CN112010948A - Mutant protein applied to low-temperature degradation of hydroquinone wastewater and construction method - Google Patents
Mutant protein applied to low-temperature degradation of hydroquinone wastewater and construction method Download PDFInfo
- Publication number
- CN112010948A CN112010948A CN201910454531.0A CN201910454531A CN112010948A CN 112010948 A CN112010948 A CN 112010948A CN 201910454531 A CN201910454531 A CN 201910454531A CN 112010948 A CN112010948 A CN 112010948A
- Authority
- CN
- China
- Prior art keywords
- mutein
- petduet
- hqdb
- hqda
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F3/00—Biological treatment of water, waste water, or sewage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F2101/00—Nature of the contaminant
- C02F2101/30—Organic compounds
- C02F2101/34—Organic compounds containing oxygen
- C02F2101/345—Phenols
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Water Supply & Treatment (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Plant Pathology (AREA)
- Environmental & Geological Engineering (AREA)
- Hydrology & Water Resources (AREA)
- Biodiversity & Conservation Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the field of genetic engineering, and particularly relates to a mutant protein applied to low-temperature degradation of hydroquinone wastewater and a construction method thereof. The amino acid sequence of the mutein applied to the low-temperature degradation of hydroquinone wastewater is shown as SEQ ID NO.1, and the mutein comprises the mutein hqdAmuAnd the mutein hqdBmuThe amino acid sequences are shown as SEQ ID NO.2 and SEQ ID NO. 3. The mutein hqdAmuGlycine at the 17 th site, leucine at the 88 th site and valine at the 133 th site of the protein hqdA are respectively mutated into arginine, aspartic acid and histidine; the mutein hqdBmuIs the protein hqdB methionine at the 39 th position and the protein hqdB glutamine at the 148 th positionThe acid was mutated to valine and lysine, respectively. The mutant protein prepared by the invention has the characteristic of efficiently degrading phenol-containing wastewater at low temperature, and can be applied to degrading low-temperature phenol-containing wastewater.
Description
Technical Field
The invention belongs to the field of genetic engineering, and particularly relates to a mutant protein applied to low-temperature degradation of hydroquinone wastewater and a construction method thereof.
Background
The phenolic wastewater in the wastewater discharged by the chemical industry is a wastewater which is difficult to treat, and microorganisms can be effectively killed due to the low content of phenolic substances. Therefore, the phenol-containing wastewater generated in the chemical industry cannot be directly discharged into a sewage treatment tank. The means mainly applied to the degradation of phenolic substances in the phenolic wastewater at present is an iron-carbon degradation method: the iron carbon can form microelectrodes in acidic water, and the microelectrodes can ionize and decompose phenolic substances. The phenol content in the wastewater treated by the iron-carbon reaction is greatly reduced, and the wastewater can not kill the sewage degrading microorganisms. At this time, the wastewater can be discharged into a sewage treatment tank. Because the temperature is relatively low in autumn and winter in most areas in northern China, phenolic substances in wastewater cannot be effectively degraded through iron-carbon reaction, and therefore the standard of microbial treatment of wastewater discharged to a sewage treatment tank is difficult to achieve.
The genes reported for hydroquinone degradation are hqdA and hqdB, both from Sphingomonas sp. The hqdA and hqdB co-expressed protein in the thallus can form a dimer to co-catalyze and degrade hydroquinone. By researching the catalytic kinetics of the purified HqdA and HqdB dimer proteins, the protein has the efficiency of catalyzing and degrading hydroquinone of 1.4mol of hydroquinone/mol of protein at normal temperature, and the Km of the protein catalyzing and degrading the hydroquinone is 2.2 mu M. However, the enzyme has relatively weak capability of degrading hydroquinone at 4 ℃, has the catalytic efficiency of only 1/35 of that of normal temperature, and cannot degrade the hydroquinone at low temperature.
The invention specifically provides a method for carrying out directed evolution on hqdA and hqdB by utilizing an error-prone PCR technology, screening mutants and then selecting mutant protein HqdAmuAnd HqdBmuApplication of Escherichia coli to HqdAmuAnd HqdBmuRecombinant co-expression is carried out on pETduet-1-hqdABmu2 culturing, performing high-density fermentation and protein expression induction to obtain induced fermentation liquor, separating out Escherichia coli from the fermentation liquor, and crushing to obtain Escherichia coli lysate of mutant protein. The mutant protein prepared by the invention has the characteristic of efficiently degrading phenol-containing wastewater at low temperature.
Disclosure of Invention
The invention aims to provide a mutant protein applied to the low-temperature degradation of hydroquinone wastewater, wherein the mutant protein can efficiently degrade phenolic wastewater at a low temperature.
The invention also aims to provide a construction method and application of the mutant protein applied to the low-temperature degradation of hydroquinone wastewater.
In order to achieve the purpose, the invention adopts the technical scheme that:
a mutant protein, the amino acid sequence of which is shown in SEQ ID NO. 1.
The mutein comprises the mutein hqdAmuAnd the mutein hqdBmuThe mutein hqdAmuThe amino acid sequence of (A) is shown as SEQ ID NO.2, and the mutant protein hqdBmuThe amino acid sequence of (A) is shown in SEQ ID NO. 3.
