pro Phe Ala

115 120 125

Ile Leu Asp Leu Leu Lys Gly Tyr Trp Pro Phe Asn Glu Pro Leu Cys

130 135 140

Asp Met Tyr Ile Ser Phe Asp Val Leu Leu Cys Thr Ala Ser Ile Leu

145 150 155 160

Asn Leu Cys Ala Ile Ser Ile Asp Arg Tyr Leu Val Ile Thr Arg Pro

165 170 175

Leu Thr Tyr Val Ser Lys Arg Thr Pro Cys Arg Met Ala Gln Met Ile

180 185 190

Ala Ala Thr Trp Ile Ile Ser Ala Leu Ile Cys Ile Pro Pro Asn Ile

195 200 205

Gly Trp Lys Ser Pro Phe Gln Glu Gly Arg Cys Glu Tyr Ser Glu Asp

210 215 220

Val Gly Tyr Gln Ile Tyr Ala Thr Phe Cys Ala Phe Tyr Leu Pro Leu

225 230 235 240

Leu Val Met Leu Val Leu Tyr Gly Lys Ile Phe Lys Leu Ala Arg Glu

245 250 255

Met Ser Arg Asn Glu Gln Arg Gln Met Met Pro Cys Thr Gln Asn Asn

260 265 270

Leu Gln His Gln Thr Ser Gln Thr Ala Asp Asp Pro Asn Asn Leu Asn

275 280 285

Ser Arg Thr Cys Leu Pro Arg Gln Val Glu Ser Pro Ser Glu Lys Cys

290 295 300

Asp Asn Asp Ala Phe Val Asn Ser Val Pro Ser Gly Pro Ile Pro Gly

305 310 315 320

Pro Val Asp Thr Thr Gly Pro His Pro Leu Thr Asn Gly Lys Ser Glu

325 330 335

Glu Asp Thr Ile Arg Arg Gln Thr Ala Asn Thr Val Thr Phe Ser Glu

340 345 350

Asp Glu Ser Arg Thr Arg Thr Ser Phe Trp Lys Pro Pro Ser Asn Pro

355 360 365

Asp Leu Val Arg Arg Arg Ser Lys Asn Ser Ser Glu Thr Lys Val Ile

370 375 380

Lys Thr Leu Gly Ile Ile Met Gly Cys Phe Cys Leu Cys Trp Leu Pro

385 390 395 400

Phe Phe Met Val Gln Leu Leu Leu Ala Leu Leu Lys Ala Gly Lys Val

405 410 415

Lys Thr Asp Gly Leu Val Pro Lys Ala Cys Phe Gln Phe Leu Gln Trp

420 425 430

Leu Gly Tyr Ile Asn Ser Ser Leu Asn Pro Leu Ile Tyr Ala Lys Phe

435 440 445

Asn Gln Glu Phe Arg Leu Pro Phe Lys Leu Ile Leu Leu Cys His Cys

450 455 460

Arg Asn Ile Asn Ala Arg Leu Arg Ser Ala Ala Phe Ser Ala Gln Tyr

465 470 475 480

Gly Leu Ser Ser Ser Gly Ser Arg Arg Ser Asn Ser Val Leu Leu Ser

485 490 495

Val Ser Thr Arg Ala Asp Arg Ser Ser Arg Ile Asp Ser Gly Arg Arg

500 505 510

Arg Pro Pro Ser Gln Pro His Ile Val His Ser Gly Ala Ser Thr Phe

515 520 525

Gly Asn

530

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

acaacattgg acacggcaac 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tattgttgcc accgcgattg 20

<210> 5

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggtgacgctg aagtatccta ttga 24

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ccaaagcata gccctcgtag at 22

Claims

1.5-HTR7 gene and application of expression product thereof as target in preparation of products for resisting liver fluke infection.

2. The use according to claim 1, wherein the nucleotide sequence of the 5-HTR7 gene is shown in SEQ ID No.1 and the amino acid sequence is shown in SEQ ID No. 2.

3. The use of claim 1, wherein the product is any one of a product for diagnosing liver fluke infection by RT-PCR, a product for detecting liver fluke infection by real-time quantitative PCR, a product for diagnosing liver fluke infection by immunodetection, a product for diagnosing liver fluke infection by in situ hybridization, a product for diagnosing liver fluke infection by a chip, and a product for detecting liver fluke infection by a high throughput sequencing platform.

4. The use of claim 3, wherein the RT-PCR product for diagnosing liver fluke infection comprises at least one pair of primers for specifically amplifying the 5-HTR7 gene, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID No.3, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 4.

5. The use of claim 3, wherein the real-time quantitative PCR product for detecting liver fluke infection comprises at least one pair of primers for specifically amplifying the 5-HTR7 gene, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 4.

6. The use of claim 3, wherein the product for the immunodetection diagnosis of liver fluke infection comprises an antibody that specifically binds to 5-HTR7 protein.

7. The use of claim 3, wherein the product for the diagnosis of liver fluke infection by in situ hybridization comprises a probe that hybridizes to the nucleic acid sequence of the 5-HTR7 gene.

8. The use of claim 3, wherein the products for diagnosing liver fluke infection by the chip comprise a protein chip and a gene chip; wherein the protein chip comprises an antibody which is specifically combined with the 5-HTR7 protein, and the gene chip comprises a probe which is hybridized with the nucleic acid sequence of the 5-HTR7 gene.