CN112010948A - Mutant protein applied to low-temperature degradation of hydroquinone wastewater and construction method - Google Patents

Abstract

The invention belongs to the field of genetic engineering, and in particular relates to a mutant protein and a construction method for low-temperature degradation of hydroquinone wastewater. The amino acid sequence of the mutant protein applied to the low-temperature degradation of hydroquinone wastewater is shown in SEQ ID NO.1, including the mutant protein hqdA _mu and the mutant protein hqdB _mu , and the amino acid sequence is shown in SEQ ID NO.2 and SEQ ID NO. NO.3 shows. The mutant protein hqdA _mu is to mutate glycine at position 17, leucine at position 88 and valine at position 133 of protein hqdA into arginine, aspartic acid and histidine, respectively; the The mutant protein hqdB _mu is the 39-position methionine and the 148-position glutamic acid of the protein hqdB are mutated to valine and lysine, respectively. The mutant protein prepared by the invention has the characteristics of efficiently degrading phenol-containing wastewater at low temperature, and can be used in degrading low-temperature phenol-containing wastewater.

Description

A kind of mutant protein applied to low temperature degradation of hydroquinone wastewater and construction method

technical field

The invention belongs to the field of genetic engineering, and in particular relates to a mutant protein and a construction method for low-temperature degradation of hydroquinone wastewater.

Background technique

Phenol-containing wastewater in the wastewater discharged from the chemical industry is a type of wastewater that is difficult to treat. Due to the low content of phenolic substances, it can effectively kill microorganisms. Therefore, the phenol-containing wastewater produced by the chemical industry cannot be directly discharged into the sewage treatment tank. At present, the method mainly used for the degradation of phenolic substances in phenol-containing wastewater is the iron-carbon degradation method: iron-carbon can form micro-electrodes in acidic water, and these micro-electrodes can ionize and decompose phenolic substances. The phenolic content in the wastewater treated by the iron-carbon reaction is greatly reduced, and it will not kill the microorganisms that degrade the wastewater. At this time, the waste water can be discharged into the sewage treatment tank. Due to the relatively low temperature in autumn and winter in most parts of northern China, the iron-carbon reaction cannot effectively degrade phenolic substances in wastewater, so it is difficult to meet the standard of microbial treatment in sewage treatment pools.

The genes that have been reported for hydroquinone degradation are hqdA and hqdB, both of which are derived from Sphiningomonassp.strain TTNP3. The proteins co-expressed by hqdA and hqdB in bacteria can form dimers to catalyze the degradation of hydroquinone. By studying the catalytic kinetics of the HqdA and HqdB dimer protein after purification, it was found that the efficiency of the protein to catalyze the degradation of hydroquinone at room temperature was 1.4mol hydroquinone/mol protein. Km=2.2 μM. However, the enzyme's ability to degrade hydroquinone at 4 °C is relatively weak, and its catalytic efficiency is only 1/35 of the catalytic efficiency at room temperature, and it cannot degrade hydroquinone at low temperature.

The invention specifically provides a kind of directed evolution of hqdA and hqdB by using error-prone PCR technology, selecting mutant proteins HqdA _mu and HqdB _mu after screening the mutants, and using Escherichia coli to recombine and co-express HqdA _mu and HqdB _mu , After culturing pETduet-1-hqdAB _mu 2, high-density fermentation and protein expression induction were performed to obtain an induced fermentation broth, and then E. coli was isolated from the fermentation broth and disrupted to obtain an E. coli lysate of the mutant protein. The mutant protein prepared by the invention has the characteristics of efficiently degrading phenol-containing wastewater at low temperature.

SUMMARY OF THE INVENTION

The purpose of the present invention is to provide a mutant protein for low-temperature degradation of hydroquinone wastewater, and the mutant protein can efficiently degrade phenol-containing wastewater at low temperature.

Another object of the present invention is to provide the above-mentioned construction method and application of the mutant protein for low-temperature degradation of hydroquinone wastewater.

In order to achieve the above object, the technical scheme adopted in the present invention is:

A mutant protein whose amino acid sequence is shown in SEQ ID NO.1.

The mutein comprises a mutein hqdA _mu and a mutein hqdB _mu , the amino acid sequence of the mutein hqdA _mu is shown in SEQ ID NO.2, and the amino acid sequence of the mutein hqdB _mu is shown in SEQ ID NO.3.