The mutein hqdAmuGlycine at the 17 th site, leucine at the 88 th site and valine at the 133 th site of the protein hqdA are respectively mutated into arginine, aspartic acid and histidine; the mutein hqdBmuThe methionine at the 39 th position and the glutamic acid at the 148 th position of the protein hqdB are mutated into valine and lysine respectively.
A method for constructing mutant protein applied to low-temperature degradation of hydroquinone wastewater comprises the following steps:
step one, respectively taking a Sphingomonas (Sphingomonas sp. strain) genome as a PCR amplification template, amplifying hqdA by using PCR amplification primers P1 and P2, and amplifying hqdB by using PCR amplification primers P3 and P4, wherein the nucleotide sequences of P1, P2, P3 and P4 are as follows:
P1：AAGGATCCGATGGCCGACGTGGTCACC；
P2：GCAAGCTTTCAGGCCGCCTCGGTCTGG；
P3：AACATATGATGGCTATGTCCGAAGCACTTG；
P4：AACTCGAGTCAGAAAGTGACCGGGACCAC；
respectively purifying and enzyme-cutting the amplified products, and respectively connecting the enzyme-cut products to an escherichia coli co-expression vector pETduet-1 to construct pETduet-1-hqdA and pETduet-1-hqdB;
step two, amplifying hqdB by using PCR amplification primers P3 and P4 and an error-prone PCR kit, amplifying hqdA by using PCR amplification primers P1 and P2 and an error-prone PCR kit, respectively purifying and enzyme-cutting the amplification products, respectively connecting the enzyme-cut products to pETduet-1-hqdA and pETduet-1-hqdB obtained in step one, and constructing pETduet-1-hqdABmuAnd pETduet-1-hqdBAmu；
Step three, the pETduet-1-hqdAB obtained in the step twomuAnd pETduet-1-hqdAmuB, respectively transferring the bacterial colonies into escherichia coli BL21 for colony culture, and transferring the obtained bacterial colonies into a TB culture medium for strain culture;
step four, respectively carrying out sequence optimization by using the optimal codon of the escherichia coli and carrying out total gene synthesis on the hqdAmuAnd hqdBmuThen respectively constructing the two genes into an escherichia coli co-expression vector pETduet-11 to construct pETduet-1-hqdABmu2；
Step five, pETduet-1-hqdABmu2 to Escherichia coli BL21, inoculating to culture medium, fermenting for 16-20h, adding 5-13L supplement liquid for 4-10h, adding sterilized yeast extract to final concentration of 1-4%, and addingInducing with 0.1-0.8mM IPTG at 20-28 deg.C overnight to obtain fermentation broth, adding 5-13L inducing supplement liquid in the inducing process for 12-24 hr, and separating out Escherichia coli from the fermentation broth to obtain mutant protein.
Preferably, in the third step, the Escherichia coli BL21 is cultured in LB solid medium containing 0.005-0.015g/L hydroquinone and 0.1-0.8mMIPTG at 14-20 ℃ for 48-60 h. Since Escherichia coli is extremely sensitive to hydroquinone and dies in a medium containing 0.005-0.015g/L of hydroquinone, IPTG should be added.
Preferably, the inoculation in the step five adopts an escherichia coli high-density fermentation medium, and the inoculation ratio is 1:50-1: 100.
preferably, the feed supplement liquid in the fifth step consists of glucose, magnesium sulfate, vitamins and trace elements;
preferably, the inducing and supplementing liquid in the fifth step consists of glycerol, magnesium sulfate, vitamin B1 and trace elements.
The application of the mutant protein in the low-temperature degradation of phenol-containing wastewater.
The invention has the beneficial effects that:
compared with wild protein, the mutant protein provided by the invention has the advantages that the capability of degrading hydroquinone at 20-25 ℃ is improved, but no significant difference exists; the capability of degrading hydroquinone is 27.3 times of that of wild protein at the low temperature of 2-4 ℃, the enzyme activity is obviously improved, and the catalytic activity is 6.4 mu mol/min/mg.
Diluting and adding the Escherichia coli lysate into wastewater containing 1g/L of hydroquinone according to different proportions, and detecting that the content of hydroquinone is only 20-80ppm after 14-24g of Escherichia coli lysate is used for treating 1 ton of wastewater containing 0.5-2g/L of hydroquinone for 8-16h at 4 ℃. The content of hydroquinone is obviously reduced, namely the mutein prepared by the invention can degrade hydroquinone in low temperature environment, and the degrading activity is extremely high.
Drawings
FIG. 1 construction of pETduet-1-hqdABmu2
FIG. 2 is a bar graph showing the catalytic activity of wild-type protein and mutein at 25 ℃ and 4 ℃
Wherein Wt 25 ℃ is the enzyme activity catalysis efficiency of the wild type protein at 25 ℃, Wt 4 ℃ is the enzyme activity catalysis efficiency of the wild type protein at 4 ℃, Mu 25 ℃ is the enzyme activity catalysis efficiency of the mutant protein at 25 ℃, and Mu 4 ℃ is the enzyme activity catalysis efficiency of the mutant protein at 4 ℃.
