CN112011627B - Molecular marker related to backfat thickness of captive white pig, screening method and application - Google Patents
Molecular marker related to backfat thickness of captive white pig, screening method and application Download PDFInfo
- Publication number
- CN112011627B CN112011627B CN202011028842.XA CN202011028842A CN112011627B CN 112011627 B CN112011627 B CN 112011627B CN 202011028842 A CN202011028842 A CN 202011028842A CN 112011627 B CN112011627 B CN 112011627B
- Authority
- CN
- China
- Prior art keywords
- backfat
- thickness
- pig
- white
- molecular marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
- G16B20/20—Allele or variant detection, e.g. single nucleotide polymorphism [SNP] detection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Evolutionary Biology (AREA)
- Medical Informatics (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Theoretical Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a molecular marker related to the backfat thickness of an extended white pig, a screening method and application thereof, wherein the molecular marker related to the backfat thickness of the extended white pig is a nucleotide sequence of 100bp upstream and downstream of ASGA0004992, R at a 101-bit base of the nucleotide sequence is A or G, and when the 101-bit nucleotide of the sequence is G, the extended white pig has lower backfat thickness. The method can detect the genotype of the pig by adopting a gene chip technology in vitro, is used for evaluating the thickness of the backfat of the pig for a non-diagnosis purpose, and has the outstanding advantages of simplicity, quickness, high sensitivity, good specificity and the like. The invention aims to perfect breeding molecular markers related to the thickness trait of the tethered white backfat, utilize a 50K gene chip to type SNP, and use GWAS to screen the SNP related to the thickness of the tethered white backfat, thereby providing a new molecular marker resource and a marker-assisted selection application basis for genetic breeding of pigs.
Description
Technical Field
The invention relates to the technical field of pig molecular marker preparation, in particular to an SNP molecular marker of a nucleotide polymorphism site related to the backfat thickness of a captive large white pig, a screening method and application.
Background
China is the largest pork producing country and consumer country in the world, and with the rapid development of national economy, the demand of consumers for pork products is continuously increased. In recent years, with the development of society and the improvement of quality of life, people are pursuing a healthy lifestyle, and the concept of pork consumption is changed. Compared with the prior art, the high-quality pork is more popular among people. Therefore, pork producers and pork breeders are beginning to pay more attention to the improvement of carcass shape. The pig carcass shape is an important economic trait of pigs, including backfat thickness, eye muscle area, carcass lean meat percentage and the like, and is closely related to meat nutrition of people, meat food processing and economic benefit of pig industry. The correlation between backfat thickness, lean meat percentage, intramuscular fat content and other characters is obvious, which shows that the correlation has important influence on carcass characters and meat quality characters and is an important index for breeding.
The previous research shows that the backfat thickness character is a middle and high heritability character, the heritability is between 0.42 and 0.52, and the character has a certain improvement space, and a large genetic progress can be obtained by selecting through a proper method. However, due to the complexity of the mechanism for forming the backfat thickness trait, the backfat thickness trait can only be measured after slaughter, the cost is high, and adverse and antagonistic correlations exist among other traits, so that the traditional breeding method is difficult to make great genetic progress on the backfat thickness. In order to improve the selection accuracy, methods of assisted selection using molecular markers have been developed. Early molecular marker-assisted selection, while playing a positive role in genetic improvement of traits, was limited by the number of markers, and thus it was difficult to find a true causative gene. With the rapid development of sequencing technology and the more abundant genome annotation, the possibility of searching for a true causative gene by using massive markers in the whole genome range is made possible. Since the first genome-wide association analysis (GWAS) research published in 2005, with the continuous development of high-throughput sequencing technology, a large number of genetic markers have been detected in the genome-wide range of livestock, which has led to the wide application of GWAS in the genetic research of complex traits such as livestock economic traits and disease resistance. The GWAS searches SNP loci obviously associated with target traits in the whole genome range, and further determines candidate genes through linkage disequilibrium analysis, thereby providing an effective analysis means for analyzing the genetic basis of complex quantitative traits. In the past, the Liu Xin carries out GWAS on 6 carcass traits including backfat thickness, carcass weight and the like of a constructed attaching big white pig multiplied by Min pig F2 generation resource population, 25 SNPs are found to be obviously related to the backfat thickness trait, and finally HMGA1 is determined to be a major gene of the backfat thickness of the pig; GWAS is carried out on the reproductive capacity of the throughout life of the sow and the reproductive performance of 1-3 births of the sow by S.K.Onteru and the like, and 14, 19 and 12 significant SNPs are detected to be respectively related to the total litter size of the throughout life, the live litter size of the throughout life, the elimination number of births and the ratio of non-reproductive days. At present, research on backfat thickness trait is still in the exploration stage, and due to its great economic value, it is very necessary and meaningful to develop GWAS research on it.
Disclosure of Invention
The invention provides a molecular marker related to the backfat thickness of a captive large white pig, a screening method and application in order to overcome the defects in the prior art.
The invention is realized by the following technical scheme: the invention discloses a molecular marker related to the backfat thickness of a captive large white pig, which is a nucleotide sequence of 100bp upstream and downstream of ASGA0004992, and the nucleotide sequence of the molecular marker is shown as follows:
ATGATTATATTCATATCTCATCTTCTTTCCTCCCATTTTCACTCTGTAACAATGTGTATACACTCTACTTTTTCTGGCAATCCTATGAGAGTAACTGGTCR(A/G)TGGCCTCAGCTAAGTCCTGCCCTTCTTCTTGTGTACTACATACCAACATCCTCTCTTATCTACTCAAAGATATCCCTCCAGCAATTCTCATTTCTCTTTT；
r at the 101 th base of the sequence is A or G, and when the 101 th nucleotide of the sequence is G, the extended white pig has lower backfat thickness.
The above sequence can be used as a molecular marker for detecting the behavior of the thickened white backfat, R at the 101 st base of the sequence is an allelic mutation which generates a nucleotide polymorphism in the sequence, the molecular marker can be used as a molecular marker for detecting the behavior of the thickened white backfat, and when the 101 st nucleotide in the sequence is G, the thickened white backfat is lower.
The invention also discloses a screening method of the molecular marker related to the backfat thickness of the captive white pig, which comprises the following steps:
(1) extracting the total DNA of the tissue sample of the extended white pig, and carrying out quality detection on the DNA;
(2) typing by gene chip technology;
(3) based on a multi-label correlation model method, carrying out GWAS analysis by using an MLM model in an MVP software package under an R statistical environment;
(4) and carrying out association analysis on the significant SNP sites screened out by the MLM model and the thickness of the white backfat.
In the step (3) of the screening method, the back fat thickness trait of the line-added large white pig needs to be analyzed by a traditional Best Linear Unbiased estimation method (BLUP), the population mean and the sex are used as fixed effects, the joint-measured day age is used as covariates, the individual effect and the batch effect are used as random effects, the individual random effect is calculated, and the random effect is used for constructing a new phenotype (pseudo-phenotype) for subsequent GWAS.
The molecular marker is applied to marker-assisted selection of the backfat thickness character of the captive large white pig. The molecular marker is used for the correlation analysis of the gene or genotype related to the white-pig with the back fat thickness of the white-pig with the additional line for the non-diagnosis purpose, and provides a new molecular marker for the molecular marker-assisted selection of the back fat thickness character of the white-pig with the additional line.
The invention has the beneficial effects that: the method can detect the genotype of the pig by adopting a gene chip technology in vitro, is used for evaluating the backfat thickness of the pig for non-diagnosis purposes, and has the outstanding advantages of simplicity, rapidness, high sensitivity, good specificity and the like compared with methods such as PCR-RFLP and the like in the prior art. The invention aims to perfect breeding molecular markers related to the thickness trait of the tethered white backfat, utilize a 50K gene chip to type SNP, and use GWAS to screen the SNP related to the thickness of the tethered white backfat, thereby providing a new molecular marker resource and a marker-assisted selection application basis for genetic breeding of pigs. The MVP software and the mixed linear model MLM are used for GWAS analysis, SNP sites which are obviously related to backfat thickness are screened out, and a new genetic basis is provided for development of additional white backfat thickness character DNA marker auxiliary selection and whole genome selection. The molecular marker can be used for marker-assisted selection of the back fat thickness character of the captive large white pig.
The invention relates to an SNP molecular marker influencing the calibre of white backfat and application thereof, wherein the molecular marker is cloned from the accession number ASGA 0004992. The gene is subjected to typing screening by a gene chip technology to obtain a molecular marker related to the tethered white pig backfat thickness, the nucleotide sequence of the marker is shown in the attached figure 2 of the specification, an A/G allelic gene mutation exists at the 101 th base of the sequence, and when the 101 th nucleotide of the sequence is G, the tethered white pig has lower backfat thickness. The invention discloses a method for screening molecular markers related to an additive white backfat thickness trait and application of a correlation analysis method thereof, and provides a new SNP molecular marker for marker-assisted selection of the additive white backfat thickness trait.
Drawings
FIG. 1 is a schematic diagram of the general technical process of the method for screening molecular markers of the present invention.
FIG. 2 shows the nucleotide sequence of 100bp upstream and downstream of ASGA0004992 clone of the present invention and the nucleotide sequence of the molecular marker of the present invention.
In FIG. 2, the length of the nucleotide sequence is shown as 201bp, an A/G allelic mutation exists at the 101 st base position of the sequence, and the English letter R at the 101bp position is a mutation site.
FIG. 3 is a Manhattan diagram of the present invention.
In FIG. 3, the white backfat thickness property of the additive line is studied, and the black circles and arrows point to the markers of the molecular markers screened by the invention, and the markers are located on the No. 1 chromosome of the pig.
Description of the Gene sequence Listing: the sequence table SEQ ID NO 1 is a nucleotide sequence of the molecular marker related to the thickness of the tethered white backfat screened by the invention, the length is 201bp, and an allelic mutation (A/G) exists at the 101bp position of the sequence, and the allelic mutation causes the polymorphism of the sequence shown in the SEQ ID NO 1.
Detailed Description
The invention is described in detail below with reference to the figures and the detailed description.
The invention discloses a molecular marker related to the backfat thickness of a captive large white pig, which is a nucleotide sequence of 100bp upstream and downstream of ASGA0004992, and the nucleotide sequence of the molecular marker is shown as follows:
ATGATTATATTCATATCTCATCTTCTTTCCTCCCATTTTCACTCTGTAACAATGTGTATACACTCTACTTTTTCTGGCAATCCTATGAGAGTAACTGGTCR(A/G)TGGCCTCAGCTAAGTCCTGCCCTTCTTCTTGTGTACTACATACCAACATCCTCTCTTATCTACTCAAAGATATCCCTCCAGCAATTCTCATTTCTCTTTT；
r at the 101 th base of the sequence is A or G, and when the 101 th nucleotide of the sequence is G, the extended white pig has lower backfat thickness.
The above sequence can be used as a molecular marker for detecting the behavior of the thickened white backfat, R at the 101 st base of the sequence is an allelic mutation which generates a nucleotide polymorphism in the sequence, the molecular marker can be used as a molecular marker for detecting the behavior of the thickened white backfat, and when the 101 st nucleotide in the sequence is G, the thickened white backfat is lower.
The invention also discloses a screening method of the molecular marker related to the backfat thickness of the captive white pig, which comprises the following steps: (1) extracting the total DNA of the tissue sample of the extended white pig, and carrying out quality detection on the DNA; (2) typing by gene chip technology; (3) based on a multi-label correlation model method, carrying out GWAS analysis by using an MLM model in an MVP software package under an R statistical environment; (4) and carrying out association analysis on the significant SNP sites screened out by the MLM model and the thickness of the white backfat.
In the step (3) of the screening method, the back fat thickness of the tethered large white pig needs to be estimated by using a traditional optimal linear unbiased estimation method BLUP, the population mean and the gender are used as fixed effects, the measurement day age is used as a covariate, the individual effect and the batch effect are used as random effects, the individual random effect is calculated and used for constructing a new phenotype for subsequent GWAS analysis.
The molecular marker is applied to marker-assisted selection of the backfat thickness character of the captive large white pig. The molecular marker is used for the correlation analysis of the gene or genotype related to the white-pig with the back fat thickness of the white-pig with the additional line for the non-diagnosis purpose, and provides a new molecular marker for the molecular marker-assisted selection of the back fat thickness character of the white-pig with the additional line.
Example 1: genotyping detection:
the method comprises the following steps of automatically extracting the total DNA of the tissue sample of the captive big white pig by using a magnetic bead method genome extraction kit:
(1) taking a proper amount of tissue sample into a 1.5mL centrifuge tube;
(2) adding 500 mu L of lysis solution and 5 mu L of proteinase K (20 mg/mL) into a centrifuge tube, oscillating and uniformly mixing for 30 seconds, placing the mixture into a 65 ℃ oven or a metal bath, and carrying out lysis for 30 minutes to 1 hour;
(3) after completion of lysis, the whole supernatant was transferred to a deep well plate (labeled as first), and 350. mu.L of isopropanol was added to each well;
(4) the first deep hole plate is placed on a station 1 of a nucleic acid extraction instrument, and the deep hole plates filled with magnetic beads, a washing solution, the second washing solution, the third washing solution and an eluent are respectively placed on stations 2-6. Turning on the power supply of the instrument, and setting instrument parameters as shown in the following table after the instrument completes self-inspection;
(5) running the program, wherein after the program is finished, the instrument automatically stops, and the station 6 enters a 4 ℃ storage program to temporarily store the sample;
(6) the DNA sample can be directly used for downstream experiments, or can be temporarily stored for a plurality of days at 4 ℃ after being packaged, and if the DNA sample is stored for a long time, the DNA sample can be packaged or transferred to a new container and placed in a refrigerator at the temperature of-20 ℃ for long-term storage.
Determination and quality control of SNP genotype: typing with GeneSeek Porcine 50K SNP chip, quality control of obtained genotype data with PLINK v1.9, and rejection rate<90% sub-allelic frequency MAF<0.05 deviation from Hardy Winberg HWE<10-7SNP marker and detection Rate of<90% of individuals, ultimately 2269 and 35666 SNPs were used for GWAS studies.
Example 2: the application of the ASGA0004992 molecular marker typing method in the correlation analysis of the back fat thickness traits of the captive large white pigs.
(1) B, performing phenotype pretreatment on backfat thickness of the tethered white pig:
the line-added white backfat thickness property needs to use a mixed linear model MLM, the population mean and the gender are used as fixed effects, the individual effect and the batch effect are used as random effects, the measured age is used as a covariate, and the individual estimated breeding value is calculated and used as a new constructed table for subsequent GWAS analysis. Constrained maximum likelihood estimation (REML) and BLUP analysis were performed using a DMUAI module in a DMU statistical environment, with data containing 31333 individuals. The concrete model is as follows:
ykljbm =μ+IDl+Sexj+Agek+Zb+εkljbm。
wherein, ykljbmIs the first individual backfat thickness trait original phenotype value; μ is population mean (fixed effect); sexjIs gender (fixed effect); agekIs the node measurement age in days (covariate); IDlIs an individual additive effect (random effect); zbIs a batch effect (random effect) that is assumed to follow a normal distribution: id to N (0, A sigma)2 id ），σ2 idRepresenting individual effect variance, A representing a genetic relationship matrix between individuals; epsilonkljbmIs the model residual effect, assumed to follow a normal distribution: epsilon to N (0, I sigma)2 ε)，σ2 εRepresenting the residual variance, I is the corresponding unity correlation matrix. The Estimated Breeding Values (EBV) of individuals were recorded by the phenotypical Estimated by the model, and the reverse regression breeding value (DEBV) was calculated as the new phenotype using the DRP package in the R language.
(2) And (3) carrying out whole genome correlation analysis on the backfat thickness of the captive white pig:
the test swinery used for correlation analysis of genotype and backfat thickness traits was a captive white pig. The DNA used for genotyping is extracted from a pure breed inbred big white pig tissue sample. And (3) carrying out GWAS analysis by utilizing an MLM model in the MVP software package under the R statistical environment based on a multi-label correlation model method. The specific model is as follows:
yijk=Mi+Sj+εijk。
wherein: y isijkIs an estimated breeding value of the genotyped individual calculated according to the mixed linear model; miIs the genotypic effect of the i pseudo QTNs; sjIs the jth mark effect; epsilonijkIs a residual effect, assumed to follow a normal distribution: epsilon to N (0, I sigma)2 ε)，σ2 εRepresenting the residual variance, I is the corresponding unity correlation matrix.
(3) ASGA0004992 molecular marker typing result and backfat thickness correlation analysis:
the mixed linear model MLM is used for the correlation analysis of the ASGA0004992 molecular marker and the pig backfat thickness. The concrete model is as follows:
yiklbm=μ+IDl+Gi+Agek+Zb+εiklbm。
yiklbmis the original phenotypic value of the mth individual backfat thickness trait; μ is the population mean; giIs a genotype effect; agekIs the node measurement age in days (covariate); IDlIs an individual additive effect (random effect); zbIs a batch effect (random effect) that is assumed to follow a normal distribution: id to N (0, A sigma)2 id），σ2 idRepresenting individual effect variance, A representing a genetic relationship matrix between individuals; epsiloniklbmIs the model residual effect, obeying a normal distribution: epsilon to N (0, I sigma)2 ε)，σ2 εRepresenting the residual variance, I is the corresponding unity correlation matrix. The differences of the backfat thickness trait among the three genotype individuals were significantly analyzed using the F test, and the analysis results are shown in table 1.
Table 1: polymorphism of ASGA0004992 and the effect of different genotypes on the white backfat thickness of the additive line.
Table 1 illustrates: p <0.05 is significantly different; p <0.01 is very significantly different. As can be seen from Table 1, for the additive white backfat thickness trait, the backfat thickness of the individual with the genotype of AG is significantly lower than that of the AA individual, the backfat thickness of the individual with the genotype of GG is significantly lower than that of the AA individual, and the backfat thickness of the individual with the genotype of GG is significantly lower than that of the AG individual.
Taken together, G is an allele that contributes to the reduction of backfat thickness.
Finally, it should be noted that the above-mentioned contents are only used for illustrating the technical solutions of the present invention, and not for limiting the protection scope of the present invention, and that the simple modifications or equivalent substitutions of the technical solutions of the present invention by those of ordinary skill in the art can be made without departing from the spirit and scope of the technical solutions of the present invention.
Sequence listing
<110> Chifeng breeding pig ecological technology group limited
Huazhong Agricultural University
<120> molecular marker related to backfat thickness of Canadian white pig, screening method and application
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 201
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atgattatat tcatatctca tcttctttcc tcccattttc actctgtaac aatgtgtata 60
cactctactt tttctggcaa tcctatgaga gtaactggtc rtggcctcag ctaagtcctg 120
cccttcttct tgtgtactac ataccaacat cctctcttat ctactcaaag atatccctcc 180
agcaattctc atttctcttt t 201
Claims (1)
1. The application of a molecular marker related to the backfat thickness of a white adducted pig is characterized in that: the molecular marker related to the back fat thickness of the captive large white pig is a nucleotide sequence of 100bp upstream and downstream of ASGA0004992, and the nucleotide sequence of the molecular marker is shown as follows:
ATGATTATATTCATATCTCATCTTCTTTCCTCCCATTTTCACTCTGTAACAATGTGTATACACTCTACTTTTTCTGGCAATCCTATGAGAGTAACTGGTCRTGGCCTCAGCTAAGTCCTGCCCTTCTTCTTGTGTACTACATACCAACATCCTCTCTTATCTACTCAAAGATATCCCTCCAGCAATTCTCATTTCTCTTTT；
r at the 101 th base of the sequence is A or G, and when the 101 th nucleotide of the sequence is G, the extended big white pig has lower backfat thickness;
the molecular marker is applied to marker-assisted selection of the backfat thickness character of the captive large white pig.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011028842.XA CN112011627B (en) | 2020-09-27 | 2020-09-27 | Molecular marker related to backfat thickness of captive white pig, screening method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011028842.XA CN112011627B (en) | 2020-09-27 | 2020-09-27 | Molecular marker related to backfat thickness of captive white pig, screening method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112011627A CN112011627A (en) | 2020-12-01 |
| CN112011627B true CN112011627B (en) | 2022-02-25 |
Family
ID=73527781
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011028842.XA Active CN112011627B (en) | 2020-09-27 | 2020-09-27 | Molecular marker related to backfat thickness of captive white pig, screening method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112011627B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112695104B (en) * | 2020-09-14 | 2022-04-26 | 华中农业大学 | SNP molecular marker for deep character of eye muscle of white pig and application |
| CN113186302B (en) * | 2021-06-04 | 2022-02-01 | 华中农业大学 | Sex specific molecular marker of Megalobrama amblycephala hybrid Pioneer No. 2 and application |
| CN113699248A (en) * | 2021-07-26 | 2021-11-26 | 华南农业大学 | SNP molecular marker related to pig backfat thickness and application thereof |
| CN115287367A (en) * | 2022-06-24 | 2022-11-04 | 中国农业大学 | Pig backfat thickness character breeding 35K SNP sequencing and typing chip and application |
| CN115992252B (en) * | 2022-08-10 | 2023-12-19 | 武汉中粮肉食品有限公司 | SNP molecular marker related to backfat thickness character of long white pigs and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20100132321A (en) * | 2009-06-09 | 2010-12-17 | 대한민국(농촌진흥청장) | Molecular markers and method for selection of the backfat thickness trait in pig using single nucleotide polymorphism of lepr gene |
| CN110885889A (en) * | 2018-09-10 | 2020-03-17 | 北京康普森生物技术有限公司 | Method for identifying pig backfat thickness based on rs81469622 locus genotype and application |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| PL2612904T3 (en) * | 2010-08-31 | 2017-07-31 | Centro Superior De Investigación En Salud Pública (Csisp) | Anticaries compositions and probiotics/prebiotics |
| KR20190045958A (en) * | 2017-10-24 | 2019-05-07 | 주식회사 정피엔씨연구소 | Single nucleotide polymorphism markers associated with backfat thickness trait in pig and use thereof |
| CN109929935B (en) * | 2017-12-15 | 2022-08-16 | 北京康普森生物技术有限公司 | Method for identifying pig backfat thickness based on rs80995809 locus genotyping and application thereof |
| CN111254205B (en) * | 2020-03-30 | 2022-09-16 | 赤峰家育种猪生态科技集团有限公司 | Molecular marker influencing average daily gain of Jiazhi big white pig, screening method and application |
-
2020
- 2020-09-27 CN CN202011028842.XA patent/CN112011627B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20100132321A (en) * | 2009-06-09 | 2010-12-17 | 대한민국(농촌진흥청장) | Molecular markers and method for selection of the backfat thickness trait in pig using single nucleotide polymorphism of lepr gene |
| CN110885889A (en) * | 2018-09-10 | 2020-03-17 | 北京康普森生物技术有限公司 | Method for identifying pig backfat thickness based on rs81469622 locus genotype and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112011627A (en) | 2020-12-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112011627B (en) | Molecular marker related to backfat thickness of captive white pig, screening method and application | |
| CN109837348B (en) | Molecular marker associated with boar sperm concentration character | |
| CN112322753B (en) | SNP molecular marker related to intramuscular fat of pork and application thereof | |
| CN110747279B (en) | Fugu obscurus SNP molecular marker and application thereof in genetic breeding | |
| CN109371143B (en) | SNP molecular marker associated with pig growth traits | |
| CN111254205B (en) | Molecular marker influencing average daily gain of Jiazhi big white pig, screening method and application | |
| CN109554487B (en) | Molecular marker associated with boar semen volume character and application | |
| CN109371144B (en) | SNP molecular marker associated with pig growth traits | |
| CN108998541B (en) | SNP (Single nucleotide polymorphism) marker primer pair related to hip circumference traits of Suhuai pig legs and application thereof | |
| CN103911373A (en) | Major SNP marker capable of affecting pork aliphatic acid and application of major SNP marker in breeding pigs meat quality heredity improvement | |
| Teng et al. | Performance of whole genome prediction for growth traits in a crossbred chicken population | |
| Salisu et al. | Molecular markers and their Potentials in Animal Breeding and Genetics | |
| CN111926086A (en) | Molecular marker influencing oblique growth of chicken body and application thereof | |
| CN113699246B (en) | SNP molecular marker affecting pig feed conversion efficiency character and application thereof | |
| CN104911273B (en) | A kind of chicken FABP1 gene molecule genetic marker related to the excellent production traits of chicken and its application | |
| CN107988388B (en) | One kind SNP marker relevant to pig dewclaw undue growth character and application thereof | |
| CN113789393A (en) | Molecular marker related to chicken carcass traits and application thereof | |
| CN112980962A (en) | SNP marker related to birth weight trait of pig and application thereof | |
| CN116287281B (en) | SNP molecular marker related to eye muscle area and lean muscle performance of Changbai pigs and application thereof | |
| CN112695104B (en) | SNP molecular marker for deep character of eye muscle of white pig and application | |
| Rostamzadeh Mahdabi et al. | Genomic heritability and correlation between carcass traits in Japanese Black cattle evaluated under different ceilings of relatedness among individuals | |
| CN113151510B (en) | Molecular marker related to chicken testicular character and application thereof | |
| CN113322332B (en) | Molecular marker related to length of cockscomb and application thereof | |
| CN110452997B (en) | Molecular marker related to boar sperm teratogenesis rate | |
| Kadarmideen et al. | Combined genetic, genomic and transcriptomic methods in the analysis of animal traits. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230111 Address after: 024048 Chifeng Jiayu Seed Industry Technology Co., Ltd. at 345+600 stake along 306 National Highway, Houwujia Village, Shangguandi Town, Songshan District, Chifeng City, Inner Mongolia Autonomous Region Patentee after: Chifeng Jiayu Seed Industry Technology Co.,Ltd. Patentee after: HUAZHONG AGRICULTURAL University Address before: 024050 Chifeng home breeding pig Ecological Technology Group Co., Ltd., houwujia village, Shangguandi Town, Songshan District, Chifeng City, Inner Mongolia Autonomous Region Patentee before: CHIFENG BEST GENETICS ECOLOGICAL TECHNOLOGY GROUP CO.,LTD. Patentee before: HUAZHONG AGRICULTURAL University |
|
| TR01 | Transfer of patent right |