CN107058548A - C kit detection in Gene Mutation primed probes and its kit - Google Patents
C kit detection in Gene Mutation primed probes and its kit Download PDFInfo
- Publication number
- CN107058548A CN107058548A CN201710295454.XA CN201710295454A CN107058548A CN 107058548 A CN107058548 A CN 107058548A CN 201710295454 A CN201710295454 A CN 201710295454A CN 107058548 A CN107058548 A CN 107058548A
- Authority
- CN
- China
- Prior art keywords
- probe
- seq
- nucleotide sequence
- upstream
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of c kit detection in Gene Mutation primed probe and its kit, kit includes digital pcr premixed liquid, droplets stable agent and the primed probe mixed liquor for being used to prepare digital pcr reaction solution；Primed probe mixed liquor includes the upstream and downstream primer A and mutant probe A for being used to detect the 550th codon R550K sites, upstream and downstream primer B and mutant probe B for detecting the 545th codon E545K sites, upstream and downstream primer C and mutant probe C for detecting the 642nd codon K642E sites, and for detecting the upstream and downstream primer D and mutant probe D in the 816th codon D816V sites.The c kit gene mutation detection kits sensitivity and specificity of the present invention are high, and sample requirements are few, can carry out multiplex PCR detection exactly with rapid and convenient.
Description
Technical field
The present invention relates to a kind of primer of detection c-kit gene mutations, probe and detection product, belong to biotechnology neck
Domain.
Background technology
The product of c-kit gene codes is stem cell factor acceptor, belongs to III type tyrosine kinase, proto-oncogene c-
Kit mutation cause EGFR-TK continuous activation, and mutagenesis uncontrolled cellular proliferation is formed, and can stimulate tumour cell
Persistent hyperplastic and anti-apoptotic signal it is out of control.Therefore it is mutated detection can Accurate Prediction correspondence targeted drug treatment it is effective
Property, it is easy to clinical application to select, significantly improves therapeutic effect, patient is at utmost benefited；It is unreasonable at the same time it can also avoid
The Medical Expense for Patients burden and social medical resource that medication is caused are wasted, and the unnecessary aging loss of reduction and economy are damaged
Lose.
Exploring patient C-KIT resistance mechanisms and prediction prognosis turns into a feasible approach, and clear and definite tumour is thin now
Born of the same parents understand released dna and enter the circulatory system so that by way of " liquid biopsy ", can be specific to early stage and late tumor patient
Nucleotide sequence analyzed, be a kind of Noninvasive detection oncogene and clinical therapeutic efficacy a kind of method, and
Patient is higher to the acceptance of Noninvasive sample collection mode.
But it is due to that cfDNA contents are low in most people serum/plasma, in tumour early stage, ctDNA only accounts for total free
The 0.01% of DNA, and the reason such as cfDNA fragments are relatively small, at present the clinical detection to tumor-related gene be mainly PCR sequencing PCR
With ARMS methods, and do not apply to.Therefore, ctDNA detection is accomplished by a kind of more special technology sensitiveer than conventional method.Use
The relatively low conventional method detection of sensitivity can only find tumour variation of the subset of patients before particular treatment is received, using Gao Ling
It can be found that the carrying saltant type patient of higher proportion if sensitivity method (such as dPCR) is detected.In terms of digital pcr is due to sensitivity
Advantage, by unimolecule amplification low-abundance gene signal is distinguished from complex background, available for disease or virus
Early diagnosis or curative effect monitoring.Digital pcr technology unimolecule amplification after to sample DNA accurate quantification, with than other PCR
Higher measurement accuracy.
The sensitivity of digital pcr depends primarily on 2 main aspects：Efficiency and specific detection that nucleic acids in samples is extracted
The sensitivity of system, both determine the detection sensitivity of target sequence together.Droplet type digital pcr detects extremely low copy number sample
Its testing result of this when is unstable, it is necessary to repeatedly parallel laboratory test.Due to the limitation of hardware device, it is difficult to be difficult to realize multiple sites
While detect, and dPCR Multiple detection systems are limited to the length of pcr amplification product, and the design to TaqMan probe has
Very high requirement.The present invention is improved from digital pcr detection architecture, improves stability and the sensitivity of digital pcr detection.
The content of the invention
High the technical problem to be solved in the present invention is to provide a kind of sensitivity and specificity, sample requirements are few, can be fast
Speed easily and accurately carries out the c-kit detection in Gene Mutation primed probe and its kit of multiplex PCR detection.
The present invention is that a kind of technical scheme for solving above-mentioned technical problem proposition is：A kind of c-kit detection in Gene Mutation is drawn
Physical prospecting pin, including for detecting the upstream and downstream primer A and mutant probe A in the 550th codon R550K sites, for detecting the 545th
The upstream and downstream primer B and mutant probe B in codon E545K sites, the upstream and downstream for detecting the 642nd codon K642E sites
Primer C and mutant probe C, and for detecting the upstream and downstream primer D and mutant probe D in the 816th codon D816V sites；
The nucleotide sequence of the sense primer A is as shown in SEQ ID No.1, the nucleotide sequence of the anti-sense primer A
As shown in SEQ ID No.2, the nucleotide sequence of the probe A as shown in SEQ ID No.3,
The nucleotide sequence of the sense primer B is as shown in SEQ ID No.4, the nucleotide sequence of the anti-sense primer B
As shown in SEQ ID No.5, the nucleotide sequence of the probe B as shown in SEQ ID No.6,
The nucleotide sequence of the sense primer C is as shown in SEQ ID No.7, the nucleotide sequence of the anti-sense primer C
As shown in SEQ ID No.8, the nucleotide sequence of the probe C as shown in SEQ ID No.9,
The nucleotide sequence of the sense primer D is as shown in SEQ ID No.10, the nucleotide sequence of the anti-sense primer D
As shown in SEQ ID No.11, the nucleotide sequence of the probe D is as shown in SEQ ID No.12.
Above-mentioned probe A, B, C, D have carried out LNA modifications.
The ultimate density of above-mentioned upstream and downstream primer A, B, C, D in reaction system is 0.1~0.3 μM/L, probe A, B,
The ultimate density of C, D in reaction system is 0.15~0.30 μM/L.
Ultimate densities of the above-mentioned upstream and downstream primer A in reaction system is 0.19 μM/L, and the upstream and downstream primer B is in reaction
Ultimate density in system is 0.2 μM/L, and ultimate densities of the upstream and downstream primer C in reaction system is 0.18 μM/L, institute
Ultimate densities of the upstream and downstream primer D in reaction system is stated for 0.2 μM/L；Described probe A, B, C, D in reaction system most
Final concentration be respectively 0.22 μM/L, 0.19 μM/L, 0.21 μM/L, 0.18 μM/L.
Above-mentioned probe A, B, C, D 5 ' ends are provided with reporter fluorescence group, and 3 ' ends are provided with quenching fluorescence group.
The present invention is that a kind of technical scheme for solving above-mentioned technical problem proposition is：A kind of above-mentioned primed probe of use
C-kit detection in Gene Mutation products.
The present invention is that a kind of technical scheme for solving above-mentioned technical problem proposition is：A kind of c-kit detection in Gene Mutation examination
Agent box, including for preparing digital pcr premixed liquid, droplets stable agent and the primed probe mixed liquor of digital pcr reaction solution；
The primed probe mixed liquor includes upstream and downstream primer A and the mutation for being used to detect the 550th codon R550K sites
Probe A, upstream and downstream primer B and mutant probe B for detecting the 545th codon E545K sites, for detecting the 642nd password
The upstream and downstream primer C and mutant probe C in sub- K642E sites, and for detecting the upstream and downstream in the 816th codon D816V sites
Primer D and mutant probe D；
The nucleotide sequence of the sense primer A is as shown in SEQ ID No.1, the nucleotide sequence of the anti-sense primer A
As shown in SEQ ID No.2, the nucleotide sequence of the probe A as shown in SEQ ID No.3,
The nucleotide sequence of the sense primer B is as shown in SEQ ID No.4, the nucleotide sequence of the anti-sense primer B
As shown in SEQ ID No.5, the nucleotide sequence of the probe B as shown in SEQ ID No.6,
The nucleotide sequence of the sense primer C is as shown in SEQ ID No.7, the nucleotide sequence of the anti-sense primer C
As shown in SEQ ID No.8, the nucleotide sequence of the probe C as shown in SEQ ID No.9,
The nucleotide sequence of the sense primer D is as shown in SEQ ID No.10, the nucleotide sequence of the anti-sense primer D
As shown in SEQ ID No.11, the nucleotide sequence of the probe D is as shown in SEQ ID No.12.
Above-mentioned probe A, B, C, D have carried out LNA modifications；Described upstream and downstream primer A, B, C, D are final in reaction system
Concentration is 0.1~0.3 μM/L, and the ultimate density of probe A, B, C, D in reaction system is 0.15~0.30 μM/L；It is described
Probe A, B, C, D 5 ' ends are provided with reporter fluorescence group, and 3 ' ends are provided with quenching fluorescence group.
Above-mentioned c-kit gene mutation detection kits also include histone deacetylase solution, the digital pcr premix
Liquid includes archaeal dna polymerase, ultra-pure water, dNTPs mixed liquors, reference fluorescent ROX and buffer solution；The droplets stable agent includes
Mineral oil.
During above-mentioned c-kit gene mutation detection kits reaction, reaction system includes the volume of digital pcr premixed liquid 10,
The volume of primed probe mixed liquor 2, the volume of droplets stable agent 2, the volume of template 1, sterilize the volume of ultra-pure water 5, the use of the template
Concentration is 0.1ng/ul~1ng/ul.
The present invention has positive effect：
1) c-kit gene mutation detection kits of the invention are different from conventional multi-primerses design principle, of the invention
Product length and primer length are shorter, and carry out special modification to primer and probe, improve for mutational site and wild
The specificity of the respective probe in type site, reaches the purpose of probe and target sequence specific binding, detection architecture is optimized so that this
The sensitivity of invention is 0.01%, and specificity is 100%, and the sample of lower mutation abundance can be detected.
2) c-kit gene mutation detection kits of the invention can also carry out multiplex PCR point except being outside one's consideration with ultra-high sensitive
Analysis.4 re-detections are reached by the fluorescence signal and regulation concentration and probe concentration that design probe, 1 c- is detected by 1 original chip
Kit sudden change samples are changed into 1 chip and detect 4 c-kit sudden change samples, and testing cost is saved 50-100 members, greatly reduced
Cost.Quick, economic, sensitive detection is realized to mutation in the case of high flux sample.
3) c-kit gene mutation detection kits of the invention to the sample extracting of reaction system, probe modification mode and
Program is optimized, and sample process process optimization avoids harmful effect of the pre-treatment step to testing result accuracy, probe
Optimization is prevented effectively from the suppression between multiplex PCR probe and causes amplification efficiency unstable, it is ensured that in same reaction system
Carry out the stability of 4 re-detections.The combination of ddPCR and Multiple techniques improves the flux of genetic analysis so that can suffer from from each
More information is obtained in person's sample.Patient is higher to the acceptance of Noninvasive sample collection mode, absolute by the kit
It is quantitative that tumor patient has been carried out time and spatial analysis, change the sampling mode in Tumor mutations phase analysis, can be effective
CtDNA levels (copy number of mutation allele in per ml blood plasma) performance of ground monitoring tumor patient, can not only be prominent from c-kit
Become " having " or "None" is mutated the difference of matter, to " many " or the amount difference of " few " mutation, treatment is reacted in time, so as to influence to control
The selection and decision for the treatment of scheme, more preferably clinical application provide theoretical foundation.
Embodiment
The present invention is specifically described below by embodiment, it is necessary to it is pointed out here that be that following examples are only used
It is further described in the present invention, it is impossible to be interpreted as limiting the scope of the invention, person skilled in art can
To make some nonessential modifications and adaptations to the present invention according to the invention described above content.In following embodiments, if not specially
Show, reagent used is that analysis is pure, and agents useful for same can be obtained from commercial channel.The experiment of unreceipted actual conditions in text
Method, what the Science Press generally write according to normal condition such as J. Pehanorm Brookers etc. published for 2002《Molecular cloning is real
Test guide》Condition described in one book, or according to the condition proposed by manufacturer.Unless otherwise defined, the institute used in text
There is specialty identical with meaning known to one skilled in the art with scientific words.In addition, it is any similar to described content or
Impartial method and material all can be applied in the present invention.
First, the composition of kit.
The c-kit gene mutation detection kits of the present embodiment, including digital pcr premixed liquid, droplets stable agent, primer spy
Pin mixed liquor, histone deacetylase solution and positive control.Each composition of kit is as shown in table 1.
The Kit components table of table 1
Reagent constituents is described as follows in above-mentioned table 1：
1) main component of digital pcr premixed liquid includes archaeal dna polymerase, ultra-pure water, dNTPs mixed liquors, reference fluorescent
ROX, buffer solution etc. (are provided, article No. by Life technologies companies：1508099).
2) main component of droplets stable agent is mineral oil, (is provided by Raindance technologies companies, goods
Number：30-00826), main function is that reaction system is formed Water-In-Oil droplet by droplet processing procedure.
3) primed probe mixed liquor include be used for detect c-kit genes the 550th, 545,642, the primer of 816 codons and
Probe, upstream and downstream primer A and mutant probe A namely for detecting the 550th codon R550K sites, for detecting the 545th
The upstream and downstream primer B and mutant probe B in codon E545K sites, the upstream and downstream for detecting the 642nd codon K642E sites
Primer C and mutant probe C, and for detecting the upstream and downstream primer D and mutant probe D in the 816th codon D816V sites.
The present embodiment has carried out LNA modifications to probe A, B, C, D.A LNA base is introduced i.e. in oligonucleotide probe,
And the specificity of optimal fusing point (Tm) and hybridization is adjusted by adjusting the position of LNA bases within the probe.After modification
Probe has higher Tm values, more preferably can be combined with mutagenesis template, the real-time quantitative PCR probe after modification, length is shorter, can
To increase the flexibility of design, cross the mutant probe of LNA modifications has more preferable saltant type to have more preferable sub-clustering to imitate to saltant type
Really.
According to the requirement of instrument and Multiple experiments, certain specific mutant form is needed with two different fluorescence labelings
Taqman probes, are marked to the end of Taqman probes 5 ' using two kinds of fluorescence of VIC and FAM, use MGB quenching groups pair
The end of Taqman probes 3 ' is marked.If the design of primer and probe is improper, the selection to crucial target sequence is directly affected,
The sensitivity and specificity of PCR detections are reduced, or even are fallen flat.Thus, it is necessary to there is sufficient understanding to extension increasing sequence, and advise
Model PCR Lab operating technology, uses identical sense primer and anti-sense primer for wild and mutation, prevents due to primer mistake
Interfere more, reduce the sensitivity of detection.
Probe A and probe B 5 ' end fluorescence labelings are that FAM, probe C and probe D 5 ' end fluorescence labelings are VIC,
When detection template (DNA profiling) is undergone mutation, corresponding detection probe has VIC fluorescence signals or FAM fluorescence signals.
4) histone deacetylase is provided by Beijing Suo Laibao Science and Technology Ltd, according to product description that enzyme is dilute
Release to 10ug ml, every milliliter of serum or blood plasma add 10ul dilutions.
5) (including the 550th, 545,642,816 is close from the positive cell strain for carrying c-kit gene mutations for positive control
Saltant type including numeral), the DNA of saltant type and wild type c-kit genes is proportionally 1:100.
2nd, primed probe is designed.
Because the length of tumour dissociative DNA is very short, length≤180bp, the cracking of normal cell can discharge largely in blood
DNA, further reduction ctDNA abundance.Nuclease can also influence the stability of ctDNA in blood so that partial target piece
Duan Xulie may be shorter, if the amplified production of design primer is long, leading mutagenic sequence can not detect, the present invention
Product length is detected according to changing, it is found that the longer product mutation recall rate of shorter product mutation recall rate has bigger advantage,
It is more beneficial for realizing the detection of c-kit mutation.The primed probe length that the present invention is designed be 14~18bp, product length 50~
80bp, prevents from causing Positive rate to reduce because amplified production amplification is long, as shown in table 2.
The primer probe sequence table of table 2
| Position | Detect classification | Seq No. | Sequence(5’—3’) |
| R550K | Sense primer A | 1 | TCTCTCTGAAATCACTG |
| R550K | Anti-sense primer A | 2 | CAGTTATTTTTTCTG |
| R550K | Probe A | 3 | CTATGGAGTCACAAGT |
| E545K | Sense primer B | 4 | CTAGAGACAATGAAT |
| E545K | Anti-sense primer B | 5 | CACTTACCTGTGACT |
| E545K | Probe B | 6 | TCTGAAATCACTAAG |
| K642E | Sense primer C | 7 | TTCCAATTTTAGCGAG |
| K642E | Anti-sense primer C | 8 | TATTCATGTGATTAC |
| K642E | Probe C | 9 | TGTCTGAACTCGAAG |
| D816V | Sense primer D | 10 | TCCTCCTTACTCATGGT |
| D816V | Anti-sense primer D | 11 | AGCAGAGAATGGGTAC |
| D816V | Probe D | 12 | GTCTAGCCAGAGTCA |
Primed probe has the synthesis of the Li Ge Bioisystech Co., Ltd of Shanghai hundred, and work is diluted to by dry powder according to primer specification
Make mother liquor, then detection working solution is configured to by mother liquor, primer and probe mixed liquor is by mother liquor addition sterilizing ultra-pure water dilution
Into.
Too high concentration and probe concentration can improve the probability with wild-type template mispairing, to meet during multiple digital pcr design
Need, according to different fluorescence labelings, and by adjusting concentration and probe concentration so that the drop of different mutation types is able to put down in two dimension
Distinguished in face.For detecting that ultimate densities of the upstream and downstream primer A in the 550th codon R550K sites in reaction system is 0.1
~0.3 μM/L, end reaction concentration preferably is 0.19 μM/L；For detecting that the upstream and downstream in the 545th codon E545K sites is drawn
Ultimate densities of the thing B in reaction system is 0.1~0.3 μM/L, and end reaction concentration preferably is 0.2 μM/L；For detecting
Ultimate densities of the upstream and downstream primer C in the 642nd codon K642E sites in reaction system is 0.1~0.3 μM/L, preferably
End reaction concentration is 0.19 μM/L, for detecting the upstream and downstream primer D in the 816th codon D816V sites in reaction system
Ultimate density be 0.1~0.3 μM/L, preferred end reaction concentration is 0.2 μM/L；Probe A, B, C, D are in reaction system
Ultimate density be 0.15~0.30 μM/L, preferred end reaction concentration be respectively 0.22 μM/L, 0.19 μM/L, 0.21 μM/
L、0.18μM/L。
The application method of three kits.
1st, sample DNA is extracted
DNA sources can be serum/plasma, blood plasma, peripheral blood, mucous membrane of mouth etc..The serum of 50 tumor patients of collection/
Plasma sample 5ml, high speed centrifugation separates supernatant, obtains serum/plasma.The serum/plasma provided with German Qiagen companies is total
DNA extraction kit (article No.：55114), the dissociative DNA in patients serum/blood plasma is extracted according to kit operational manual.Obtain
Obtain after serum/plasma sample dissociative DNA, pass through Thermo-Fisher companies3.0 nucleic acid-protein fluorescent quantitation instruments, are surveyed
Determine serum/plasma sample dissociative DNA concentration and purity, -20 DEG C of preservations.
Because normal cell etc. can be cracked in the blood after blood sampling in blood, substantial amounts of DNA is discharged, reduction ctDNA's is rich
Degree, nuclease can also influence the stability meeting of ctDNA in blood, cause both sides to influence on ctDNA detection, increase
The difficulty of ctDNA detections.The present embodiment, due to that can not carry out subsequent detection to sample in time, is dividing for a large amount of detection samples
Histone deacetylase (SIR2 enzymes) is added in the DNA sample after blood plasma or extracting from after, ensure that ctDNA's is steady
It is qualitative, and enzyme inactivates at high temperature, has no effect on follow-up amplification experiment.
2nd, prepared by digital pcr reaction solution
PCR reaction systems in table 3, take 20 μ l digital pcr premixed liquid in kit, 4 μ l primed probe to mix
Liquid is closed, 2ul template, 4 μ l droplets stable agent is added, sterilizing ultra-pure water is added and mends to 40 μ l, digital pcr reaction response is made
Liquid, prepares quantitative reaction system, and vibration is mixed, and centrifuges bubble removing.Template refers to the sample DNA after serum/plasma Sample Dilution
And negative control, negative control is autoclaving water.
Table 3PCR reaction system tables
3rd, PCR reacts droplet and prepared
Digital pcr mixed liquor is fabricated to the micro- reaction drops of PCR, 500~8,000,000 Water-In-Oil drops are formed.This experiment
Reaction system by drop generator formation picoliters level size Water-In-Oil droplet, DNA molecular mixture is distributed to
In the droplet of million, each reative cell averagely contains one or zero target molecule.Droplet generation plate is put into 8 passage droplets
In maker, the drop generators RainDrop Source produced with Raindance companies carry out droplet processing to sample.
4th, PCR is expanded
Performing PCR amplification is entered to the droplet of generation using the PCR amplification instrument of Bo companies.Response procedures are as follows：Pre-degeneration rank
94 DEG C of the condition of section, 8min；1 circulation；94 DEG C of 10s, 52 DEG C of 10s, 36 circulations；94 DEG C, 8min, 1 circulation；12℃
20min, 1 circulation；4 DEG C, insulation.
5th, droplet is detected
After PCR reactions terminate, 8 unions are placed in droplet analyzer, the droplet analyzer produced with Raindance companies
RainDrop Sense are analyzed the fluorescence signal of each droplet the droplet containing fluorescence signal labeled as 1, without fluorescence
Signal is labeled as 0, then droplet is counted, and software is automatically analyzed.Because digital pcr is a kind of terminal analysis method, if target molecule
Without discretization well, such as some droplets include multiple target nucleic acid molecules, then the result obtained in theory will be inaccurate,
Therefore introduce Poisson probability distribution function and be used to analyze data.
Poisson distribution formula is as follows：
According to the coefficient of dilution of droplet sum, the droplet number containing fluorescence signal and sample, the ctDNA water of sample can obtain
The abundance of flat and corresponding c-kit gene mutations.The ctDNA levels of sample represent the copy of every milliliter of blood plasma allelic
Number, gene mutation abundance represents the mutant copies number of c-kit genes in peripheral blood genome, mutation includes the 550th, 545,642,
The mutation of 816 codons.
Comparative example 1
In order to improve the sensitivity of detection, those skilled in the art have carried out contrast experiment, the detection examination of this comparative example
Agent box, remainder is same as Example 1, and difference is：
1) primed probe design is using conventional primed probe design principle, and design primer length is 18~25bp, probe
Length is 20~30bp, and product length is 80~150bp, and probe does not carry out LNA modifications, primer probe sequence such as table 4
It is shown.
The custom primer probe sequence table of table 4
| Position | Detect classification | Sequence(5’—3’) |
| R550K | Sense primer a | GAGTAACAGACTAGCTAGAGAC |
| R550K | Anti-sense primer a | TTATTCCAATAGGTATGGTA |
| R550K | Probe a | TTTCTATGGAGTCACAAGTAAG |
| E545K | Sense primer b | TACAGAGTAACAGACTAGCTAGA |
| E545K | Anti-sense primer b | CATGCTGAGATCAGCCAAA |
| E545K | Probe b | CTCTCTCTGAAATCACTAAGCA |
| K642E | Sense primer c | CTTGACATCAGTTTGCCAGTTGT |
| K642E | Anti-sense primer c | GACAATAAAAGGCAGCTTGGACA |
| K642E | Probe c | CTCATGTCTGAACTCGAAGTC |
| D816V | Sense primer d | TCTCCTCCAACCTAATAGTGT |
| D816V | Anti-sense primer d | TGCAGGACTGTCAAGGAGAG |
| D816V | Probe d | TGGTCTAGCCAGAGTCATCAA |
2) histone deacetylase dilution is not added in sample extraction step.
3) PCR amplification programs are：95 DEG C of the condition in pre-degeneration stage, 10min；1 circulation；94 DEG C of 10s, 52 DEG C of 15s, 60
DEG C 45s, 36 circulations；98 DEG C, 10min, 1 circulation；12 DEG C of 30min, 1 circulation；4 DEG C, insulation.
Take 50 samples that embodiment 1 is respectively adopted and the kit of comparative example 1 is detected, the c-kit bases of 50 samples
Because mutation abundance as shown in table 5 and table 6.
The comparative example 1 of table 5 detects the c-kit gene mutations abundance table (%) of 50
The embodiment 1 of table 6 detects the c-kit gene mutations abundance table (%) of 50
As a result show, use the positive rate of kit of comparative example 1 for the abundance of 12%, c-kit gene mutations
Average value is 2.0%；Use positive rate being averaged for the abundance of 16%, c-kit gene mutations of the kit of embodiment 1
It is worth for 6.7%.
Comparative example 2
In order to optimize the detection kit of this comparative example, remainder is same as Example 1, and difference is：
1) probe does not carry out LNA modification.
2) histone deacetylase (SIR2 is added in the blood plasma after being separated when using or the DNA sample after extracting
Enzyme).
The positive sample of 20 c-kit gene mutations is taken, takes 20 samples that the examination of embodiment 1 and comparative example 2 is respectively adopted
Agent box is detected that the abundance of the c-kit gene mutations of 20 samples is as shown in table 7 and table 8.
The comparative example 2 of table 7 detects the abundance table (%) of the c-kit gene mutations of 20
The embodiment 1 of table 8 detects the abundance table (%) of the c-kit gene mutations of 20
Histone deacetylase is added in blood plasma after being separated during due to using or the DNA sample after extracting
High 6~10ng/ul of ctDNA concentration ratios comparative example 2 in (SIR2 enzymes), the sample serum of embodiment 1.The c-kit of embodiment 1
The average value of the c-kit gene mutation abundance of the abundance ratio comparative example 2 of gene mutation is high by 4.4%.
Above-described embodiment is only intended to clearly illustrate example of the present invention, and is not the embodiment party to the present invention
The restriction of formula.For those of ordinary skill in the field, other differences can also be made on the basis of the above description
The change or variation of form.There is no necessity and possibility to exhaust all the enbodiments.And these belong to the essence of the present invention
Among the obvious changes or variations that god extends out is still in protection scope of the present invention.
SEQUENCE LISTING
<110>Shanghai Saian Biological Medical Technology Co., Ltd.
<120>C-kit detection in Gene Mutation primed probe and its kit
<130>Nothing
<160> 12
<170> PatentIn version 3.3
<210> 1
<211> 17
<212> DNA
<213>It is artificial synthesized
<400> 1
tctctctgaa atcactg 17
<210> 2
<211> 15
<212> DNA
<213>It is artificial synthesized
<400> 2
cagttatttt ttctg 15
<210> 3
<211> 16
<212> DNA
<213>It is artificial synthesized
<400> 3
ctatggagtc acaagt 16
<210> 4
<211> 15
<212> DNA
<213>It is artificial synthesized
<400> 4
ctagagacaa tgaat 15
<210> 5
<211> 15
<212> DNA
<213>It is artificial synthesized
<400> 5
cacttacctg tgact 15
<210> 6
<211> 15
<212> DNA
<213>It is artificial synthesized
<400> 6
tctgaaatca ctaag 15
<210> 7
<211> 16
<212> DNA
<213>It is artificial synthesized
<400> 7
ttccaatttt agcgag 16
<210> 8
<211> 15
<212> DNA
<213>It is artificial synthesized
<400> 8
tattcatgtg attac 15
<210> 9
<211> 15
<212> DNA
<213>It is artificial synthesized
<400> 9
tgtctgaact cgaag 15
<210> 10
<211> 17
<212> DNA
<213>It is artificial synthesized
<400> 10
tcctccttac tcatggt 17
<210> 11
<211> 16
<212> DNA
<213>It is artificial synthesized
<400> 11
agcagagaat gggtac 16
<210> 12
<211> 15
<212> DNA
<213>It is artificial synthesized
<400> 12
gtctagccag agtca 15
Claims (10)
1. a kind of c-kit detection in Gene Mutation primed probe, it is characterised in that：Including for detecting the 550th codon R550K
The upstream and downstream primer A and mutant probe A of point, upstream and downstream primer B and mutation for detecting the 545th codon E545K sites are visited
Pin B, upstream and downstream primer C and mutant probe C for detecting the 642nd codon K642E sites, and for detecting that the 816th is close
The upstream and downstream primer D and mutant probe D in numeral D816V sites；
The nucleotide sequence of the sense primer A is as shown in SEQ ID No.1, the nucleotide sequence such as SEQ of the anti-sense primer A
Shown in ID No.2, the nucleotide sequence of the probe A as shown in SEQ ID No.3,
The nucleotide sequence of the sense primer B is as shown in SEQ ID No.4, the nucleotide sequence such as SEQ of the anti-sense primer B
Shown in ID No.5, the nucleotide sequence of the probe B as shown in SEQ ID No.6,
The nucleotide sequence of the sense primer C is as shown in SEQ ID No.7, the nucleotide sequence such as SEQ of the anti-sense primer C
Shown in ID No.8, the nucleotide sequence of the probe C as shown in SEQ ID No.9,
The nucleotide sequence of the sense primer D is as shown in SEQ ID No.10, and the nucleotide sequence of the anti-sense primer D is such as
Shown in SEQ ID No.11, the nucleotide sequence of the probe D is as shown in SEQ ID No.12.
2. c-kit detection in Gene Mutation primed probe according to claim 1, it is characterised in that：Described probe A, B, C, D
LNA modifications are carried out.
3. c-kit detection in Gene Mutation primed probe according to claim 1, it is characterised in that：The upstream and downstream primer
The ultimate density of A, B, C, D in reaction system is 0.1~0.3 μM/L, and probe A, B, C, D are final dense in reaction system
Degree is 0.15~0.30 μM/L.
4. c-kit detection in Gene Mutation primed probe according to claim 3, it is characterised in that：The upstream and downstream primer A
Ultimate density in reaction system is 0.19 μM/L, and ultimate densities of the upstream and downstream primer B in reaction system is 0.2 μ
The ultimate density of M/L, the upstream and downstream primer C in reaction system is 0.19 μM/L, and the upstream and downstream primer D is in reaction system
In ultimate density be 0.2 μM/L；The ultimate density of described probe A, B, C, D in reaction system be respectively 0.22 μM/L,
0.19μM/L、0.21μM/L、0.18μM/L。
5. c-kit detection in Gene Mutation primed probe according to claim 1, it is characterised in that：Described probe A, B, C, D
5 ' end be provided with reporter fluorescence group, 3 ' end be provided with quenching fluorescence group.
6. a kind of c-kit detection in Gene Mutation products using primed probe as claimed in claim 1.
7. a kind of c-kit gene mutation detection kits, it is characterised in that：Including the numeral for preparing digital pcr reaction solution
PCR premixed liquids, droplets stable agent and primed probe mixed liquor；
The primed probe mixed liquor includes the upstream and downstream primer A and mutant probe for being used to detect the 550th codon R550K sites
A, upstream and downstream primer B and mutant probe B for detecting the 545th codon E545K sites, for detecting the 642nd codon
The upstream and downstream primer C and mutant probe C in K642E sites, and for detecting that the upstream and downstream in the 816th codon D816V sites is drawn
Thing D and mutant probe D；
The nucleotide sequence of the sense primer A is as shown in SEQ ID No.1, the nucleotide sequence such as SEQ of the anti-sense primer A
Shown in ID No.2, the nucleotide sequence of the probe A as shown in SEQ ID No.3,
The nucleotide sequence of the sense primer B is as shown in SEQ ID No.4, the nucleotide sequence such as SEQ of the anti-sense primer B
Shown in ID No.5, the nucleotide sequence of the probe B as shown in SEQ ID No.6,
The nucleotide sequence of the sense primer C is as shown in SEQ ID No.7, the nucleotide sequence such as SEQ of the anti-sense primer C
Shown in ID No.8, the nucleotide sequence of the probe C as shown in SEQ ID No.9,
The nucleotide sequence of the sense primer D is as shown in SEQ ID No.10, and the nucleotide sequence of the anti-sense primer D is such as
Shown in SEQ ID No.11, the nucleotide sequence of the probe D is as shown in SEQ ID No.12.
8. c-kit gene mutation detection kits according to claim 6, it is characterised in that：Described probe A, B, C, D enter
LNA modifications are gone；The ultimate density of described upstream and downstream primer A, B, C, D in reaction system is 0.1~0.3 μM/L, probe
The ultimate density of A, B, C, D in reaction system is 0.15~0.30 μM/L；Described probe A, B, C, D 5 ' ends are provided with report
Fluorophor, 3 ' ends are provided with quenching fluorescence group.
9. c-kit gene mutation detection kits according to claim 6, it is characterised in that：Also include histone and take off second
Acylated enzyme solutions, the digital pcr premixed liquid include archaeal dna polymerase, ultra-pure water, dNTPs mixed liquors, reference fluorescent ROX and
Buffer solution；The droplets stable agent includes mineral oil.
10. c-kit gene mutation detection kits according to claim 6, it is characterised in that：During reaction, reaction system
Include the volume of digital pcr premixed liquid 10, the volume of primed probe mixed liquor 2, the volume of droplets stable agent 2, the volume of template 1, sterilizing
The volume of ultra-pure water 5, the concentration of the template is 0.1ng/ul~1ng/ul.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710295454.XA CN107058548A (en) | 2017-04-28 | 2017-04-28 | C kit detection in Gene Mutation primed probes and its kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710295454.XA CN107058548A (en) | 2017-04-28 | 2017-04-28 | C kit detection in Gene Mutation primed probes and its kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107058548A true CN107058548A (en) | 2017-08-18 |
Family
ID=59605213
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710295454.XA Pending CN107058548A (en) | 2017-04-28 | 2017-04-28 | C kit detection in Gene Mutation primed probes and its kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107058548A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109306374A (en) * | 2017-09-08 | 2019-02-05 | 广州健天基因技术有限公司 | For detecting primer, detection method and the kit of mankind PIK3CA gene E545K mutation |
| CN109439758A (en) * | 2018-12-18 | 2019-03-08 | 武汉迪安医学检验实验室有限公司 | Kit for detecting C-kit mutant gene |
| CN110938696A (en) * | 2019-12-21 | 2020-03-31 | 武汉百泰基因工程有限公司 | Kit for detecting gastrointestinal stromal tumor related gene mutation |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105838779A (en) * | 2015-01-13 | 2016-08-10 | 上海宝藤生物医药科技股份有限公司 | Method for monitoring and controlling drug resistance of gastrointestinal stromal tumor patient to imatinib/sunitinib through ddPCR technology |
| CN106520931A (en) * | 2016-10-17 | 2017-03-22 | 上海赛安生物医药科技有限公司 | EGFR gene mutation detection primer probe and kit thereof |
-
2017
- 2017-04-28 CN CN201710295454.XA patent/CN107058548A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105838779A (en) * | 2015-01-13 | 2016-08-10 | 上海宝藤生物医药科技股份有限公司 | Method for monitoring and controlling drug resistance of gastrointestinal stromal tumor patient to imatinib/sunitinib through ddPCR technology |
| CN106520931A (en) * | 2016-10-17 | 2017-03-22 | 上海赛安生物医药科技有限公司 | EGFR gene mutation detection primer probe and kit thereof |
Non-Patent Citations (4)
| Title |
|---|
| JAIR BAR等: "Genetic Mutation Screen in Early Non-Small-Cell Lung Cancer （NSCLC） Specimens，159-165", 《CLINICAL LUNG CANCER》 * |
| LEI L CHEN等: "A mutation-created novel intra-exonic pre-mRNA splice site causes constitutive activation of KIT in human gastrointestinal stromal tumors，4271-4280", 《ONCOGENE》 * |
| MARC DANIELS等: "Spectrum of KIT/PDGFRA/BRAF mutations and Phosphatidylinositol-3-Kinase pathway gene alterations in gastrointestinal stromal tumors (GIST)，43-54", 《CANCER LETTERS》 * |
| 张霞等: "沉默信息调节因子2与基因转录调控，465-468", 《中国寄生虫学与寄生虫病杂志》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109306374A (en) * | 2017-09-08 | 2019-02-05 | 广州健天基因技术有限公司 | For detecting primer, detection method and the kit of mankind PIK3CA gene E545K mutation |
| CN109439758A (en) * | 2018-12-18 | 2019-03-08 | 武汉迪安医学检验实验室有限公司 | Kit for detecting C-kit mutant gene |
| CN110938696A (en) * | 2019-12-21 | 2020-03-31 | 武汉百泰基因工程有限公司 | Kit for detecting gastrointestinal stromal tumor related gene mutation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106987640A (en) | PIK3CA detection in Gene Mutation primed probe and its kit | |
| JP5531367B2 (en) | Target sequence enrichment | |
| CN103710460B (en) | Test kit of detection by quantitative EGFR genetic mutation and uses thereof | |
| CN107022619A (en) | KRAS gene mutation detection primer probe and its kit | |
| CN103667514B (en) | A kind of human interleukin 2 8B gene pleiomorphism fluorescence PCR detection reagent kits | |
| US11028431B2 (en) | Detection of short homopolymeric repeats | |
| CN111020031A (en) | Method for detecting tumor gene mutation by combining sequence specific blocker with specific PCR (polymerase chain reaction) program | |
| CN105567854A (en) | Primer combination for detecting human EGFR, KRAS and BRAF gene mutation and kit thereof | |
| CN113025701B (en) | Early screening method and kit for non-alcoholic fatty liver disease susceptibility gene | |
| CN107513578A (en) | A kind of nucleic acid Mass Spectrometry detection method early sieved for lung cancer driving gene and tumor susceptibility gene | |
| CN107058548A (en) | C kit detection in Gene Mutation primed probes and its kit | |
| CN107022620A (en) | N RAS detection in Gene Mutation primed probes and its kit | |
| CN107022621A (en) | BRAF gene mutation detection primer probe and its kit | |
| CN107513577A (en) | A kind of method of efficient detection EGFRT790M mutant and probe and kit for detection | |
| CN106811512B (en) | Method and kit for rapidly detecting human Y chromosome AZF region microdeletion and preparation thereof | |
| CN110592215A (en) | Composition for detecting nucleic acid sequence and detection method | |
| EP3494236B1 (en) | Method for conducting early detection of colon cancer and/or of colon cancer precursor cells and for monitoring colon cancer recurrence | |
| EP2540838A1 (en) | Kit for quantitative detection of braf mutation | |
| CN108913774B (en) | C-KIT somatic mutation gene detection KIT and detection method thereof | |
| TWI780315B (en) | Method of quantifying mutant allele burden of target gene | |
| CN111349691B (en) | Composition, kit and detection method for EGFR gene deletion mutation detection | |
| US11535897B2 (en) | Composite epigenetic biomarkers for accurate screening, diagnosis and prognosis of colorectal cancer | |
| CN109306374A (en) | For detecting primer, detection method and the kit of mankind PIK3CA gene E545K mutation | |
| CN105969874B (en) | Primer for detecting KRAS gene mutation in microcomponent combines and its application | |
| CN109652539A (en) | A kind of kit detected for EGFR T790M site mutation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170818 |
|
| RJ01 | Rejection of invention patent application after publication |