FIG. 3 is a graph showing the trend of hydroquinone concentration in wastewater with time after 500ppm of hydroquinone wastewater was treated with Escherichia coli fermentation broth (14g/t) expressing muteins at high density at low temperature (4 ℃), with the abscissa representing the treatment time and the ordinate representing the hydroquinone concentration in wastewater.
FIG. 4 is a graph showing the trend of hydroquinone concentration in wastewater with time after 2000ppm of hydroquinone wastewater was treated with Escherichia coli fermentation broth (24g/t) expressing muteins at high density at low temperature (4 ℃), with the abscissa representing the treatment time and the ordinate representing the hydroquinone concentration in wastewater.
Detailed Description
The invention is further described with reference to the following figures and detailed description, but the scope of protection of the invention is not limited by the examples.
The materials in the following examples are:
sphingomonas (Sphingomonas sp.
Relevant reagents such as a tool enzyme, a DNA molecular weight Marker, a gel recovery kit, a His-tag purification kit, an error-prone PCR kit, a protein quantification kit and the like are purchased from Biotechnology engineering (Shanghai) GmbH, and specific reaction conditions and a using method refer to a commercial instruction book.
The following plasmids and E.coli were used for DNA library construction and gene cloning;
coli BL21 competent cells were obtained from Solebao (solarbio) Biotech Co., Ltd, and plasmid pETduet-1 was obtained from Hu nan Fenghui Biotech Co., Ltd.
Example 1 construction and Activity measurement of a mutein applied to Low-temperature degradation of Hydroquinone wastewater
1. Amplification with primers
The sequences of the designed primers P1, P2, P3 and P4 are as follows:
P1:5’—AAGGATCCGATGGCCGACGTGGTCACC—3’；
P2:5’—GCAAGCTTTCAGGCCGCCTCGGTCTGG—3’；
P3:5’—AACATATGATGGCTATGTCCGAAGCACTTG—3’；
P4:5’—AACTCGAGTCAGAAAGTGACCGGGACCAC—3’；
sphingomonas sp. When OD600 is 1.0-1.5, adding 20 μ L2 g/L lysozyme into 80 μ L bacterial liquid, lysing at 37 deg.C for 10 hr, and heating at 95 deg.C to break the bacteria for 5 min.
To the PCR tube, 25. mu.l of 2 XPCR Mix, 2. mu. l p1, 2. mu. l p2, 2. mu.l of the heat-disrupted bacterial suspension was added as a template, and water was added to make up to 50. mu.l. To the PCR tube, 25. mu.l of 2 XPCR Mix, 2. mu. l p3, 2. mu. l p4, 2. mu.l of the heat-disrupted bacterial suspension was added as a template, and water was added to make up to 50. mu.l.
PCR procedure: pre-denaturation at 95 ℃ for 5min, 40S at 95 ℃, 50S at 55 ℃ and 90S at 72 ℃ (30 cycles). After amplification, separating the amplified product by agarose gel electrophoresis, cutting the gel and recovering the amplified hqdA and hqdB.
2. Enzyme digestion
Firstly, the hqdA is digested by NcoI + HindIII
Enzyme digestion system: mu.l of buffer, 1. mu.l each of NcoI + HindIII enzyme, 25. mu.l of amplified hqdA;
enzyme cutting conditions are as follows: the enzyme was cleaved at 37 ℃ for 2 h.
② enzyme digestion is carried out on hqdB by utilizing NedI + XhoI
Enzyme digestion system: mu.l buffer, 1. mu.l each of NedI + XhoI enzyme, 25. mu.l amplified hqdB;
enzyme cutting conditions are as follows: the enzyme was cleaved at 37 ℃ for 2 h.
Separating the amplified product by agarose gel electrophoresis, cutting the gel and recovering the hqdA and hqdB which are well cut by the enzyme.
③ digestion of pETduet-1 with NcoI + HindIII
Enzyme digestion system: mu.l buffer, 1. mu.l each of the enzymes, 16. mu.l of pETduet-1.
Enzyme cutting conditions are as follows: the enzyme was cleaved at 37 ℃ for 12 h.
Separating the amplified product by agarose gel electrophoresis, cutting the gel and recovering the pETduet-1 which is well cut by the enzyme.
3. Connection of
Firstly, using T4DNA ligase to connect pETduet-1 and hqdA
A connection system: mu.l buffer, 1. mu.l enzyme, 3. mu.l pETduet-1, 14. mu.l hqdA, ligated overnight at 16 ℃. Transforming the ligation product into Escherichia coli competence, culturing in LB medium containing 100. mu.g/ml ampicillin, and screening; the single colony was amplified with primers P1 and P2, and positive clones were determined by detecting whether hqdA could be amplified. The correctness of the clone is verified by sequencing, and pETduet-1-hqdA is constructed. And (3) extracting plasmids by using a plasmid extraction kit for correctly connected clones, and performing enzyme digestion on the plasmids by using NedI + XhoI, wherein an enzyme digestion system comprises the following steps: mu.l buffer, 1. mu.l each of the enzymes, 16. mu.l of pETduet-1-hqdA. Enzyme cutting conditions are as follows: the enzyme was cleaved at 37 ℃ for 12 h. Separating the amplified product by agarose gel electrophoresis, cutting the gel and recovering the plasmid after enzyme digestion.
② the T4DNA ligase is used to connect the enzyme-cut plasmid with hqdB
A connection system: mu.l buffer, 1. mu.l enzyme, 3. mu.l plasmid, 14. mu.l hqdB, ligation overnight at 16 ℃. The ligation products were transformed into E.coli competent cells, cultured in LB medium containing 100. mu.g/ml ampicillin, and screened. Amplifying the single colony by using primers P3 and P4, and determining a positive clone by detecting whether hqdB can be amplified; the correctness of the clone is verified by sequencing, and pETduet-1-hqdAB is constructed.
4. Protein expression and purification
pETduet-1-hqdAB was transformed into E.coli BL21 competent cells and cultured using E.coli protein expression medium TB. The strain was cultured at 37 ℃ until the concentration of OD600 became 0.5-0.8, and then medium-concentration IPTG was added thereto, followed by induction at 20 ℃ overnight. The cells were collected by centrifugation, and suspended in a proportion of 1g of the cells in 6ml of PBS. The protein is crushed by ultrasonic waves, the protein is purified by a His-tag purification kit, and the purified protein is quantitatively analyzed by a protein quantitative kit.
5. Error prone PCR
And performing error-prone PCR amplification by using an error-prone PCR kit and hqdA and hqdB obtained by amplification as templates. To the PCR tube, 25. mu.l of 2X error-prone PCR Mix, 2. mu. l p1, 2. mu. l p2, 2. mu.l of template were added, and water was added to make up to 50. mu.l. To the PCR tube, 25. mu.l of 2X error-prone PCR Mix, 2. mu. l p3, 2. mu. l p4, 2. mu.l of template were added, and water was added to make up to 50. mu.l. PCR procedure: pre-denaturation at 95 ℃ for 5min, 40S at 95 ℃, 50S at 55 ℃ and 90S at 72 ℃ (30 cycles). After amplification, separating the amplification product by agarose gel electrophoresis, cutting gel and recovering the amplified hqdAmu and hqdBmu.
6. Error-prone PCR library construction
Firstly, carrying out enzyme digestion on hqdAmu by using NcoI + HindIII; the hqdBmu was digested with NedI + XhoI. Enzyme digestion system: mu.l buffer, 1. mu.l each of the enzymes, 25. mu.l of the recovered DNA. Enzyme cutting conditions are as follows: the enzyme was cleaved at 37 ℃ for 2 h. Separating the amplified products by agarose gel electrophoresis, and cutting the gel to recover hqdAmu and hqdBmu which are well cut by enzyme.
② enzyme digestion is carried out on pETduet-1-hqdAB by using NcoI + HindIII and NedI + XhoI respectively. Enzyme digestion system: mu.l buffer, 2. mu.l each of the enzymes, 25. mu.l of pETduet-1-hqdAB. Enzyme cutting conditions are as follows: the enzyme was cleaved at 37 ℃ for 12 h. Separating the amplified product by agarose gel electrophoresis, cutting the gel and recovering the carrier after enzyme digestion.
Thirdly, the enzyme-cut plasmid is respectively connected with the enzyme-cut hqdAmu and hqdBmu by utilizing T4DNA ligase, and a connecting system is as follows: mu.l buffer, enzyme 1. mu.l, 3. mu.l plasmid, 14. mu.l hqdAmu or hqdBmu, ligation overnight at 16 ℃. The ligation products were transformed into E.coli competent cells, cultured in LB medium containing 100. mu.g/ml ampicillin, and screened. pETduet-1-hqdABmu and pETduet-1-hqdBoamu are obtained by construction.
7. Error-prone PCR library screening and co-expression mutant protein vector construction
The constructed pETduet-1-hqdABmu and pETduet-1-hqdBacu are respectively transformed into Escherichia coli BL21 and cultured in LB solid culture medium containing 0.005-0.015g/L hydroquinone and 0.1-0.8mM IPTG at 14-20 ℃ for 48-60 h. And selecting the single colony growing firstly, and sequencing to confirm the mutation site. The consensus mutation sites in different mutant clones were confirmed using bioinformatics software cluster W. The hqdA and hqdB on pETduet-1-hqdAB were site-directed mutated using a site-directed mutagenesis kit, and pETduet-1-hqdABmu2 was finally constructed (FIG. 1).
8. Mutein expression and purification
pETduet-1-hqdABmu2, transforming the strain into escherichia coli BL21 competent cells, culturing the strain, inoculating the strain into a culture medium for high-density fermentation, after fermenting for 16-20h, adding 5-13L of supplement liquid in a flow mode for 4-10h, after the addition is finished, adding a sterilized yeast extract until the final concentration of the yeast extract is 1-4%, culturing the strain at 37 ℃ until the concentration is OD600 (OD 600) is 0.5-0.8, adding IPTG (isopropyl thiogalactoside) with the concentration of 0.1-0.8mM, inducing overnight at 20-28 ℃ to obtain fermentation liquor, adding 5-13L of the supplement liquid in a flow mode during the induction process, after the addition is finished, separating the escherichia coli from the fermentation liquor, centrifugally collecting the thalli, and resuspending 1g of the thalli in a proportion of 6ml of PBS. The protein is crushed by ultrasonic waves, the protein is purified by a His-tag purification kit, and the purified protein is quantitatively analyzed by a protein quantitative kit.
9. Determination of Hydroquinone degradation Capacity
An enzyme catalysis reaction system: 250 μ l 50mM Tris pH7.0; 50nM purified HqdAB or HqdABmu 2; mu.l of 350. mu.M hydroquinone solution dissolved in 50mM Tris pH 7.0. The HqdAB after purification was determined by measuring the change in absorbance at 320nm after incubation at different temperatures for different timesmuAnd wild type protein at different temperatures.
And 8, separating and weighing escherichia coli in the induced fermentation broth obtained in the mutant protein expression and purification, suspending the escherichia coli in phosphate buffer solution according to the concentration of 100g/L, crushing the escherichia coli for 1-2 times under the pressure of 80MPa by using a high-pressure homogenizer to form escherichia coli lysate, diluting the escherichia coli lysate according to different proportions, adding the escherichia coli lysate into wastewater containing 1g/L of hydroquinone, and detecting the content of the hydroquinone.
10. Analysis of results
HqdABmuAnd the capability of degrading hydroquinone of the wild type protein at 20-25 ℃ is respectively 6.8 mu mol/min/mg and 6.1 mu mol/min/mg, HqdABmuThe capability of degrading hydroquinone at 10 ℃ and 4 ℃ is stronger than that of wild-type protein, particularly the capability of degrading hydroquinone at 2-4 ℃ is 27.3 times of that of wild-type protein, and the catalytic activity of the protein is 6.4 mu mol/min/mg. The results of the experiment are shown in FIG. 2.
After the escherichia coli in the obtained induced fermentation broth is separated, weighing and detecting that the wet weight of the escherichia coli is as high as 80-150g/L, adding the escherichia coli into wastewater containing hydroquinone, and detecting that the content of the hydroquinone is only 20-80ppm after 14-24g of escherichia coli lysate is used for treating 1 ton of wastewater containing 0.5-2g/L of hydroquinone for 8-16h at 4 ℃. The experimental results are shown in fig. 3 and 4.
Sequence listing
<110> Lanzhou City college
<120> mutant protein applied to low-temperature degradation of hydroquinone wastewater and construction method
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 511
<212> PRT
<213> Sphingomonas sp
<400> 1
Met Ala Asp Val Val Thr Glu Phe Gly Ala Leu Thr Asp Tyr Arg Lys
1 5 10 15
Arg Gly Val Glu Ile Ile Asp Asp Asp Pro Arg Asn Tyr Val Phe Ser
20 25 30
Asn Val Phe Glu Val Ala Ala Asn Ala Ala Pro Tyr Glu Arg Val Ala
35 40 45
Val Gly Lys Asn Phe Glu Tyr Val Ile Glu Ser Ala Arg Ala Glu Gly
50 55 60
Thr Ser Gly Trp Phe Ser Cys Ala His Asp Glu Phe Val Leu Ala Met
65 70 75 80
Asp Gly Gln Ile Glu Val His Asp Leu Lys Leu Asp Asn Ser Asp Ala
85 90 95
Tyr Val Asp Pro Asp Ser Glu Gly Ala Val Ala Ile Gly Glu Ala Leu
100 105 110
Pro Glu Gly Arg Lys Met Gly Arg Ile Val Leu Arg Arg Gly His Met
115 120 125
Ala Leu Leu Pro His Gly Ala Ala Tyr Arg Phe Tyr Ala Glu Gln Pro
130 135 140
Ala Ala Met Leu Phe Gln Ser Ile Glu Gly Ala Val Thr Val Gln Lys
145 150 155 160
Trp Gly Glu Ile Cys Gln Thr Glu Ala Ala Met Ala Met Ser Glu Ala
165 170 175
Leu Glu Ile Ile Asp Phe Gly Asp Ser Lys Ala Arg Thr Asp Thr Glu
180 185 190
His Leu Ala Ile Asn Asn Glu Thr Gly Tyr Arg Ser Phe Arg Ala Gly
195 200 205
Gly Phe Thr Phe Thr Arg Asp Glu Tyr Phe Ala Arg Leu Thr Trp Pro
210 215 220
Gly Gly Ser His Ile Ile Pro Ile Asp Ala Phe Leu Arg Ala Val Met
225 230 235 240
Arg Asp Val Ala Trp Gly Phe Phe Tyr Gly Val Val Asn Phe Asp His
245 250 255
Val Phe Gly Thr Ile Asn His Tyr Gly Glu Val Thr Met Phe Ala Gly
260 265 270
Arg Phe Asn Asp Ala Tyr Arg Asn Ala Gly Arg Asp His Glu Glu Arg
275 280 285
Phe Lys Ser Ser Ala Leu Met Ala Val Phe Lys Asp Ile Leu Ser Asp
290 295 300
Trp Thr Val Glu Gly Tyr Asp Pro Phe Ala Ala Pro Met Lys Thr Gly
305 310 315 320
Leu Pro Trp Gly Ile Lys Asn Gly Asn Asn Asp Glu Ala Ile Ser Arg
325 330 335
Gln Arg Val Thr Ala Arg Arg Met Val Gly Leu Pro Gly Asp Thr Pro
340 345 350
Val Arg Thr Asp Ala Asn Gly Phe Pro Val Asn Arg Gln Phe Ala Asp
355 360 365
Val Pro Gln Glu Gln Pro Val Val Glu Ala Glu Pro Gly Phe Glu Ala
370 375 380
Glu Val Ser Ala Tyr Asn Leu Phe Gly Tyr Leu Ser Arg Ser Asp Val
385 390 395 400
Thr Trp Asn Pro Ser Val Cys Ser Val Val Gly Asp Ser Leu Phe Cys
405 410 415
Pro Thr Ser Glu Glu Phe Ile Leu Pro Val Glu His Gly Asn Asp Arg
420 425 430
Cys Glu Trp Phe Leu Gln Leu Ser Asp Glu Ile Val Trp Asp Val Lys
435 440 445
Asp Lys Glu Ser Gly Lys Pro Arg Ala Arg Val Thr Ala Arg Ala Gly
450 455 460
Asp Ile Cys Cys Met Pro Ala Asp Ile Arg His Gln Gly Tyr Ser Thr
465 470 475 480
Lys Arg Ser Met Leu Leu Val Trp Glu Asn Gly Ser Pro Lys Ile Pro
485 490 495
Gln Met Ile Ala Asp Gly Thr Ala Pro Val Val Pro Val Thr Phe
500 505 510
<210> 2
<211> 170
<212> PRT
<213> Sphingomonas sp
<400> 2
Met Ala Asp Val Val Thr Glu Phe Gly Ala Leu Thr Asp Tyr Arg Lys
1 5 10 15
Arg Gly Val Glu Ile Ile Asp Asp Asp Pro Arg Asn Tyr Val Phe Ser
20 25 30
Asn Val Phe Glu Val Ala Ala Asn Ala Ala Pro Tyr Glu Arg Val Ala
35 40 45
Val Gly Lys Asn Phe Glu Tyr Val Ile Glu Ser Ala Arg Ala Glu Gly
50 55 60
Thr Ser Gly Trp Phe Ser Cys Ala His Asp Glu Phe Val Leu Ala Met
65 70 75 80
Asp Gly Gln Ile Glu Val His Asp Leu Lys Leu Asp Asn Ser Asp Ala
85 90 95
Tyr Val Asp Pro Asp Ser Glu Gly Ala Val Ala Ile Gly Glu Ala Leu
100 105 110
Pro Glu Gly Arg Lys Met Gly Arg Ile Val Leu Arg Arg Gly His Met
115 120 125
Ala Leu Leu Pro His Gly Ala Ala Tyr Arg Phe Tyr Ala Glu Gln Pro
130 135 140
Ala Ala Met Leu Phe Gln Ser Ile Glu Gly Ala Val Thr Val Gln Lys
145 150 155 160
Trp Gly Glu Ile Cys Gln Thr Glu Ala Ala
165 170
<210> 3
<211> 341
<212> PRT
<213> Sphingomonas sp
<400> 3
Met Ala Met Ser Glu Ala Leu Glu Ile Ile Asp Phe Gly Asp Ser Lys
1 5 10 15
Ala Arg Thr Asp Thr Glu His Leu Ala Ile Asn Asn Glu Thr Gly Tyr
20 25 30
Arg Ser Phe Arg Ala Gly Gly Phe Thr Phe Thr Arg Asp Glu Tyr Phe
35 40 45
Ala Arg Leu Thr Trp Pro Gly Gly Ser His Ile Ile Pro Ile Asp Ala
50 55 60
Phe Leu Arg Ala Val Met Arg Asp Val Ala Trp Gly Phe Phe Tyr Gly
65 70 75 80
Val Val Asn Phe Asp His Val Phe Gly Thr Ile Asn His Tyr Gly Glu
85 90 95
Val Thr Met Phe Ala Gly Arg Phe Asn Asp Ala Tyr Arg Asn Ala Gly
100 105 110
Arg Asp His Glu Glu Arg Phe Lys Ser Ser Ala Leu Met Ala Val Phe
115 120 125
Lys Asp Ile Leu Ser Asp Trp Thr Val Glu Gly Tyr Asp Pro Phe Ala
130 135 140
Ala Pro Met Lys Thr Gly Leu Pro Trp Gly Ile Lys Asn Gly Asn Asn
145 150 155 160
Asp Glu Ala Ile Ser Arg Gln Arg Val Thr Ala Arg Arg Met Val Gly
165 170 175
Leu Pro Gly Asp Thr Pro Val Arg Thr Asp Ala Asn Gly Phe Pro Val
180 185 190
Asn Arg Gln Phe Ala Asp Val Pro Gln Glu Gln Pro Val Val Glu Ala
195 200 205
Glu Pro Gly Phe Glu Ala Glu Val Ser Ala Tyr Asn Leu Phe Gly Tyr
210 215 220
Leu Ser Arg Ser Asp Val Thr Trp Asn Pro Ser Val Cys Ser Val Val
225 230 235 240
Gly Asp Ser Leu Phe Cys Pro Thr Ser Glu Glu Phe Ile Leu Pro Val
245 250 255
Glu His Gly Asn Asp Arg Cys Glu Trp Phe Leu Gln Leu Ser Asp Glu
260 265 270
Ile Val Trp Asp Val Lys Asp Lys Glu Ser Gly Lys Pro Arg Ala Arg
275 280 285
Val Thr Ala Arg Ala Gly Asp Ile Cys Cys Met Pro Ala Asp Ile Arg
290 295 300
His Gln Gly Tyr Ser Thr Lys Arg Ser Met Leu Leu Val Trp Glu Asn
305 310 315 320
Gly Ser Pro Lys Ile Pro Gln Met Ile Ala Asp Gly Thr Ala Pro Val
325 330 335
Val Pro Val Thr Phe
340
Claims (9)
1. The mutein applied to the low-temperature degradation of hydroquinone wastewater is characterized in that the amino acid sequence of the mutein is shown in SEQ ID NO. 1.
2. The mutein according to claim 1, wherein the mutein comprises the mutein hqdAmuAnd the mutein hqdBmuThe mutein hqdAmuThe amino acid sequence of (A) is shown as SEQ ID NO.2, and the mutant protein hqdBmuThe amino acid sequence of (A) is shown in SEQ ID NO. 3.
3. The mutein according to claim 2, wherein the mutein hqdA is characterized in thatmuGlycine at the 17 th site, leucine at the 88 th site and valine at the 133 th site of the protein hqdA are respectively mutated into arginine, aspartic acid and histidine; the mutein hqdBmuThe methionine at the 39 th position and the glutamic acid at the 148 th position of the protein hqdB are respectively mutated into valine and lysine.
4. A construction method of mutant protein applied to low-temperature degradation of hydroquinone wastewater is characterized by comprising the following steps:
step one, taking a genome of Sphingomonas sp.strain as a PCR amplification template, amplifying hqdA by using PCR amplification primers P1 and P2, and amplifying hqdB by using PCR amplification primers P3 and P4, wherein the sequences of P1, P2, P3 and P4 are respectively as follows:
P1：AAGGATCCGATGGCCGACGTGGTCACC；
P2：GCAAGCTTTCAGGCCGCCTCGGTCTGG；
P3：AACATATGATGGCTATGTCCGAAGCACTTG；
P4：AACTCGAGTCAGAAAGTGACCGGGACCAC；
respectively purifying and enzyme-cutting the amplified products, and respectively connecting the enzyme-cut products to an escherichia coli co-expression vector pETduet-1 to construct pETduet-1-hqdA and pETduet-1-hqdB;
step two, amplifying hqdBmu by using PCR amplification primers P3 and P4 and an error-prone PCR kit, and amplifying hqdBmu by using PCR amplification primersAmplifying hqdAmu by using P1, P2 and an error-prone PCR kit, respectively purifying and enzyme-cutting the amplified products, respectively connecting the enzyme-cut products to pETduet-1-hqdA and pETduet-1-hqdB obtained in the step one to construct pETduet-1-hqdABmuAnd pETduet-1-hqdBAmu；
Step three, the pETduet-1-hqdAB obtained in the step twomuAnd pETduet-1-hqdBAmuRespectively transferring the bacterial colonies into escherichia coli BL21 for colony culture, and transferring the obtained bacterial colonies into an LB culture medium for strain culture;
fourthly, carrying out site-directed mutagenesis on the hqdA and the hqdB on the pETduet-1-hqdAB by utilizing a site-directed mutagenesis kit, and finally constructing and finishing pETduet-1-hqdABmu 2;
step five, pETduet-1-hqdABmu2, transforming the strain into escherichia coli BL21 competence, culturing the strain, inoculating the strain to a culture medium for high-density fermentation, adding a feed liquid after the fermentation, adding a sterilized yeast extract until the final concentration is 1-4%, culturing the strain at 37 ℃ until the concentration is OD600 (OD 600) is 0.5-0.8, adding IPTG (isopropyl-beta-thiogalactoside) with the concentration of 0.1-0.8mM, inducing at 20-28 ℃ overnight to obtain a fermentation liquid, adding an induction feed liquid during the induction process, separating escherichia coli from the fermentation liquid after the feed is finished, centrifugally collecting the thalli, resuspending the thalli according to the proportion of 1g of the thalli with 6ml of PBS (phosphate buffer solution), crushing the thalli by using ultrasonic waves, and purifying the protein by using a His-tag purification kit to prepare the mutant protein.
5. The method for constructing the mutein of claim 4, wherein the LB solid medium in step three contains 0.005-0.015g/L hydroquinone, 0.1-0.8mM IPTG.
6. The method of claim 4, wherein the inoculation in step five is carried out using a high-density fermentation medium of Escherichia coli at an inoculation ratio of 1:50 to 1: 100.
7. The method of claim 4, wherein the feed solution in step five comprises glucose, magnesium sulfate, vitamins and trace elements.
8. The method of claim 4, wherein the inducing supplement solution of step five comprises glycerol, magnesium sulfate, vitamin B1, and trace elements.
9. The use of the mutein of claim 1 for the degradation of low temperature phenol-containing wastewater.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910454531.0A CN112010948B (en) | 2019-05-29 | 2019-05-29 | Mutant protein applied to low-temperature degradation of hydroquinone wastewater and construction method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910454531.0A CN112010948B (en) | 2019-05-29 | 2019-05-29 | Mutant protein applied to low-temperature degradation of hydroquinone wastewater and construction method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112010948A true CN112010948A (en) | 2020-12-01 |
| CN112010948B CN112010948B (en) | 2021-03-16 |
Family
ID=73500715
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910454531.0A Expired - Fee Related CN112010948B (en) | 2019-05-29 | 2019-05-29 | Mutant protein applied to low-temperature degradation of hydroquinone wastewater and construction method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112010948B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102911962A (en) * | 2011-08-02 | 2013-02-06 | 中国科学院微生物研究所 | Method for modifying microbes and for acquiring improved phenotype |
| CN105907688A (en) * | 2016-06-27 | 2016-08-31 | 南京工业大学 | Strain for degrading phenol compounds and application thereof |
| CN107603991A (en) * | 2017-10-24 | 2018-01-19 | 河南科技大学 | A kind of Catechol 2,3 dioxygenase genes and its application |
-
2019
- 2019-05-29 CN CN201910454531.0A patent/CN112010948B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102911962A (en) * | 2011-08-02 | 2013-02-06 | 中国科学院微生物研究所 | Method for modifying microbes and for acquiring improved phenotype |
| CN105907688A (en) * | 2016-06-27 | 2016-08-31 | 南京工业大学 | Strain for degrading phenol compounds and application thereof |
| CN107603991A (en) * | 2017-10-24 | 2018-01-19 | 河南科技大学 | A kind of Catechol 2,3 dioxygenase genes and its application |
Non-Patent Citations (3)
| Title |
|---|
| B.A. KOLVENBACH和P.F.-X. CORVINI: "The degradation of alkylphenols by Sphingomonas sp. strain TTNP3-a review on seven years of research", 《NEW BIOTECHNOLOGY》 * |
| 无: "WP_066521100.1", 《GENBANK》 * |
| 罗巅辉: "α-乙酰乳酸脱羧酶的定向进化及低温条件下高活力突变酶的筛选", 《中国优秀博硕士学位论文全文数据库（硕士）基础科学辑》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112010948B (en) | 2021-03-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210009981A1 (en) | Nitrilase mutant, construction method therefor, and application thereof | |
| CN111876404B (en) | Aldolase mutant and coding gene and application thereof | |
| CN108467860B (en) | Method for high yield of gamma-aminobutyric acid | |
| CN108342378B (en) | Glutamic acid decarboxylase mutant and coding gene and application thereof | |
| CN112626057B (en) | Chimeric plant nitrilase mutant, coding gene and application thereof | |
| CN113862233B (en) | Method for improving acid stability of glucose oxidase, mutant Q241E/R499E, gene and application | |
| CN106939315B (en) | Preparation method and application of oxalate decarboxylase | |
| CN106244569B (en) | Esterase EstC10, and coding gene and application thereof | |
| CN113337495B (en) | Method for improving sialic acid yield and application | |
| CN110699396B (en) | Method for preparing D-aromatic amino acid by cascade reaction | |
| CN112010948B (en) | Mutant protein applied to low-temperature degradation of hydroquinone wastewater and construction method | |
| CN115948363B (en) | Tn5 transposase mutant and preparation method and application thereof | |
| CN109593739B (en) | Recombinant ketoacid reductase mutant, gene, engineering bacterium and application thereof | |
| CN113735282B (en) | Old yellow enzyme OYE2 protein and application thereof in chromium pollution | |
| CN110551697A (en) | Application of ergothioneine synthetase PEGT1 and PEGT2 of Pleurotus ostreatus in synthesis of ergothioneine | |
| CN115786315A (en) | Acylase, coding gene, engineering bacterium and application in hydrolyzing and synthesizing N-fatty acyl-glutamic acid type surfactant | |
| CN111394323B (en) | Recombinant RecA protein and expression method and application thereof | |
| CN109266634B (en) | Application of deinococcus radiodurans keratinase gene kerA | |
| CN106834311B (en) | Acidic lipoxygenase, and preparation method and application thereof | |
| CN110029093B (en) | Recombinant glucose dehydrogenase and preparation method and encoding gene thereof | |
| CN114249803B (en) | Engineering bacterium for high-yield arginine and construction method and application thereof | |
| CN118207172B (en) | Bifunctional glutathione synthase mutant and application thereof | |
| CN107236718B (en) | Low-temperature esterase from metagenome, coding gene and application thereof | |
| CN114107270B (en) | L-aspartic acid beta-decarboxylase mutant | |
| CN110066814B (en) | beta-D-glucosidase gene and encoding protein thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20210316 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |