CN112029829B

CN112029829B - Nucleic acid isothermal amplification method based on hairpin structure and kit application thereof

Info

Publication number: CN112029829B
Application number: CN201910665757.5A
Authority: CN
Inventors: 徐高连; 祁小飞; 侯建华; 单洪波
Original assignee: Nanjing Dabbocote Biotechnology Co ltd
Current assignee: Nanjing Dabbocote Biotechnology Co ltd
Priority date: 2019-07-23
Filing date: 2019-07-23
Publication date: 2023-11-28
Anticipated expiration: 2039-07-23
Also published as: CN112029829A

Abstract

The invention relates to a design of a related specific primer, which enables the primer to form a hairpin structure with special purpose when amplifying a target nucleic acid sequence under a constant temperature condition, and the hairpin structure mediates subsequent exponential amplification, thereby achieving the purpose of high-efficiency and high-sensitivity detection of target molecules. Meanwhile, the invention also relates to application of the kit in rapid nucleic acid diagnosis, including application of the kit in detection of pathogenic microorganisms such as bacteria and viruses.

Description

Nucleic acid isothermal amplification method based on hairpin structure and kit application thereof

Technical Field

The invention relates to a nucleic acid molecular biology detection method in the field of biotechnology, in particular to a hairpin structure-based nucleic acid isothermal amplification method and a kit application thereof.

Background

The research on the global epidemic trend shows that the conventional pathogenic bacteria detection means, such as bacterial culture, morphological detection, biochemical identification and the like, cannot effectively meet the requirements of rapid and specific field detection of pathogenic microorganisms due to the defects of low sensitivity, poor specificity, complicated steps, dependence on instruments and equipment and the like. The rapid development of molecular biology technology, especially nucleic acid amplification technology, greatly improves the detection level of pathogenic bacteria, thus having good control and prevention effects on the transmission and treatment of infectious diseases. Meanwhile, the nucleic acid amplification technology can be directly used for detecting clinical specimens on the basis of not separating and culturing pathogenic microorganisms, and can obtain results in a short time (2-3 hours), so that the nucleic acid amplification technology is widely applied to diagnosis of infectious diseases. These molecular detection techniques, in combination with other molecular biological techniques and bioinformatics approaches, are rapidly evolving towards accuracy, rapidity, sensitivity, and automation.

Currently, according to the requirement for the temperature change in the amplification process, nucleic acid amplification detection techniques can be broadly divided into two categories:

1. depending on the cyclic variation of temperature: mainly comprises a Polymerase Chain Reaction (PCR) and a ligase chain reaction (1igase chain reaction,LCR). Each cycle of the PCR/LCR reaction involves denaturation and melting of the target double-stranded molecule, hybridization renaturation of the primer to the target single-stranded molecule, and extension/ligation of the primer under the corresponding enzymatic reaction. Meanwhile, newly synthesized double-stranded DNA fragments can become templates of the next cycle in each cycle, so that the quantity of target sequence DNA can be increased in an exponential amplification mode, and the aim of rapidly enriching target molecules is fulfilled. PCR technology is the most mature nucleic acid amplification technology at present and has been very widely used and developed. However, PCR technology requires specialized equipment to support cyclic reciprocation of temperature, and often requires a corresponding fluorescence detection system for the purpose of solving contamination of amplified products and achieving real-time detection, but this increases costs and increases the demands of experimental operators. These drawbacks limit their popularization and application in field detection events and primary community hospitals.

2. Nucleic acid isothermal amplification system: the system means that the denaturation, renaturation and extension between the nucleic acid target molecule and the primer in the nucleic acid amplification process can be carried out under the condition of constant temperature, and the physical process of heating and cooling is not needed. Currently, more common techniques such as strand displacement amplification (strand displacement amplification, SDA), nucleic acid sequence amplification (Nucleic Acid Sequence Based Amplification, NASBA), transcriptase amplification (Transcription Mediated Amplification, TMA), rolling circle amplification (Rolling Circle Amplification, RCA), loop isothermal amplification (Loop-Mediated Isothermal Amplification, LAMP), melting enzyme amplification (Helicase Dependent Amplification, HDA), and cross primer amplification (Cross Priming Amplification, CPA) are used. Compared with the PCR technology, the nucleic acid isothermal amplification technology has the characteristics of high specificity and high sensitivity, and has the advantages of simple operation and low requirements on instruments and equipment, and the amplification reaction can be effectively realized by one water bath kettle and even a simple vacuum cup. The nucleic acid isothermal amplification technology can be combined with different detection technologies, and related amplification products can be detected and judged rapidly and effectively by naked eyes directly, special instruments and equipment are not needed, for example, a certain amount of calcein is added into the reaction, and whether LAMP is performed or not can be judged by naked eyes through observing whether the color of a reaction page is changed or not. The nucleic acid isothermal amplification system is simple, convenient and quick, so that the nucleic acid isothermal amplification system is suitable for on-site detection and popularization and application in basic medical institutions.

Nucleic acid isothermal amplification techniques can be broadly divided into single enzyme systems (e.g., LAMP and CPA) and multiple enzyme systems (e.g., RCA, TMA, HAD, etc.) depending on the number of enzymes involved. LAMP is the most widely used single-enzyme isothermal amplification system at present, and the amplification system mainly comprises Bst large-fragment DNA polymerase, two pairs of special inner primers (FIP consists of F1C and F2; BIP consists of BIC and B2) and a pair of outer primers (F3 and B3). The F2 sequence of the FIP primer pairs with the complementary sequence on the target DNA, initiating a circular strand displacement reaction. The F3 primer is complementary to the F3C region on the template, causing synthesis of a double strand complementary to the template DNA, thereby squeezing out the DNA single strand caused by FIP. At the same time, the BIP primer hybridizes to the single strand that is squeezed out, the loop structure formed is opened, and then the B3 primer base pairs outside the BIP, forming a new complementary strand under the action of the polymerase. Complementary sequences exist at both ends of the single-stranded DNA to be replaced, so that self base pairing occurs to form a dumbbell-like DNA structure. The LAMP reaction uses this DNA structure as an initial structure, and performs recirculation and extension, and the target DNA sequence is repeatedly generated in a large number of alternations, and the amplification product formed is a cauliflower-shaped stem-loop structure DNA having many loops.

The invention relates to a novel nucleic acid isothermal amplification method, which is characterized in that different primers are designed aiming at 5 different areas on a target gene, and then a hairpin structure with special functions is formed under the action of DNA polymerase with a strand displacement function and an artificial primer, and the structure can mediate the subsequent exponential type nucleic acid amplification process. The amplified products can be directly detected visually by adding specific fluorescent dye into the reaction, or detected in real time on a related instrument (such as a real-time fluorescence PCR instrument), thereby achieving the purposes of quantitative or semi-quantitative detection and analysis.

Disclosure of Invention

Aiming at the defects of time and labor consumption, complicated steps, dependence on instruments and equipment and the like in the field of nucleic acid molecular biology detection in the biotechnology, the invention aims to provide a nucleic acid constant-temperature detection method which is simple to operate and low in price for people, so that an advanced molecular detection means can be effectively popularized and applied widely in field detection events and primary community hospitals.

The nucleic acid isothermal amplification technology based on hairpin structure is a novel isothermal nucleic acid amplification method, and is characterized in that 5 specific primers are designed aiming at 5 regions of a target gene, and a nucleic acid amplification reaction can be completed by utilizing a strand displacement DNA polymerase and an artificial primer to perform heat preservation for tens of minutes under a constant temperature condition (about 62 ℃). The method does not need the processes of thermal denaturation of the template, long-time temperature circulation, complicated electrophoresis and the like, and has the advantages of simplicity, convenience and rapidness and no need of large-scale instruments.

Primer designs involved in hairpin-based nucleic acid isothermal amplification techniques include the following requirements (FIG. 1),

a) Design of inner amplification primers: designing a pair of internal amplification primers, wherein the internal amplification primers refer to one of main single-stranded oligonucleotide sequences participating in a nucleic acid isothermal amplification reaction based on a hairpin structure; the amplified extension sequence of the 3 'end of the forward internal amplification primer is completely complementary to the antisense strand of the target nucleic acid, and the hybridization end sequence of the 5' end of the forward internal amplification primer is a DNA sequence with a hairpin structure, wherein the stem of the hairpin structure is 8-12 bases in length, and the loop of the hairpin structure is 15-25 bases in length; the 3' amplified extension end sequence of the reverse internal amplification primer is completely complementary to the sense strand of the target nucleic acid, while the 5' end is the 3' end sequence of the forward internal amplification primer;

b) Design of artificial primers: the artificial primer is completely identical to the sequence of the 5' end of the forward inward amplification primer, but the primer does not have any hairpin structure;

c) Design of loop primers: designing a loop primer, wherein the loop primer refers to one of main single-stranded oligonucleotide sequences participating in a nucleic acid isothermal amplification reaction based on a hairpin structure; the loop primer is fully complementary to the antisense strand of the target nucleic acid and is located within the amplified fragment of the inner amplification primer;

d) The design of the stripping primer comprises a forward stripping primer and a reverse stripping primer respectively; the forward and reverse split primers are fully complementary to the antisense and sense strands, respectively, of the target gene.

Meanwhile, the amplification process based on the hairpin structure nucleic acid isothermal amplification technology comprises the following amplification steps (fig. 2):

1. forward inner amplification primers and loop primers hybridize to the antisense strand of the target nucleic acid molecule, respectively; then extending under the action of DNA polymerase with strand displacement function;

2. forward stripper primers hybridize to the antisense strand of a target nucleic acid molecule; then extending under the action of DNA polymerase with strand displacement function; stripping two single-stranded products respectively generated by forward inward amplification primer and loop primer extension;

3. the stripped two single-stranded products respectively generated by forward amplification primer and loop primer extension can be used as templates for hybridization/extension of reverse amplification primers;

4. the reverse stripping primer can be hybridized with two single-stranded products generated by the extension of the forward inner amplification primer and the forward outer amplification primer respectively, and then the single-stranded products are extended under the action of DNA polymerase with a strand displacement function; this extension process will produce a single stranded DNA sequence that is fully complementary by the forward and reverse internal amplification primers;

5. the single-stranded DNA containing the complete complementary sequences of the forward internal amplification primer and the reverse internal amplification primer can form two asymmetric hairpin DNA secondary structures at two ends of the single-stranded DNA under the action of molecular thermodynamics due to the complementary sequences in the sequences;

6. the formed asymmetric hairpin secondary structure can be used as an amplified template, and the asymmetric hairpin secondary structure can be repeatedly hybridized and extended with the artificial primer, the inner amplification primer and the loop primer; the formed product can form more single-chain or double-chain products capable of forming a secondary structure; the formed products can be used as templates for amplification to participate in the amplification of the next stage, thereby achieving the purpose of rapidly amplifying target sequences.

In one aspect, the invention also provides a method and kit for rapid detection of a target nucleic acid sequence, comprising the steps of:

(1) Primer design:

a) Design of inner amplification primers: designing a pair of internal amplification primers, wherein the internal amplification primers refer to one of main single-stranded oligonucleotide sequences participating in a nucleic acid isothermal amplification reaction based on a hairpin structure; the amplified extension sequence of the 3 'end of the forward internal amplification primer is completely complementary with the antisense strand of the target nucleic acid, and the hybridization end sequence of the 5' end of the forward internal amplification primer is a DNA sequence with a hairpin structure; the 3' amplified extension end sequence of the reverse internal amplification primer is completely complementary to the sense strand of the target nucleic acid, while the 5' end is the 3' end sequence of the forward internal amplification primer;

c) Design of loop primers: designing a loop primer, wherein the loop primer refers to one of main single-stranded oligonucleotide sequences participating in a hairpin structure-based nucleic acid isothermal amplification reaction; the loop primer is fully complementary to the antisense strand of the target nucleic acid and is located within the amplified fragment of the inner amplification primer;

(2) Amplification step: mixing the designed primer, DNA polymerase with strand displacement function, target nucleic acid sequence and reaction buffer system; placing the evenly mixed liquid at 55-65 ℃ for 30-60 minutes; thus, the target nucleic acid sequence can be rapidly amplified. The amplification process comprises the following characteristics:

2.1. forward inner amplification primers and loop primers hybridize to the antisense strand of the target nucleic acid molecule, respectively; then extending under the action of DNA polymerase with strand displacement function;

2.2. forward stripper primers hybridize to the antisense strand of a target nucleic acid molecule; then extending under the action of DNA polymerase with strand displacement function; stripping two single-stranded products respectively generated by forward inward amplification primer and loop primer extension;

2.3. the stripped two single-stranded products respectively generated by forward amplification primer and loop primer extension can be used as templates for hybridization/extension of reverse amplification primers;

2.4. the reverse stripping primer can be hybridized with two single-stranded products generated by the extension of the forward inner amplification primer and the forward outer amplification primer respectively, and then the single-stranded products are extended under the action of DNA polymerase with a strand displacement function; this extension process will produce a single stranded DNA sequence that is fully complementary by the forward and reverse internal amplification primers;

2.5. the single-stranded DNA containing the complete complementary sequences of the forward internal amplification primer and the reverse internal amplification primer can form two asymmetric hairpin DNA secondary structures at two ends of the single-stranded DNA under the action of molecular thermodynamics due to the complementary sequences in the sequences;

2.6. the formed asymmetric hairpin secondary structure can be used as an amplified template, and the asymmetric hairpin secondary structure can be repeatedly hybridized and extended with the artificial primer, the inner amplification primer and the loop primer; the formed product can form more single-chain or double-chain products capable of forming a secondary structure; the formed products can be used as templates for amplification to participate in the amplification of the next stage, thereby achieving the purpose of rapidly amplifying target sequences.

(3) Detection of amplification products: by adding corresponding fluorescent dye or detection probe in the reaction, the concentration of the target gene in the reaction is continuously increased along with the progress of the reaction, so that the corresponding dye signal is gradually changed or the conformation of the detection probe is correspondingly changed, and the fluorescent signal of the reaction solution is continuously increased.

In another aspect, the invention also provides kits for rapid target nucleic acid sequence detection.

Description of the drawings:

the embodiments are further described below with reference to the accompanying drawings, in which:

FIG. 1 illustrates the positions of the inner amplification primers, the loop amplification primers, the artificial primers and the stripper primers involved.

FIG. 2 illustrates the amplification principle based on the hairpin nucleic acid isothermal amplification technique.

FIG. 3 illustrates the design of the change in reverse internal amplification primer composition.

FIG. 4 illustrates the results of detection of HBV whole genome DNA with a gel imaging system, a hand-held UV light source and an ABI 7500 fluorescence PCR instrument, respectively. (A) The results of the detection of positive control and HBV whole genome DNA respectively using gel imaging system. L is a 100bp ladder;1 is whole genome DNA with concentration of 1000 copies; 3 is a positive control concentration of 1000 copies; 2 and 4 are negative controls, respectively. The results show that there is no significant difference in the strips. (B) And (3) respectively detecting HBV whole genome DNA by using a hand-held purple light source. 1 is whole genome DNA with concentration of 1000 copies; 2 is a negative control. (C) Results of detection of different clinical samples with ABI 7500 fluorescence PCR instrument.

Detailed Description

The invention provides a hairpin structure-based nucleic acid isothermal amplification method, which is characterized by comprising the following steps of:

(1) Primer design:

1.1 design of amplification primers: designing a pair of internal amplification primers, wherein the internal amplification primers refer to one of main single-stranded oligonucleotide sequences participating in a nucleic acid isothermal amplification reaction based on a hairpin structure; the amplified extension sequence of the 3 'end of the forward internal amplification primer is completely complementary with the antisense strand of the target nucleic acid, and the hybridization end sequence of the 5' end of the forward internal amplification primer is a DNA sequence with a hairpin structure; the 3' amplified extension end sequence of the reverse internal amplification primer is completely complementary to the sense strand of the target nucleic acid, while the 5' end is the 3' end sequence of the forward internal amplification primer;

1.2 design of artificial primers: the artificial primer is completely identical to the sequence of the 5' end of the forward inward amplification primer, but the primer does not have any hairpin structure;

1.3 design of Loop primers: designing a loop primer, wherein the loop primer refers to one of main single-stranded oligonucleotide sequences participating in a hairpin structure-based nucleic acid isothermal amplification reaction; the loop primer is fully complementary to the antisense strand of the target nucleic acid and is located within the amplified fragment of the inner amplification primer;

1.4 design of stripping primers, respectively comprising forward stripping primers and reverse stripping primers; the forward and reverse split primers are fully complementary to the antisense and sense strands, respectively, of the target gene.

(2) Amplification step: mixing the designed primer, DNA polymerase with strand displacement function, target nucleic acid sequence and reaction buffer system; placing the evenly mixed liquid at 55-65 ℃ for 30-60 minutes; thus, the target nucleic acid sequence can be rapidly amplified. The amplification process based on the hairpin structure nucleic acid isothermal amplification method comprises the following characteristics:

In another alternative embodiment, the present invention may select only the inner amplification primer, the artificial primer and the loop primer and then extend under the action of a DNA polymerase having a strand displacement function; this extension process will form single stranded DNA with an asymmetric hairpin structure; the secondary structure can be used as a template to participate in subsequent reactions, thereby achieving the purpose of amplifying target sequences.

In another alternative embodiment, the invention may be extended and amplified in the absence of reverse-stripping external amplification primers, followed by a strand displacement-capable DNA polymerase; this extension process will form single stranded DNA with an asymmetric hairpin structure; the asymmetric hairpin structure can be used as a template to participate in subsequent reactions, thereby achieving the purpose of amplifying target sequences.

In another alternative embodiment, the invention may alter the reverse internal amplification primer composition. The amplified extension end sequence 3 'of the reverse internal amplification primer is fully complementary to the sense strand of the target nucleic acid, while its hybridization end sequence 5' is fully identical to the forward target sequence, but downstream of the hybridization binding region of the forward internal amplification primer to the target molecule (FIG. 3);

in another alternative embodiment, the invention provides for the purpose and method of amplifying a target nucleic acid sequence based on spontaneous formation of an amplification product having an asymmetric hairpin structure. The method is characterized in that a single-chain or double-chain product with an asymmetric hairpin structure can be spontaneously formed in the amplification process; the single-chain or double-chain products can be folded by themselves under the action of molecular thermodynamics, so that a secondary structure is formed and the hybridization binding site of the primer is exposed; this allows for easy and rapid binding of the primer to the secondary structure; once the primer is combined with the secondary structure, a new amplification product can be formed under the action of DNA polymerase with a strand displacement function; the amplification products can be folded under the action of molecular thermodynamics, so that a new secondary structure is formed to participate in the subsequent amplification process; the purpose of rapid amplification of the target nucleic acid sequence can be achieved by the repeated amplification.

According to an alternative embodiment of the present invention, the DNA polymerase described in the hairpin structure-based nucleic acid isothermal amplification technology is selected from the group consisting of commercially available Bst DNA polymerase, klenow DNA polymerase, vent DNA polymerase, phi 29DNA polymerase or Gst DNA polymerase.

According to an alternative embodiment of the present invention, the DNA polymerase described in the hairpin structure-based nucleic acid isothermal amplification technology is selected from one or more of Bst DNA polymerase, klenow DNA polymerase or Gst DNA polymerase, which are already commercially available; more preferably, the DNA polymerase described in the hairpin structure-based nucleic acid isothermal amplification technology is selected from one or more of the commercially available Bst DNA polymerases or Gst DNA polymerases. .

According to an alternative embodiment of the invention, the fluorescent dye described in the hairpin-based nucleic acid isothermal amplification technology is selected from one or more of the EVA GREEN, SYBR GREEN 1, calcein or hydroxynaphthol blue already commercially available; preferably, the fluorescent dye in the hairpin structure-based nucleic acid isothermal amplification technology is selected from one or more of EVA GREEN or calcein which are sold on the market; further preferably, the fluorescent dye described in the hairpin-based nucleic acid isothermal amplification technology is selected from the group of commercially available EVA GREENs.

The invention has the outstanding effect that the DNA polymerase with the strand displacement function is used for being placed for 30-60 minutes under the constant temperature condition (63 ℃), and the amplification of the target nucleic acid sequence can be completed. Therefore, the whole amplification can be completed by only one simple constant temperature device, the requirement on instruments is greatly reduced, and the amplification reaction can be effectively realized even by a simple vacuum cup. Meanwhile, if the corresponding fluorescent dye is added in the reaction, the corresponding amplification curve can be obtained through a fluorescence counter or the amplification reaction result can be directly judged through naked eyes. These advantages allow for a rapid and easy overall detection of amplification of the target nucleic acid sequence, and the detection of the results thereof without the need for the reaction tube to be opened and the cumbersome electrophoresis detection procedure involved. The invention has the characteristics of high specificity, simple operation, low requirements on instruments and equipment and the like, can obtain a very wide application prospect, and is particularly suitable for on-site detection and popularization and use in basic medical units, such as:

1. molecular diagnosis of human genetic diseases directly related thereto;

2. detection of pathogenic microorganisms;

3. diagnosis and prognosis of tumor cancer;

4. typing of certain microorganisms.

In another embodiment, the invention provides the use of a kit for amplifying a target nucleic acid sequence in the detection of a pathogenic microorganism, an environmental microorganism or a microbial typing.

In another embodiment, the invention provides the use of a kit for amplifying a target nucleic acid sequence in the detection of a pathogen of infectious disease in humans, animals or plants.

In another embodiment, the invention provides the use of a kit for amplifying a target nucleic acid sequence for detecting infectious disease pathogens in food products or biological weapons.

In the description of the invention, the technical terms used have the following meanings:

the primers involved are single stranded oligonucleotide sequences that are synthesized artificially.

The stripping primer refers to a short-chain single-stranded oligonucleotide sequence positioned behind the amplification primer, and the stripping primer is used for stripping the product extended by the amplification primer from the template under the action of DNA polymerase with a strand displacement function.

An internal amplification primer refers to one of the major single stranded oligonucleotide sequences involved in a hairpin-based isothermal amplification reaction of nucleic acids; the amplified extension sequence of the 3 'end of the forward internal amplification primer is completely complementary with the antisense strand of the target nucleic acid, and the hybridization end sequence of the 5' end of the forward internal amplification primer is a DNA sequence with a hairpin structure; the 3' amplified extension end sequence of the reverse internal amplification primer is completely complementary to the sense strand of the target nucleic acid, while the 5' end is the 3' end sequence of the forward internal amplification primer;

the artificial primer is completely identical to the sequence of the 5' end of the forward inward amplification primer, but the primer does not have any hairpin structure;

a loop primer refers to one of the major single stranded oligonucleotide sequences involved in hairpin-based nucleic acid isothermal amplification reactions; the loop primer is fully complementary to the antisense strand of the target nucleic acid and is located within the amplified fragment of the internal amplification primer.

Example 1 hepatitis B Virus detection kit

The pathogen of viral hepatitis B is hepatitis B virus, abbreviated as HBV, and the hepatitis B virus is DNA virus. The genome is double-stranded, circular, incompletely closed DNA. The outermost layer of the virus is the outer membrane or envelope (envelope) of the virus, the inner layer of which is the core, the core antigen (HBcAg), and which cannot be detected in serum. Viral hepatitis b is an infectious disease caused by HBV and mainly caused by liver lesions. Clinically, it is mainly manifested by anorexia, nausea, epigastric discomfort, pain in liver region and hypodynamia. Some patients may have jaundice fever and liver large with liver function impairment. Some patients may become chronicized, even develop cirrhosis, and a few may develop liver cancer. HBV is an infectious disease seriously harming human health, is a serious problem impeding national economic and social development, is one of important diseases controlled by China, and is also a public health problem and a social problem which are concerned globally.

In recent years, the fluorescent quantitative PCR (Fluorescence QuantitativePCR, FQ-PCR) technology for HBV has been developed, and has wide application in the HBV gene detection level due to the advantages of high sensitivity, high speed, strong specificity and the like, and is the main method for HBV virus detection at present. FQ-PCR has the advantage of being simple, fast and sensitive, but requires expensive instrumentation for its detection.

The kit can effectively amplify the target sequence within 1 hour under the constant temperature condition without the need of three stages of denaturation, renaturation and extension of PCR, and has the advantages of no need of special equipment, shorter detection time and higher sensitivity. The kit comprises the following components:

DNA extraction reagent;

2. target nucleic acid sequence amplification detection reaction solution: three strip primers, two outer and two inner amplification primers, 10 Xthermol buffer, mgSO4 (6. Mu. Mol), dNTPs solution (0.4. Mu. Mol), bst DNA polymerase 2.0 (8 units) and sterile double distilled water.

Wherein the specific sequence composition of the primer is as follows:

forward internal amplification primer:

tgctaaccacagccaggttaggtgctcggtggttagcacctgctgctatgcctcatcttc

reverse internal amplification primer:

cctgctgctatgcctcatcttcgacaaacgggcaacatacctt

loop primer:

ttggttcttctggactacc

and (3) artificial primer:

tgctaaccacagccaggttaggtgctcg

universal stripping primer: gctatacaatccctggg

Forward stripping primer: acagcccgtcccgccgat

Reverse peel primer: ggtggttgatgttcctgga

The concentration of the components of the reaction system are respectively as follows:

composition of 10×thermo buffer: 20mM Tris-HCl (pH 8.8), 10mM KCl,10mM (NH 4) 2SO4,2mM MgSO4,0.1%Triton X-100.

All primers and probes were synthesized by Shanghai Biotechnology Co.

Positive control: HBV whole genome fragment.

The reaction solution containing the reaction components was placed on an ABI 7500 fluorescent PCR instrument for 60 minutes at a reaction temperature of 63 ℃, and then fluorescent signals generated by the reaction were recorded every minute to obtain a corresponding amplification curve (fig. 4C).

Example 2 HBV amplification product detection

In the reaction system of example 1, eva Green was replaced with calcein and other reaction conditions were maintained unchanged, and then isothermal amplification products were detected using a hand-held violet light source and a gel electrophoresis system, respectively. The results of the detection are shown in FIG. 4B.

The foregoing examples illustrate only a few embodiments of the invention and are described in detail herein without thereby limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.

Claims

1. A hairpin-based isothermal amplification method for non-disease diagnosis and treatment purposes, comprising the steps of:

1) Primer design: designing a pair of internal amplification primers, a loop primer, an artificial primer and two stripping primers; wherein, the primer design comprises the following steps:

a) Design of inner amplification primers: designing a pair of internal amplification primers, wherein the internal amplification primers areFinger participationThe main nucleic acid isothermal amplification reaction based on hairpin structureOne of the single stranded oligonucleotide sequences; forward internal amplification primersThe amplified extension sequence at the 3 'end is fully complementary to the antisense strand of the target nucleic acid, while the hybridization end sequence at the 5' end is a DNA sequence with a hairpin structure; reverse-rotationInwardly amplifying the primersThe amplified extension end sequence of the 3' end is completely complementary to the sense strand of the target nucleic acid, while the 5' end is the amplified extension sequence of the 3' end of the forward inward amplification primer;

b) Design of artificial primers: artificial primersForward internal amplification primersThe 5' end sequence is identical, but the primer does not have any hairpin structure;

c) Design of loop primers: designing a loop primer, wherein the loop primer isFinger participationThe main nucleic acid isothermal amplification reaction based on hairpin structureOne of the single stranded oligonucleotide sequences; loop primerThe antisense strand of the targeting nucleic acid is fully complementary, which is located within the amplified fragment of the inner amplification primer;

d) The design of the stripping primer comprises a forward stripping primer and a reverse stripping primer, wherein the forward stripping primer and the reverse stripping primer are respectively and completely complementary with an antisense strand and a sense strand of a target gene, and the stripping primer refers to a short-chain single-stranded oligonucleotide sequence positioned behind an amplification primer and is used for stripping a product extended by the amplification primer from a template under the action of DNA polymerase with a strand displacement function;

2) Amplification process: when the target nucleic acid sequence is amplified, different types of amplification products can be generated between the inner amplification primer/inner amplification primer, the inner amplification primer/loop primer and the inner amplification primer/artificial primer under the action of DNA polymerase with a strand displacement function, and the amplification products form an asymmetric hairpin type DNA secondary structure due to self-hybridization recombination in molecules; the amplification products with asymmetric hairpin DNA secondary structures are used as templates for subsequent amplification reaction, and amplified in a linear structure or secondary structure mode under the action of DNA polymerase with a strand displacement function and an inner amplification primer/artificial primer/loop primer, so that the aim of amplifying a target nucleic acid sequence is fulfilled;

3) Detection of amplification products: by adding a dye or probe to the reaction, the concentration of the targeted gene in the reaction is increased continuously as the reaction proceeds, resulting in a gradual change in the fluorescent signal in the solution or in a change in the color of the solution.

2. The hairpin nucleic acid-based isothermal amplification method for non-disease diagnosis and treatment according to claim 1, wherein: the amplification process comprises the following steps:

a) Forward inner amplification primers and loop primers hybridize to the antisense strand of the target nucleic acid molecule, respectively; then extending under the action of DNA polymerase with strand displacement function;

b) Forward stripper primers hybridize to the antisense strand of a target nucleic acid molecule; then extending under the action of DNA polymerase with strand displacement function; stripping two single-stranded products respectively generated by forward inward amplification primer and loop primer extension;

c) The stripped two single-stranded products respectively generated by forward amplification primer and loop primer extension are used as templates for hybridization/extension of reverse amplification primers; d) The reverse internal amplification primer hybridizes with two single-stranded products generated by the forward internal amplification primer and the loop primer extension respectively, and then extends under the action of DNA polymerase with a strand displacement function; this extension process will produce a single stranded DNA sequence comprising a complete complement of the forward amplification primer and a sequence identical to the reverse amplification primer;

e) The sequence of the single-stranded DNA which comprises the complete complementary sequence of the forward internal amplification primer and the sequence of the reverse internal amplification primer forms two asymmetric hairpin DNA secondary structures at two ends under the action of molecular thermodynamics due to the complementary sequence in the sequence;

f) The formed asymmetric hairpin secondary structure is used as an amplified template, and the asymmetric hairpin secondary structure is repeatedly hybridized and extended with the artificial primer, the inner amplification primer and the loop primer; the formed product forms more single-chain or double-chain products capable of forming a secondary structure; the formed products are used as templates for amplification to participate in the amplification of the next stage, so that the aim of rapidly amplifying target sequences can be fulfilled.

3. The hairpin nucleic acid-based isothermal amplification method according to any one of claims 1 or 2, characterized in that: the secondary structure can fold itself under the action of molecular thermodynamics, and then an asymmetric hairpin structure is formed on one single chain.

4. The method for isothermal amplification of nucleic acids based on hairpin structures for non-disease diagnosis and treatment according to claim 1, wherein the DNA polymerase is selected from one or more of Bst DNA polymerase, klenow DNA polymerase, vent DNA polymerase, phi 29DNA polymerase or Gst DNA polymerase.