CN112011630A - Primer group, kit and detection method for detecting escherichia coli and salmonella in medicine - Google Patents

Primer group, kit and detection method for detecting escherichia coli and salmonella in medicine Download PDF

Info

Publication number
CN112011630A
CN112011630A CN202010819796.9A CN202010819796A CN112011630A CN 112011630 A CN112011630 A CN 112011630A CN 202010819796 A CN202010819796 A CN 202010819796A CN 112011630 A CN112011630 A CN 112011630A
Authority
CN
China
Prior art keywords
salmonella
escherichia coli
primer
detection
pcr reaction
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202010819796.9A
Other languages
Chinese (zh)
Inventor
马广强
牛玲
黄旭春
曾传平
韩飞
黄小英
杨明
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangxi University of Traditional Chinese Medicine
Original Assignee
Jiangxi University of Traditional Chinese Medicine
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangxi University of Traditional Chinese Medicine filed Critical Jiangxi University of Traditional Chinese Medicine
Priority to CN202010819796.9A priority Critical patent/CN112011630A/en
Publication of CN112011630A publication Critical patent/CN112011630A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to the technical field of specific detection of escherichia coli and salmonella in a medicament, and provides a primer group, a kit and a detection method for detecting escherichia coli and salmonella in a medicament. The primer set included uidA, invA and 16 SrDNA. The primer group can be used for detecting beta-glucosidase genes, invader A genes of salmonella and genes of 16SrRNA subunits of escherichia coli in the medicine through multiple PCR, and whether the medicine contains bacteria such as escherichia coli, salmonella and the like is detected through detecting whether the medicine contains the beta-glucosidase genes, the invader A genes and the genes of 16SrRNA subunits.

Description

Primer group, kit and detection method for detecting escherichia coli and salmonella in medicine
Technical Field
The invention relates to the technical field of bacteria detection, in particular to a primer group, a kit and a detection method for detecting escherichia coli and salmonella in a medicament.
Background
Along with the continuous improvement of the life of the substance, the requirements of people on the aspect of sanitation are also increased day by day, and particularly, the sanitary safety of the medicine has higher standards; the existence and the content of escherichia coli and salmonella in the medicine are important indexes for judging whether the medicine is safe or not, and the traditional detection method for detecting bacteria is long in time, high in consumption and relatively complex in operation.
The identification and authentication of escherichia coli and salmonella in the medicine are indispensable items for checking the products of pharmaceutical enterprises, and the medicines can be generally checked in drug checking departments of various provinces, and the medicines can be marketed and circulated after the checks are passed. The traditional detection method is to utilize a selective culture medium for enrichment culture and then identify whether bacteria exist or not by using an identification culture medium; the time required in the whole process is as long as about one week, and the method has the defects of low detection efficiency, single detection target, low sensitivity, long time consumption, complex operation and the like, and is expensive, and needs 5 ten thousand per 3 batches.
Disclosure of Invention
Aiming at the defects, the invention provides the primer group, the kit and the detection method for detecting escherichia coli and salmonella in the medicine, can carry out multiple PCR in the same reaction system, has the characteristics of high detection speed, high sensitivity, good specificity and the like, can make up the defects of the existing detection technology, and achieves the purpose of comprehensively, quickly and efficiently detecting and screening the bacteria such as escherichia coli, salmonella and the like in the medicine.
The technical scheme adopted by the invention is as follows:
a primer group for detecting escherichia coli or salmonella in a medicament comprises one or more of the following primer pairs 1-3,
primer set 1 (primer set for amplification of β -glucosidase gene):
TTGGGACTTTGCCTTAGC (named uidA-F3),
TACGAGCCAGGATAGTCTTT (named uidA-F4);
primer set 2 (primer set for invader A gene amplification):
ATTTGACCTGGTGCCACTGT (named invA-p1),
GTAACCACTACCAGAACAGC (named invA-p 2);
primer set 3 (primer set for 16SrDNA amplification):
GACTCGGTCCTAGTTTGAGA (designated as F27),
CCCAGAACATGTGTGGC (named L1401).
The invention also provides a kit for detecting escherichia coli or salmonella in a medicament, and the kit comprises the primer group for detecting escherichia coli and salmonella in the medicament.
Further, the kit further comprises: taq enzyme, dNTP, GelGreen DNA nucleic acid dye, 2000bp Marker and PCR reaction buffer solution.
Further, the PCR reaction buffer contained 100mM Tris-HCl buffer (pH 8.3), 15mM Mg2+, and 500mM KCl.
The invention also provides a method for detecting escherichia coli or salmonella in a medicament, which comprises the following steps:
(1) a pretreatment step of obtaining template DNA from a drug to be detected;
(2) establishing a PCR reaction system based on the kit, and then performing multiple PCR amplification reaction on the template DNA by adopting the PCR reaction system to obtain an amplification product;
(3) and carrying out electrophoresis detection on the amplification product to obtain a detection result, and analyzing the electrophoresis result to judge the existence and the content of escherichia coli and salmonella in the medicament.
Furthermore, the concentration of Taq enzyme in the PCR reaction system is 0.025-0.15U/. mu.L.
Further, the primer group in the PCR reaction system comprises a primer pair 1, a primer pair 2 and a primer pair 3, and the concentration ratio of the three primer pairs is 1:1: 1.
Further, the concentration of each primer in the primer set used in the system of the PCR reaction was 2. mu. mol/L.
The invention also provides an application of the kit in detection of Escherichia coli or salmonella in a medicament.
Through the PCR in vitro amplification method, the bacteria can specifically amplify DNA fragments in vitro under the catalysis of base complementary pairing of specific primers and Taq enzyme. Coli uidA (beta-glucosidase gene) is a gene which catalyzes terminal non-reducing beta-glucose residue to hydrolyze and release beta-glucosidase, and the gene is an important marker gene for identifying escherichia coli by PCR; salmonella inv A (invasin A gene) is a gene sequence unique to Salmonella and can therefore be used to identify Salmonella; 16SrDNA is a gene of a 16SrRNA subunit of ribosomal RNA, a plurality of sections of the 16SrDNA of bacteria are conserved, and a universal bacterial primer can be designed according to the conserved regions, so that 16SrDNA fragments of all bacteria can be amplified; and the primers are only specific to the bacteria, namely the primers are not complementary with non-bacterial DNA, so that the gene can be used for PCR identification of the bacteria.
The invention has the beneficial effects that:
according to the invention, specific primers of beta-glucosidase gene of escherichia coli, invader protein A gene of salmonella and gene of 16SrRNA subunit are designed, and primer pairs with appropriate length difference of corresponding PCR products are combined, so that the quick detection of bacteria such as escherichia coli, salmonella and the like in the medicine based on the multiplex PCR technology is realized, and the screening of bacteria such as escherichia coli, salmonella and the like can be completed only by carrying out 1 group of PCR reaction on each medicine sample. Compared with the traditional detection method, the detection efficiency is improved by about 40 times, and on one hand, the detection time can be shortened; on the other hand, the detection cost can be saved; the kit has the advantages of simple and convenient operation, low cost, high efficiency, sensitivity and the like, and can be used for comprehensive screening and detection of escherichia coli, salmonella and the like in various medicaments.
Drawings