The mutant protein hqdA _mu is to mutate glycine at position 17, leucine at position 88 and valine at position 133 of protein hqdA into arginine, aspartic acid and histidine, respectively; the The mutant protein hqdB _mu is the 39-position methionine and the 148-position glutamic acid of the protein hqdB are mutated to valine and lysine, respectively.

A method for constructing a mutant protein for low-temperature degradation of hydroquinone wastewater, comprising the following steps:

Step 1. Take the genome of Sphingomonas sp.strain as a PCR amplification template, use PCR amplification primers P1 and P2 to amplify hqdA, and use PCR amplification primers P3 and P4 to amplify hqdB, wherein P1 , the nucleotide sequences of P2, P3, and P4 are as follows:

P1:AAGGATCCGATGGCCGACGTGGTCACC;

P2:GCAAGCTTTCAGGCCGCCTCGGTCTGG;

P3: AACATATGATGGCTATGTCCGAAGCACTTG;

P4: AACTCGAGTCAGAAAGTGACCGGGACCAC;

The amplified products were purified and digested respectively, and the digested products were respectively connected to the E. coli co-expression vector pETduet-1 to construct pETduet-1-hqdA and pETduet-1-hqdB;

Step 2: Amplify hqdB with PCR amplification primers P3, P4 and error-prone PCR kit, amplify hqdA with PCR amplification primers P1, P2 and error-prone PCR kit, and purify and digest the amplified product respectively, The enzyme cleavage products are respectively connected to the pETduet-1-hqdA and pETduet-1-hqdB obtained in step 1 to construct pETduet-1-hqdAB _mu and pETduet-1-hqdBA _mu ;

Step 3, transform the pETduet-1-hqdAB _mu and pETduet-1-hqdA _mu B obtained in step 2 into Escherichia coli BL21 respectively for colony culture, and the obtained colony is transferred into TB medium for bacterial culture;

Step 4. Perform sequence optimization with the optimal codons of E. coli and synthesize hqdA _mu and hqdB _mu from the whole gene, respectively construct them into the co-expression vector pETduet-11 of E. coli, and construct pETduet-1-hqdAB _mu 2;

Step 5. Transform pETduet-1-hqdAB _mu 2 into Escherichia coli BL21 and inoculate it into the medium for high-density fermentation. After 16-20 hours of fermentation, add 5-13 L of feed solution, and the feeding time is 4-10 hours. , add sterilized yeast extract to a final concentration of 1-4% after the flow addition, add IPTG with a concentration of 0.1-0.8mM to induce overnight at 20-28°C to obtain a fermentation broth, and flow 5-13L during the induction process The feeding liquid is induced, and the feeding time is 12-24 h. After the feeding is completed, Escherichia coli is separated from the fermentation broth to prepare the mutant protein.

Preferably, in the third step, Escherichia coli BL21 is cultured in LB solid medium containing 0.005-0.015g/L hydroquinone and 0.1-0.8mM IPTG at 14°C-20°C for 48-60 hours. Since Escherichia coli is extremely sensitive to hydroquinone, it will die in the hydroquinone medium containing 0.005-0.015g/L, so IPTG needs to be added.

Preferably, in the inoculation in the fifth step, a high-density fermentation medium of Escherichia coli is used, and the inoculation ratio is 1:50-1:100.

Preferably, in the step 5, the feed solution is composed of glucose, magnesium sulfate, vitamins and trace elements;

Preferably, the induction feeding solution in the fifth step is composed of glycerol, magnesium sulfate, vitamin B1 and trace elements.

Application of mutant proteins in low-temperature degradation of phenol-containing wastewater.

The beneficial effects of the present invention are:

Compared with the wild-type protein, the mutant protein provided by the present invention has an improved ability to degrade hydroquinone at 20-25°C, but there is no significant difference; it degrades hydroquinone at a low temperature of 2-4°C The capacity of the enzyme is 27.3 times that of the wild-type protein, and the enzyme activity is significantly improved, and its catalytic activity is 6.4 μmol/min/mg.

The Escherichia coli lysate was diluted in different proportions and added to the wastewater containing 1g/L hydroquinone, and it was found that 14-24g of Escherichia coli lysate contained 0.5-2g/L hydroquinone for 1 ton at 4°C. After 8-16h of wastewater treatment, the hydroquinone content is only 20-80ppm. The content of hydroquinone is significantly reduced, that is, the mutant protein prepared by the present invention can degrade hydroquinone in a low temperature environment, and the degradation activity is extremely high.

Description of drawings

Figure 1 Construction process of pETduet-1-hqdABmu2

Figure 2 Column comparison of the catalytic efficiency of wild-type protein and mutant protease activity at 25°C and 4°C

Among them, Wt 25°C is the enzymatic catalytic efficiency of the wild-type protein at 25°C, Wt 4°C is the enzymatic catalytic efficiency of the wild-type protein at 4°C, and Mu 25°C is the enzymatic catalytic efficiency of the mutant protein at 25°C Efficiency, Mu 4°C is the catalytic efficiency of the mutant protein at 4°C.

Figure 3 shows the variation trend of hydroquinone concentration in wastewater with time after treating 500 ppm hydroquinone wastewater with Escherichia coli fermentation broth (14g/t) expressing mutant protein at high density at low temperature (4°C). The coordinate is the treatment time, and the ordinate is the hydroquinone concentration in the wastewater.

Fig. 4 After treating 2000 ppm hydroquinone wastewater with Escherichia coli fermentation broth (24g/t) expressing the mutant protein at high density at low temperature (4°C), the change trend of hydroquinone concentration in wastewater with time, abscissa is the treatment time, and the ordinate is the hydroquinone concentration in the wastewater.

Detailed ways

The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the protection scope of the present invention is not limited by the embodiments.

The materials in the following examples are:

Sphingomonas sp. strain used was obtained from the Culture Collection Center of Gansu Key Laboratory of Extreme Environmental Resources and Engineering.

Use tool enzymes, DNA molecular weight markers, gel recovery kits, His-tag purification kits, error-prone PCR kits, protein quantification kits and other related reagents were purchased from Sangon Bioengineering (Shanghai) Co., Ltd. The specific reaction For conditions and methods of use, refer to the product manual.

The following plasmids and E. coli were used for DNA library construction and gene cloning;

Escherichia coli BL21 competent cells were purchased from Solarbio Biotechnology Co., Ltd., and the pETduet-1 plasmid was purchased from Hunan Fenghui Biotechnology Co., Ltd.

Example 1 Construction and activity assay of a mutant protein applied to hydroquinone wastewater low-temperature degradation

1. Primer Amplification

The sequences of the designed primers P1, P2, P3 and P4 are as follows:

P1:5'-AAGGATCCGATGGCCGACGTGGTCACC-3';

P2:5'-GCAAGCTTTCAGGCCGCCTCGGTCTGG-3';

P3:5'-AACATATGATGGCTATGTCCGAAGCACTTG-3';

P4:5'-AACTCGAGTCAGAAAGTGACCGGGACCAC-3';

Sphingomonas sp. strain was cultured in LB medium (peptone 10 g/L, yeast extract 5 g/L, sodium chloride 10 g/L) for 4 days at 28°C. When OD 600=1.0-1.5, take 80 μl of bacterial solution and add 20 μl of 2g/L lysozyme, lyse the bacteria at 37°C for 10 hours, and heat at 95°C for 5 minutes to break the bacteria.

Add 25 μl of 2X PCR Mix, 2 μl of p1, 2 μl of p2, and 2 μl of heat-disrupted bacterial solution to the PCR tube as a template, and add water to make up to 50 μl. Add 25 μl of 2X PCR Mix, 2 μl of p3, 2 μl of p4, and 2 μl of heat-disrupted bacterial solution to the PCR tube as a template, and add water to make up to 50 μl.

PCR program: pre-denaturation at 95°C for 5 min, 40S at 95°C, 50S at 55°C, and 90S at 72°C (30 cycles). After the amplification, the amplified products were separated by agarose gel electrophoresis, and the amplified hqdA and hqdB were recovered by cutting the gel.

2. Enzyme digestion

①Enzyme cleavage of hqdA with NcoI+HindIII

Enzyme digestion system: 3 μl buffer, 1 μl each of NcoI+HindIII enzymes, and 25 μl amplifying hqdA;

Digestion conditions: Digestion at 37°C for 2h.

②Enzymatic cleavage of hqdB with NedI+XhoI

Enzyme digestion system: 3μl buffer, 1μl NedI+XhoI enzyme each, 25μl amplification hqdB;

Digestion conditions: Digestion at 37°C for 2h.

The amplified products were separated by agarose gel electrophoresis, and the digested hqdA and hqdB were recovered by cutting the gel.

③Enzymatic digestion of pETduet-1 with NcoI+HindIII

Enzyme digestion system: 2 μl buffer, 1 μl enzyme, 16 μl pETduet-1.

Digestion conditions: Digestion at 37°C for 12h.

The amplified products were separated by agarose gel electrophoresis, and the digested pETduet-1 was recovered by cutting the gel.

3. Connect

① Use T4 DNA ligase to ligate pETduet-1 and hqdA

Ligation system: 2μl buffer, 1μl enzyme, 3μl pETduet-1, 14μl hqdA, ligation overnight at 16°C. The ligation product was transformed into E. coli competent, cultured in LB medium containing 100 μg/ml ampicillin, and screened; the grown single colonies were amplified with primers P1 and P2, respectively, and it was detected by testing whether they could expand. hqdA to identify positive clones. The correctness of the clone was verified by sequencing, and pETduet-1-hqdA was constructed. For the clones with correct ligation, the plasmid was extracted with a plasmid extraction kit, and the plasmid was digested with NedI+XhoI. The digestion system was: 2 μl buffer, 1 μl enzyme each, and 16 μl pETduet-1-hqdA. Digestion conditions: Digestion at 37°C for 12h. The amplified products were separated by agarose gel electrophoresis, and the digested plasmid was recovered by cutting the gel.

②Use T4 DNA ligase to connect the digested plasmid to hqdB

Ligation system: 2μl buffer, 1μl enzyme, 3μl plasmid, 14μl hqdB, ligation overnight at 16°C. The ligated product was transformed into competent E. coli, cultured in LB medium containing 100 μg/ml ampicillin, and screened. The grown single colonies were amplified with primers P3 and P4 respectively, and positive clones were determined by detecting whether hqdB could be amplified; sequencing was used to verify the correctness of clones, and pETduet-1-hqdAB was constructed.

4. Protein expression and purification

The pETduet-1-hqdAB was transformed into E. coli BL21 competent cells and cultured in E. coli protein expression medium TB. The strain was cultured at 37°C to a concentration of OD600 = 0.5-0.8, and 0.5 mM IPTG was added to induce overnight induction at 20°C. The cells were collected by centrifugation, and the cells were resuspended in 6 ml of PBS according to the ratio of 1 g of cells. It was crushed by ultrasonic wave, the protein was purified by His-tag purification kit, and the purified protein was quantitatively analyzed by protein quantification kit.

5. Error-prone PCR

Error-prone PCR amplification was performed using an error-prone PCR kit with the hqdA and hqdB obtained by the above amplification as templates. Add 25 μl 2X Error-Prone PCR Mix, 2 μl p1, 2 μl p2, 2 μl template to the PCR tube, and make up to 50 μl with water. Add 25 μl of 2X error-prone PCR Mix, 2 μl p3, 2 μl p4, 2 μl template to the PCR tube, and make up to 50 μl with water. PCR program: pre-denaturation at 95°C for 5 min, 40S at 95°C, 50S at 55°C, and 90S at 72°C (30 cycles). After the amplification, the amplified products were separated by agarose gel electrophoresis, and the amplified hqdAmu and hqdBmu were recovered by cutting the gel.

6. Error-prone PCR library construction

① Use NcoI+HindIII to digest hqdAmu; use NedI+XhoI to digest hqdBmu. Enzyme digestion system: 3 μl buffer, 1 μl enzyme each, 25 μl recovered DNA. Digestion conditions: Digestion at 37°C for 2h. The amplified products were separated by agarose gel electrophoresis, and the digested hqdAmu and hqdBmu were recovered by cutting the gel.

② pETduet-1-hqdAB was digested with NcoI+HindIII and NedI+XhoI respectively. Enzyme digestion system: 3 μl buffer, 2 μl enzyme, 25 μl pETduet-1-hqdAB. Digestion conditions: Digestion at 37°C for 12h. The amplified products were separated by agarose gel electrophoresis, and the digested vector was recovered by cutting the gel.

③ Use T4 DNA ligase to connect the digested plasmids to the digested hqdAmu and hqdBmu respectively. The ligation system: 2 μl buffer, 1 μl enzyme, 3 μl plasmid, 14 μl hqdAmu or hqdBmu, and ligation overnight at 16°C. The ligated product was transformed into competent E. coli, cultured in LB medium containing 100 μg/ml ampicillin, and screened. The construction yielded pETduet-1-hqdABmu and pETduet-1-hqdBAmu.

7. Error-prone PCR library screening and co-expression mutant protein vector construction

The constructed pETduet-1-hqdABmu and pETduet-1-hqdBAmu were transformed into E. coli BL21, respectively, in LB solid medium containing 0.005-0.015g/L hydroquinone and 0.1-0.8mM IPTG. Incubate at 14°C-20°C for 48-60h. The first single colony was selected and sequenced to confirm the mutation site. The common mutation sites in different mutant clones were confirmed by the bioinformatics software clust W. The hqdA and hqdB on pETduet-1-hqdAB were site-directed mutagenesis using a site-directed mutagenesis kit, and pETduet-1-hqdABmu2 was finally constructed (Figure 1).

8. Mutant protein expression and purification

The pETduet-1-hqdAB _mu 2 was transformed into Escherichia coli BL21 competent medium and then inoculated into the medium for high-density fermentation. After fermentation for 16-20h, 5-13L of feed solution was added in flow for 4-10h. After the feeding is completed, add sterilized yeast extract to a final concentration of 1-4%, culture the strain at 37°C to a concentration of OD600=0.5-0.8, add IPTG with a concentration of 0.1-0.8mM to 20- Induce overnight at 28°C to obtain fermentation broth. During the induction process, 5-13 L of induction feed solution was added, and the feeding time was 12-24 h. The cells were resuspended in the ratio of 6ml PBS. It was crushed by ultrasonic wave, the protein was purified by His-tag purification kit, and the purified protein was quantitatively analyzed by protein quantification kit.

9. Determination of hydroquinone degradation ability

Enzyme-catalyzed reaction system: 250 μl 50 mM Tris pH7.0; 50 nM purified HqdAB or HqdABmu2; 100 μl 350 μM hydroquinone solution dissolved in 50 mM Tris pH7.0. Incubate at different temperatures for different times, and measure the changes in absorbance at 320 nm to determine the enzymatic activities of purified HqdAB _mu and wild-type proteins at different temperatures, respectively.

8. The Escherichia coli in the induced fermentation broth obtained in the expression and purification of the mutant protein were separated and weighed, and the Escherichia coli was resuspended in phosphate buffer at a concentration of 100g/L, and a high pressure homogenizer was used at a pressure of 80MPa. After crushing for 1-2 times, an Escherichia coli lysate was formed, and the Escherichia coli lysate was diluted in different proportions and added to the wastewater containing 1 g/L hydroquinone to detect the content of hydroquinone.

10. Analysis of results

The ability of HqdAB _mu and wild-type protein to degrade hydroquinone at 20-25 °C was 6.8 μmol/min/mg and 6.1 μmol/min/mg, respectively, and HqdAB _mu degraded hydroquinone at 10 °C and 4 °C, respectively. The ability is stronger than that of the wild-type protein, especially the ability to degrade hydroquinone at 2-4 °C is 27.3 times that of the wild-type protein, and its catalytic activity is 6.4 μmol/min/mg. The experimental results are shown in Figure 2.

The E. coli in the obtained induced fermentation broth was separated and weighed to detect that the wet weight of E. coli was as high as 80-150g/L, added to the wastewater containing hydroquinone, and the detection found that 14-24g of E. coli lysate was The content of hydroquinone was only 20-80ppm after treating 1 ton of wastewater containing 0.5-2g/L hydroquinone at 4°C for 8-16h. The experimental results are shown in Figure 3 and Figure 4.

sequence listing

<110> Lanzhou City College

<120> A mutant protein applied to low-temperature degradation of hydroquinone wastewater and its construction method

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 511

<212> PRT

<213> Sphingomonas sp. strain

<400> 1

Met Ala Asp Val Val Thr Glu Phe Gly Ala Leu Thr Asp Tyr Arg Lys

1 5 10 15

Arg Gly Val Glu Ile Ile Asp Asp Asp Pro Arg Asn Tyr Val Phe Ser

20 25 30

Asn Val Phe Glu Val Ala Ala Asn Ala Ala Pro Tyr Glu Arg Val Ala

35 40 45

Val Gly Lys Asn Phe Glu Tyr Val Ile Glu Ser Ala Arg Ala Glu Gly

50 55 60

Thr Ser Gly Trp Phe Ser Cys Ala His Asp Glu Phe Val Leu Ala Met

65 70 75 80

Asp Gly Gln Ile Glu Val His Asp Leu Lys Leu Asp Asn Ser Asp Ala

85 90 95

Tyr Val Asp Pro Asp Ser Glu Gly Ala Val Ala Ile Gly Glu Ala Leu

100 105 110

Pro Glu Gly Arg Lys Met Gly Arg Ile Val Leu Arg Arg Gly His Met

115 120 125

Ala Leu Leu Pro His Gly Ala Ala Tyr Arg Phe Tyr Ala Glu Gln Pro

130 135 140

Ala Ala Met Leu Phe Gln Ser Ile Glu Gly Ala Val Thr Val Gln Lys

145 150 155 160

Trp Gly Glu Ile Cys Gln Thr Glu Ala Ala Met Ala Met Ser Glu Ala

165 170 175

Leu Glu Ile Ile Asp Phe Gly Asp Ser Lys Ala Arg Thr Asp Thr Glu

180 185 190

His Leu Ala Ile Asn Asn Glu Thr Gly Tyr Arg Ser Phe Arg Ala Gly

195 200 205

Gly Phe Thr Phe Thr Arg Asp Glu Tyr Phe Ala Arg Leu Thr Trp Pro

210 215 220

Gly Gly Ser His Ile Ile Pro Ile Asp Ala Phe Leu Arg Ala Val Met

225 230 235 240

Arg Asp Val Ala Trp Gly Phe Phe Tyr Gly Val Val Asn Phe Asp His

245 250 255

Val Phe Gly Thr Ile Asn His Tyr Gly Glu Val Thr Met Phe Ala Gly

260 265 270

Arg Phe Asn Asp Ala Tyr Arg Asn Ala Gly Arg Asp His Glu Glu Arg

275 280 285

Phe Lys Ser Ser Ala Leu Met Ala Val Phe Lys Asp Ile Leu Ser Asp

290 295 300

Trp Thr Val Glu Gly Tyr Asp Pro Phe Ala Ala Pro Met Lys Thr Gly

305 310 315 320

Leu Pro Trp Gly Ile Lys Asn Gly Asn Asn Asp Glu Ala Ile Ser Arg

325 330 335

Gln Arg Val Thr Ala Arg Arg Met Val Gly Leu Pro Gly Asp Thr Pro

340 345 350

Val Arg Thr Asp Ala Asn Gly Phe Pro Val Asn Arg Gln Phe Ala Asp

355 360 365

Val Pro Gln Glu Gln Pro Val Val Glu Ala Glu Pro Gly Phe Glu Ala

370 375 380

Glu Val Ser Ala Tyr Asn Leu Phe Gly Tyr Leu Ser Arg Ser Asp Val

385 390 395 400

Thr Trp Asn Pro Ser Val Cys Ser Val Val Gly Asp Ser Leu Phe Cys

405 410 415

Pro Thr Ser Glu Glu Phe Ile Leu Pro Val Glu His Gly Asn Asp Arg

420 425 430

Cys Glu Trp Phe Leu Gln Leu Ser Asp Glu Ile Val Trp Asp Val Lys

435 440 445

Asp Lys Glu Ser Gly Lys Pro Arg Ala Arg Val Thr Ala Arg Ala Gly

450 455 460

Asp Ile Cys Cys Met Pro Ala Asp Ile Arg His Gln Gly Tyr Ser Thr

465 470 475 480

Lys Arg Ser Met Leu Leu Val Trp Glu Asn Gly Ser Pro Lys Ile Pro

485 490 495

Gln Met Ile Ala Asp Gly Thr Ala Pro Val Val Pro Val Thr Phe

500 505 510

<210> 2

<211> 170

<212> PRT

<213> Sphingomonas sp. strain

<400> 2

Met Ala Asp Val Val Thr Glu Phe Gly Ala Leu Thr Asp Tyr Arg Lys

1 5 10 15

Arg Gly Val Glu Ile Ile Asp Asp Asp Pro Arg Asn Tyr Val Phe Ser

20 25 30

Asn Val Phe Glu Val Ala Ala Asn Ala Ala Pro Tyr Glu Arg Val Ala

35 40 45

Val Gly Lys Asn Phe Glu Tyr Val Ile Glu Ser Ala Arg Ala Glu Gly

50 55 60

Thr Ser Gly Trp Phe Ser Cys Ala His Asp Glu Phe Val Leu Ala Met

65 70 75 80

Asp Gly Gln Ile Glu Val His Asp Leu Lys Leu Asp Asn Ser Asp Ala

85 90 95

Tyr Val Asp Pro Asp Ser Glu Gly Ala Val Ala Ile Gly Glu Ala Leu

100 105 110

Pro Glu Gly Arg Lys Met Gly Arg Ile Val Leu Arg Arg Gly His Met

115 120 125

Ala Leu Leu Pro His Gly Ala Ala Tyr Arg Phe Tyr Ala Glu Gln Pro

130 135 140

Ala Ala Met Leu Phe Gln Ser Ile Glu Gly Ala Val Thr Val Gln Lys

145 150 155 160

Trp Gly Glu Ile Cys Gln Thr Glu Ala Ala

165 170

<210> 3

<211> 341

<212> PRT

<213> Sphingomonas sp. strain

<400> 3

Met Ala Met Ser Glu Ala Leu Glu Ile Ile Asp Phe Gly Asp Ser Lys

1 5 10 15

Ala Arg Thr Asp Thr Glu His Leu Ala Ile Asn Asn Glu Thr Gly Tyr

20 25 30

Arg Ser Phe Arg Ala Gly Gly Phe Thr Phe Thr Arg Asp Glu Tyr Phe

35 40 45

Ala Arg Leu Thr Trp Pro Gly Gly Ser His Ile Ile Pro Ile Asp Ala

50 55 60

Phe Leu Arg Ala Val Met Arg Asp Val Ala Trp Gly Phe Phe Tyr Gly

65 70 75 80

Val Val Asn Phe Asp His Val Phe Gly Thr Ile Asn His Tyr Gly Glu

85 90 95

Val Thr Met Phe Ala Gly Arg Phe Asn Asp Ala Tyr Arg Asn Ala Gly

100 105 110

Arg Asp His Glu Glu Arg Phe Lys Ser Ser Ala Leu Met Ala Val Phe

115 120 125

Lys Asp Ile Leu Ser Asp Trp Thr Val Glu Gly Tyr Asp Pro Phe Ala

130 135 140

Ala Pro Met Lys Thr Gly Leu Pro Trp Gly Ile Lys Asn Gly Asn Asn

145 150 155 160

Asp Glu Ala Ile Ser Arg Gln Arg Val Thr Ala Arg Arg Met Val Gly

165 170 175

Leu Pro Gly Asp Thr Pro Val Arg Thr Asp Ala Asn Gly Phe Pro Val

180 185 190

Asn Arg Gln Phe Ala Asp Val Pro Gln Glu Gln Pro Val Val Glu Ala

195 200 205

Glu Pro Gly Phe Glu Ala Glu Val Ser Ala Tyr Asn Leu Phe Gly Tyr

210 215 220

Leu Ser Arg Ser Asp Val Thr Trp Asn Pro Ser Val Cys Ser Val Val

225 230 235 240

Gly Asp Ser Leu Phe Cys Pro Thr Ser Glu Glu Phe Ile Leu Pro Val

245 250 255

Glu His Gly Asn Asp Arg Cys Glu Trp Phe Leu Gln Leu Ser Asp Glu

260 265 270

Ile Val Trp Asp Val Lys Asp Lys Glu Ser Gly Lys Pro Arg Ala Arg

275 280 285

Val Thr Ala Arg Ala Gly Asp Ile Cys Cys Met Pro Ala Asp Ile Arg

290 295 300

His Gln Gly Tyr Ser Thr Lys Arg Ser Met Leu Leu Val Trp Glu Asn

305 310 315 320

Gly Ser Pro Lys Ile Pro Gln Met Ile Ala Asp Gly Thr Ala Pro Val

325 330 335

Val Pro Val Thr Phe

340

Claims (9)

1. The mutein applied to the low-temperature degradation of hydroquinone wastewater is characterized in that the amino acid sequence of the mutein is shown in SEQ ID NO. 1.

2. The mutein according to claim 1, wherein the mutein comprises the mutein hqdA_muAnd the mutein hqdB_muThe mutein hqdA_muThe amino acid sequence of (A) is shown as SEQ ID NO.2, and the mutant protein hqdB_muThe amino acid sequence of (A) is shown in SEQ ID NO. 3.

3. The mutein according to claim 2, wherein the mutein hqdA is characterized in that_muGlycine at the 17 th site, leucine at the 88 th site and valine at the 133 th site of the protein hqdA are respectively mutated into arginine, aspartic acid and histidine; the mutein hqdB_muThe methionine at the 39 th position and the glutamic acid at the 148 th position of the protein hqdB are respectively mutated into valine and lysine.

4. A construction method of mutant protein applied to low-temperature degradation of hydroquinone wastewater is characterized by comprising the following steps:

step one, taking a genome of Sphingomonas sp.strain as a PCR amplification template, amplifying hqdA by using PCR amplification primers P1 and P2, and amplifying hqdB by using PCR amplification primers P3 and P4, wherein the sequences of P1, P2, P3 and P4 are respectively as follows:

P1：AAGGATCCGATGGCCGACGTGGTCACC；

P2：GCAAGCTTTCAGGCCGCCTCGGTCTGG；

P3：AACATATGATGGCTATGTCCGAAGCACTTG；

P4：AACTCGAGTCAGAAAGTGACCGGGACCAC；

respectively purifying and enzyme-cutting the amplified products, and respectively connecting the enzyme-cut products to an escherichia coli co-expression vector pETduet-1 to construct pETduet-1-hqdA and pETduet-1-hqdB;

step two, amplifying hqdBmu by using PCR amplification primers P3 and P4 and an error-prone PCR kit, and amplifying hqdBmu by using PCR amplification primersAmplifying hqdAmu by using P1, P2 and an error-prone PCR kit, respectively purifying and enzyme-cutting the amplified products, respectively connecting the enzyme-cut products to pETduet-1-hqdA and pETduet-1-hqdB obtained in the step one to construct pETduet-1-hqdAB_muAnd pETduet-1-hqdBA_mu；

Step three, the pETduet-1-hqdAB obtained in the step two_muAnd pETduet-1-hqdBA_muRespectively transferring the bacterial colonies into escherichia coli BL21 for colony culture, and transferring the obtained bacterial colonies into an LB culture medium for strain culture;

fourthly, carrying out site-directed mutagenesis on the hqdA and the hqdB on the pETduet-1-hqdAB by utilizing a site-directed mutagenesis kit, and finally constructing and finishing pETduet-1-hqdABmu 2;

step five, pETduet-1-hqdAB_mu2, transforming the strain into escherichia coli BL21 competence, culturing the strain, inoculating the strain to a culture medium for high-density fermentation, adding a feed liquid after the fermentation, adding a sterilized yeast extract until the final concentration is 1-4%, culturing the strain at 37 ℃ until the concentration is OD600 (OD 600) is 0.5-0.8, adding IPTG (isopropyl-beta-thiogalactoside) with the concentration of 0.1-0.8mM, inducing at 20-28 ℃ overnight to obtain a fermentation liquid, adding an induction feed liquid during the induction process, separating escherichia coli from the fermentation liquid after the feed is finished, centrifugally collecting the thalli, resuspending the thalli according to the proportion of 1g of the thalli with 6ml of PBS (phosphate buffer solution), crushing the thalli by using ultrasonic waves, and purifying the protein by using a His-tag purification kit to prepare the mutant protein.

5. The method for constructing the mutein of claim 4, wherein the LB solid medium in step three contains 0.005-0.015g/L hydroquinone, 0.1-0.8mM IPTG.

6. The method of claim 4, wherein the inoculation in step five is carried out using a high-density fermentation medium of Escherichia coli at an inoculation ratio of 1:50 to 1: 100.

7. The method of claim 4, wherein the feed solution in step five comprises glucose, magnesium sulfate, vitamins and trace elements.

8. The method of claim 4, wherein the inducing supplement solution of step five comprises glycerol, magnesium sulfate, vitamin B1, and trace elements.

9. The use of the mutein of claim 1 for the degradation of low temperature phenol-containing wastewater.

Images