FIG. 1 is a diagram showing the results of PCR amplification by the multiplex PCR system in example 1.
FIG. 2 is a schematic diagram showing the PCR amplification result of the specific detection in the multiplex PCR reaction system in example 2.
FIG. 3 is a schematic diagram showing the results of PCR amplification in the sensitivity detection of the multiplex PCR reaction in example 3.
FIG. 4 is a schematic diagram showing the PCR amplification results of the detection of commercially available drugs by multiplex PCR in example 4.
FIG. 5 is a diagram showing the results of PCR amplification in example 5 by multiplex PCR detection of a drug not detected by the drug test.
Detailed Description
In order that the above objects, features and advantages of the present invention can be more clearly understood, a more particular description of the invention will be rendered by reference to the appended drawings. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, however, the present invention may be practiced in other ways than those specifically described herein, and thus the present invention is not limited to the specific embodiments disclosed below.
Example 1: establishment of multiplex PCR reaction System
The primer group for detecting bacteria such as escherichia coli or salmonella in the medicine provided by the embodiment comprises: primer pair 1, primer pair 2, and primer pair 3. The primer pair 1 comprises uidA-F3 and uidA-F4, can amplify beta-glucosidase gene of escherichia coli, and has a fragment size of 194 bp; the primer pair 2 comprises invA-p1 and invA-p2, and can amplify an invader protein A gene of salmonella, and the fragment size is 362 bp; primer pair 3 comprises F27 and L1401, and can amplify the gene of bacterial 16SrRNA subunit with 1374bp size. The primer sequences are shown in Table 1.
Table 1: primer sequence (Table 1Primer sequence)
Figure BDA0002634037150000041
The 3 primer pairs of the primer group can carry out triple PCR in the same PCR reaction system, detect beta-glucosidase gene of escherichia coli, invader protein A gene of salmonella and gene of 16SrRNA subunit, and judge or screen whether the establishment of the multiple PCR system has the capability of detecting bacteria such as escherichia coli, salmonella and the like in the medicine or not according to the detection result.
After multiple single PCR amplifications, selecting a stable and separated multiple PCR reaction system, optimizing reaction parameters, and finally determining that the total volume of the multiple PCR reaction is 20ul, wherein 2 XM 5 Tap HiFi PCR Mix10 ul, 2 ul of each of 3 primers and 1 ul of each bacterial solution, and then using double distilled water (ddH)2O) to 20. mu.L.
The specific steps of using the primer group to carry out triple PCR detection are as follows:
(1) preparing a PCR reaction system: the PCR reaction system consisted of 2. mu.L of primer pair 1 (concentration 1. mu. mol/L), 2. mu.L of primer pair 2 (concentration 1. mu. mol/L), 2. mu.L of primer pair 3 (concentration 1. mu. mol/L), 10. mu.L of 2 XM 5 Tap HiFi PCR Mix, 1. mu.L of E.coli broth (100000CFU/mL), 1. mu.L of Salmonella broth (100000CFU/mL) and 2. mu.L of ddH2O composition;
(2) the PCR amplification reaction program comprises: pre-denaturation at 95 ℃ for 4 min; denaturation at 95 ℃ for 30s, annealing at 59 ℃ for 1min, extension at 72 ℃ for 1min for 30s, for 35 cycles; further extension for 10min at 72 ℃;
(3) after the PCR reaction is finished, gel electrophoresis is carried out, and the position of the size of the band is analyzed or the electrophoresis result is obtained.
The results are shown in FIG. 1, where: m is a 2000bp DNA molecular mass standard, 1 is e.coli uidA, 2 is Salmonella invA, 3 is 16SrDNA, 4 is a three-gene multiplex PCR; according to the result, whether the establishment of the multiplex PCR reaction system has the ability to detect bacteria such as Escherichia coli and Salmonella in the drug can be judged or assisted.
Example 2: specificity detection of multiplex PCR reaction system
And carrying out PCR detection on escherichia coli, salmonella typhimurium, staphylococcus epidermidis, candida albicans, proteus, streptococcus enteritis, burkholderia melissii, enterocolitis phyllsenula, pathogenic bacillus cereus, C-type hemolytic streptococcus and bacillus anthracis by utilizing the established PCR reaction system.
The specific steps for performing triple PCR detection are as follows:
(1) preparing a PCR reaction system: the PCR reaction system consisted of 2. mu.L of primer set 1 (concentration 1. mu. mol/L), 2. mu.L of primer set 2 (concentration 1. mu. mol/L), 2. mu.L of primer set 3 (concentration 1. mu. mol/L), 10. mu.L of 2 XM 5 Tap HiFi PCR Mix, 1. mu.L of E.coli suspension (100000CFU/mL), and 3. mu.L of ddH2O composition;
when other strains are detected, the escherichia coli liquid is replaced by: salmonella typhimurium, Escherichia coli, Salmonella typhimurium, staphylococcus epidermidis, Candida albicans, proteus, streptococcus enteritis, Burkholderia meliae, enterocolitis Yersinia, pathogenic bacillus cereus, C-type hemolytic streptococcus or Bacillus anthracis liquid, and other conditions are unchanged, so that different PCR reaction systems can be prepared;
(2) the PCR amplification reaction program comprises: pre-denaturation at 95 ℃ for 4 min; denaturation at 95 ℃ for 30s, annealing at 59 ℃ for 1min, extension at 72 ℃ for 1min for 30s, for 35 cycles; further extension for 10min at 72 ℃;
(3) after the PCR reaction is finished, gel electrophoresis is carried out, and the position of the size of the band is analyzed or the electrophoresis result is obtained.
The detection results are shown in fig. 2, in fig. 2: m is a 2000bp DNA molecular mass standard, 1 is Escherichia coli and salmonella (positive control), 2 is Escherichia coli, 3 is salmonella, 4 is staphylococcus epidermidis, 5 is proteus, 6 is enteritis streptococcus, 7 is Candida albicans, 8 is Burkholderia melinii farci, 9 is enterocolitis Yersinia, 10 is pathogenic bacillus cereus, 11 is C-type hemolytic streptococcus, 12 is anthrax bacillus, 13 is double distilled water (negative control). The detection result shows that the sample added with the escherichia coli and the salmonella has three bands, the sample added with the escherichia coli has 194bp and 1374bp bands, the sample added with the salmonella has 362bp and 1374bp bands, and other samples only have 1374bp bands, so that the multiplex PCR reaction system has the capability of detecting bacteria such as the escherichia coli, the salmonella and the like in the medicine.
Example 3: sensitivity detection of multiplex PCR reactions
The stock solution was diluted by 10-fold dilution for 9 gradients, and PCR amplification was performed on selected gradients from 2 to 7 to determine the detection sensitivity of the method.
The specific steps for performing triple PCR detection are as follows:
(1) preparing a PCR reaction system: the PCR reaction system consisted of 2. mu.L of primer pair 1 (concentration 1. mu. mol/L), 2. mu.L of primer pair 2 (concentration 1. mu. mol/L), 2. mu.L of primer pair 3 (concentration 1. mu. mol/L), 10. mu.L of 2 XM 5 Tap HiFi PCR Mix, 1. mu.L of E.coli, 1. mu.L of Salmonella bacteria and 2. mu.L of ddH2O composition;
the mixed concentration of the escherichia coli liquid and salmonella liquid to be detected in each system is 1: 8.7x107CFU/ml，2：8.7x106CFU/ml，3：8.7x105CFU/ml，4：8.7x104CFU/ml，5：8.7x103CFU/ml，6：8.7x102CFU/ml; other conditions were unchanged;
(2) the PCR amplification reaction program comprises: pre-denaturation at 95 ℃ for 4 min; denaturation at 95 ℃ for 30s, annealing at 59 ℃ for 1min, extension at 72 ℃ for 1min for 30s, for 35 cycles; further extension for 10min at 72 ℃;
(3) after the PCR reaction is finished, gel electrophoresis is carried out, and the position of the size of the band is analyzed or the electrophoresis result is obtained.
The detection results are shown in fig. 3, in fig. 3: m is 2000bp DNA molecular mass standard, 1 is 8.7x107CFU/ml, 2 is 8.7x106CFU/ml, 3 is 8.7x105CFU/ml, 4 is 8.7x104CFU/ml, 5 is 8.7x103CFU/ml, 6 is 8.7x102CFU/ml, 7 isDouble distilled water (negative control); the detection result shows that the multiplex PCR sensitivity is more than or equal to 8.7x103CFU/ml。
Example 4: detection of marketed drugs using multiplex PCR
The established PCR reaction system is utilized to detect the Chimonanthus nitens leaf granules, the children's Chaigui antipyretic granules, the anti-cold granules, the heat stranguria clearing tablets, the Lianhua antipyretic capsules, the pseudo-ginseng powder and other medicines.
The detection method comprises the following specific steps:
(1) preparing a PCR reaction system: the PCR reaction system consisted of 2. mu.L of primer set 1 (concentration 1. mu. mol/L), 2. mu.L of primer set 2 (concentration 1. mu. mol/L), 2. mu.L of primer set 3 (concentration 1. mu. mol/L), 10. mu.L of 2 XM 5 Tap HiFi PCR Mix, 1. mu.L of Chimonanthus nitens leaf particle dilution (concentration 100g/L) and 3. mu.L of ddH2O composition;
when other medicines are detected, the wintersweet leaf granule diluent is replaced into the following components in different systems: 1 mu L of diluent of antipyretic granules of radix bupleuri and cortex cinnamomi for children (the concentration is 50g/L), 1 mu L of diluent of anti-influenza granules (the concentration is 50g/L), 1 mu L of diluent of Relinqing tablets (the concentration is 3.5g/L), 1 mu L of diluent of Lianhua antipyretic capsules (the concentration is 3.5g/L) or 1 mu L of diluent of radix notoginseng powder (the concentration is 30g/L), and other conditions are unchanged;
(2) the PCR amplification reaction program comprises: pre-denaturation at 95 ℃ for 4 min; denaturation at 95 ℃ for 30s, annealing at 59 ℃ for 1min, extension at 72 ℃ for 1min for 30s, for 35 cycles; further extension for 10min at 72 ℃;
(3) after the PCR reaction is finished, gel electrophoresis is carried out, and the position of the size of the band is analyzed or the electrophoresis result is obtained.
The detection results are shown in fig. 4, in fig. 4: m is 2000bp DNA molecular mass standard, 1 is Chimonanthus nitens leaf particles, 2 is anti-infection particles, 3 is children Chaigui antipyretic particles, 4 is heat stranguria clearing tablets, 5 is Lianhua antipyretic capsules, 6 is pseudo-ginseng powder, and 7 is double distilled water (negative control); the detection result shows that no band appears in other medicines except the 1374bp band appears in the Chimonanthus nitens leaf granules and the pseudo-ginseng powder.
Example 5
The established PCR reaction system is utilized to detect the drugs which are not detected by drug tests, such as clarithromycin capsules, bupleurum particles, fatigue-relieving particles, cold-clearing particles, and the like.
The detection method comprises the following specific steps:
(1) preparing a PCR reaction system: the PCR reaction system consisted of 2. mu.L of primer set 1 (concentration 1. mu. mol/L), 2. mu.L of primer set 2 (concentration 1. mu. mol/L), 2. mu.L of primer set 3 (concentration 1. mu. mol/L), 10. mu.L of 2 XM 5 Tap HiFi PCR Mix, 1. mu.L of clarithromycin capsule diluent (concentration 100g/L) and 3. mu.L of ddH2O composition;
when other medicines are detected, the clarithromycin capsule diluent is replaced into the following components in different systems: 1 mu L of Chaihuang granule diluent (with the concentration of 100g/L), 1 mu L of fatigue-relieving granule diluent (with the concentration of 100g/L) or 1 mu L of cold-clearing granule diluent (with the concentration of 100g/L), and the other conditions are unchanged;
(2) the PCR amplification reaction program comprises: pre-denaturation at 95 ℃ for 4 min; denaturation at 95 ℃ for 30s, annealing at 59 ℃ for 1min, extension at 72 ℃ for 1min for 30s, for 35 cycles; further extension for 10min at 72 ℃;
(3) after the PCR reaction is finished, gel electrophoresis is carried out, and the position of the size of the band is analyzed or the electrophoresis result is obtained.
The detection results are shown in fig. 5, and in fig. 5: m is 2000bp DNA molecular mass standard, 1 is clarithromycin capsule, 2 is bupleurum root granule, 3 is fatigue-relieving granule, 4 is cold heat-clearing granule, and 5 is double distilled water (negative control) which is subjected to multiple PCR detection; the detection result shows that 1374bp bands appear in the medicines.
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> university of traditional Chinese medicine in Jiangxi
<120> primer group, kit and detection method for detecting escherichia coli and salmonella in medicine
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ttgggacttt gccttagc 18
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tacgagccag gatagtcttt 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
atttgacctg gtgccactgt 20
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gtaaccacta ccagaacagc 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gactcggtcc tagtttgaga 20
<210> 6
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
cccagaacat gtgtggc 17

Claims (9)

1. A primer group for detecting escherichia coli or salmonella in a medicament is characterized by comprising one or more of the following primer pairs 1-3,
primer pair 1:
TTGGGACTTTGCCTTAGC，
TACGAGCCAGGATAGTCTTT；
and (3) primer pair 2:
ATTTGACCTGGTGCCACTGT，
GTAACCACTACCAGAACAGC；
and (3) primer pair:
GACTCGGTCCTAGTTTGAGA，
CCCAGAACATGTGTGGC。
2. a kit for detecting Escherichia coli or Salmonella in a medicament, which is characterized in that: comprising the primer set of claim 1.
3. The kit for detection of escherichia coli or salmonella in medicine according to claim 2, characterized in that: also comprises Taq enzyme, dNTP, GelGreen DNA nucleic acid dye, 2000bp Marker and PCR reaction buffer solution.
4. The kit for detection of escherichia coli or salmonella in medicine according to claim 3, characterized in that: the PCR reaction buffer contained 100mM Tris-HCl buffer, 15mM Mg2+, and 500mM KCl.
5. A method for detecting Escherichia coli or Salmonella in a drug, which is characterized by comprising the following steps:
(1) obtaining template DNA from a drug to be detected;
(2) establishing a PCR reaction system by using the kit of claim 4, and then performing multiple PCR amplification reaction on the template DNA by using the PCR reaction system to obtain an amplification product;
(3) and carrying out electrophoresis detection on the amplification product to obtain a detection result, and analyzing the electrophoresis result to judge the existence and the content of escherichia coli and salmonella in the medicament.
6. The detection method according to claim 5, characterized in that: the concentration of Taq enzyme in the PCR reaction system is 0.025-0.15U/. mu.L.
7. The detection method according to claim 5, characterized in that: the primer group in the PCR reaction system comprises a primer pair 1, a primer pair 2 and a primer pair 3, and the concentration ratio of the three primer pairs is 1:1: 1.
8. The detection method according to claim 7, characterized in that: each primer in the primer set used in the system of the PCR reaction had a concentration of 2. mu. mol/L.
9. Use of the kit of claim 2 for the detection of escherichia coli or salmonella in a medicament.
CN202010819796.9A 2020-08-14 2020-08-14 Primer group, kit and detection method for detecting escherichia coli and salmonella in medicine Pending CN112011630A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010819796.9A CN112011630A (en) 2020-08-14 2020-08-14 Primer group, kit and detection method for detecting escherichia coli and salmonella in medicine

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010819796.9A CN112011630A (en) 2020-08-14 2020-08-14 Primer group, kit and detection method for detecting escherichia coli and salmonella in medicine

Publications (1)

Publication Number Publication Date
CN112011630A true CN112011630A (en) 2020-12-01

Family

ID=73504583

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010819796.9A Pending CN112011630A (en) 2020-08-14 2020-08-14 Primer group, kit and detection method for detecting escherichia coli and salmonella in medicine

Country Status (1)

Country Link
CN (1) CN112011630A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116769937A (en) * 2023-03-28 2023-09-19 浙江省食品药品检验研究院 Detection kit for common pathogenic bacteria of traditional Chinese medicine decoction pieces

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2015039320A (en) * 2013-08-21 2015-03-02 日鉄住金環境株式会社 Simultaneous detection method of multiple bacteria and/or simultaneous quantitative method of multiple bacteria
CN104711365A (en) * 2015-04-02 2015-06-17 青岛康伦生物科技有限公司 Multiple-PCR rapid detection method of salmonella and escherichia coli
US20160032366A1 (en) * 2014-08-01 2016-02-04 The Curators Of The University Of Missouri Multiplex assay for detection of bacterial species in biological samples
CN106755529A (en) * 2017-02-24 2017-05-31 广东温氏食品集团股份有限公司 A kind of multiplex PCR specific primer for detecting pig bacterial enteritis cause of disease and its application

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2015039320A (en) * 2013-08-21 2015-03-02 日鉄住金環境株式会社 Simultaneous detection method of multiple bacteria and/or simultaneous quantitative method of multiple bacteria
US20160032366A1 (en) * 2014-08-01 2016-02-04 The Curators Of The University Of Missouri Multiplex assay for detection of bacterial species in biological samples
CN104711365A (en) * 2015-04-02 2015-06-17 青岛康伦生物科技有限公司 Multiple-PCR rapid detection method of salmonella and escherichia coli
CN106755529A (en) * 2017-02-24 2017-05-31 广东温氏食品集团股份有限公司 A kind of multiplex PCR specific primer for detecting pig bacterial enteritis cause of disease and its application

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
何超等: "沙门菌、志贺菌和大肠杆菌O157：H7的多重PCR快速检测体系的初步探讨", 卫生研究, vol. 34, no. 6, pages 721 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116769937A (en) * 2023-03-28 2023-09-19 浙江省食品药品检验研究院 Detection kit for common pathogenic bacteria of traditional Chinese medicine decoction pieces

Similar Documents

Publication Publication Date Title
Frank et al. Culture-independent molecular analysis of microbial constituents of the healthy human outer ear
WO2018157844A1 (en) Method for extracting nucleic acid substance by using magnetic bead, and reagent
US20230340624A1 (en) Detection reagents for severe acute respiratory syndrome coronavirus 2 and detection methods
Krutova et al. C. difficile ribotype 027 or 176?
JP4050870B2 (en) DNA synthesis method
CN111254206A (en) Detection method of mycobacterium tuberculosis drug-resistant strain
CN112011630A (en) Primer group, kit and detection method for detecting escherichia coli and salmonella in medicine
Beauruelle et al. Group B Streptococcus vaginal carriage in pregnant women as deciphered by clustered regularly interspaced short palindromic repeat analysis
CN113736863A (en) Diagnostic methods and compositions
CN113840923A (en) Methods, systems, and devices for nucleic acid detection
CN107058548A (en) C kit detection in Gene Mutation primed probes and its kit
CN104328206B (en) The LAMP detection method and its primer special of clostridium difficile binary toxin and test kit
Shuber et al. Accurate, noninvasive detection of Helicobacter pylori DNA from stool samples: potential usefulness for monitoring treatment
CN109628564A (en) A method of for detecting the primer sets of SNP polymorphism and detecting SNP polymorphism using primer sets
CN108203738A (en) A kind of kit for being used to detect 1 type of human T-cell lymphotropic virus
CN115961071A (en) Nucleic acid detection primer group for rapidly detecting saccharomyces boulardii based on loop-mediated isothermal amplification technology and visual detection method
CN113832259A (en) Novel rapid detection kit for coronavirus and application thereof
CN111334592A (en) Nucleic acid composition for detecting helicobacter pylori drug-resistant gene and kit and application thereof
CN112899385A (en) Primer group and probe for identifying Brucella S2 vaccine strain and wild strain and application of primer group and probe
CN106032551B (en) Method for detecting back mutation in virus sample and kit for the same
Gaoh et al. Propidium Monoazide (PMAxx)-Recombinase Polymerase Amplification Exo (RPA Exo) Assay for Rapid Detection of Burkholderia cepacia Complex in Chlorhexidine Gluconate (CHX) and Benzalkonium Chloride (BZK) Solutions
CN112391485A (en) Specific primer for detecting escherichia coli in oral medicine and detection method thereof
WO2021124960A1 (en) Primer set for detecting mycobacterium tuberculosis, mycobacterium avium, and mycobacterium intracellulare and method using same, and reagent kit therefor
CN103382502A (en) RT-PCR method integrated with restriction endonuclease removal of DNA pollution
CN112852948B (en) Method and kit for detecting drug-induced deafness related gene locus

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination