CN111999497B - ELISA kit for detecting rabies virus glycoprotein antigen and application thereof - Google Patents

ELISA kit for detecting rabies virus glycoprotein antigen and application thereof Download PDF

Info

Publication number
CN111999497B
CN111999497B CN202010854943.6A CN202010854943A CN111999497B CN 111999497 B CN111999497 B CN 111999497B CN 202010854943 A CN202010854943 A CN 202010854943A CN 111999497 B CN111999497 B CN 111999497B
Authority
CN
China
Prior art keywords
amino acid
solution
seq
rabies virus
acid sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010854943.6A
Other languages
Chinese (zh)
Other versions
CN111999497A (en
Inventor
董春娜
张蕾
宋芳
肖进
齐鹏
李静
李鹏宇
刘新月
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
China Animal Husbandry Industry Co Ltd
Original Assignee
China Animal Husbandry Industry Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by China Animal Husbandry Industry Co Ltd filed Critical China Animal Husbandry Industry Co Ltd
Priority to CN202010854943.6A priority Critical patent/CN111999497B/en
Publication of CN111999497A publication Critical patent/CN111999497A/en
Application granted granted Critical
Publication of CN111999497B publication Critical patent/CN111999497B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • G01N33/56994—Herpetoviridae, e.g. cytomegalovirus, Epstein-Barr virus
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/531—Production of immunochemical test materials
    • G01N33/532—Production of labelled immunochemicals
    • G01N33/535—Production of labelled immunochemicals with enzyme label or co-enzymes, co-factors, enzyme inhibitors or enzyme substrates
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
    • G01N2333/08—RNA viruses
    • G01N2333/145—Rhabdoviridae, e.g. rabies virus, Duvenhage virus, Mokola virus or vesicular stomatitis virus
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • Microbiology (AREA)
  • Organic Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses an enzyme-linked immunosorbent assay kit for specifically and quantitatively detecting rabies virus glycoprotein antigen and application thereof. The kit comprises an ELISA plate coated with a capture antibody and a monoclonal antibody of an ELISA antibody. The monoclonal antibody heavy chain variable region: CDR1 is shown as amino acids 31-36 of sequence 1; CDR2 is shown as amino acids 51-66 of sequence 1; CDR3 is shown as amino acids 99-105 of sequence 1; light chain variable region: CDR1 is shown as amino acids 24-40 of sequence 2; CDR2 is shown as amino acids 56-62 of sequence 2; CDR3 is shown as amino acids 95-103 of sequence 2. The ELISA quantitative detection kit prepared by the specific monoclonal antibody of the rabies virus has high sensitivity and strong specificity, and can effectively distinguish and detect the content of rabies virus glycoprotein antigen in a sample.

Description

ELISA kit for detecting rabies virus glycoprotein antigen and application thereof
Technical Field
The invention belongs to the technical field of biological detection, and particularly relates to an enzyme-linked immunosorbent assay kit for specifically and quantitatively detecting rabies virus glycoprotein antigen, which is suitable for specific, rapid and accurate detection of rabies virus glycoprotein antigen.
Background
Rabies virus is a member of the Rhabdoviridae genus rabies virus (Lysavirus). Based on analysis and identification of rabies virus N protein monoclonal antibodies and G protein series, rabies viruses in various places around the world are mainly divided into 4 serotypes. Among them, serotype 1 is the most widely known rabies virus with the greatest geographical distribution and greatest threat to the health of people worldwide, and includes wild viruses and fixed virus laboratory strains (such as SAD). With the progress of modern molecular biology research, rabies virus is classified into 7 genotypes, genotypes 2 to 6 are found only in europe and africa, referring to the similarity of 500 nucleotides at the N-terminus of the rabies virus nucleoprotein (N protein) gene.
Rabies virus is a non-segmented single-stranded negative-strand RNA virus with a total genome length of about 1,2000nt, mainly encoding five known structural proteins: nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G) and RNA-dependent RNA polymerase (L). During rabies virus infection, both cellular and humoral immune responses can be generated by the human and animal body. Mainly invading nerve cells and T lymphocyte-based lymphocytes, but has less influence on B lymphocytes. In this process, viral immunity is now increasingly being related to both N and P proteins, in addition to G proteins. The length of the N gene is 1350-1353nt, and the N gene encodes N protein (Nucleopritien) and is mainly responsible for packaging viral genome RNA. Because the N gene is abundant in content and the encoded N protein is easy to detect by a fluorescent antibody method, the N gene and the N protein are most widely applied to antigen diagnosis and evolution analysis.
The existing methods for determining rabies virus glycoprotein antigen mainly comprise a cell culture separation method, an RT-PCR nucleic acid detection method and a virus separation method, and mainly comprise a cell culture separation method and a milk mouse inoculation method separation method, and the detection methods are all required to be completed in a P2 or P3 laboratory, and the detection methods can be completed only by professional laboratory staff and equipment, are long in time consumption and cannot meet the requirement of large-scale rapid diagnosis, so that the rabies virus glycoprotein antigen detection method is required to be developed, and the method is convenient to operate, specific, sensitive, accurate and reliable.
At present, enzyme-Linked immunosorbent assay (Enzyme-Linked ImmunosorbentAssays, ELISA) is a mainstream immunoassay technology in the market, has been widely applied to clinical detection, is quick and convenient and has high sensitivity, and does not need special instruments and equipment. With the development of monoclonal antibody technology, antigen detection methods of various pathogens have been unprecedented, and as monoclonal antibodies are antibodies prepared by screening aiming at single epitopes on antigens, rabies virus glycoprotein antigens can be sensitively and specifically identified, a foundation is laid for the detection method of rabies virus glycoprotein antigens based on monoclonal antibody technology, and the detection method of enzyme-linked immunosorbent assay related to quantitative detection of rabies antigens is not searched at present, so that the invention has originality and novelty.
Disclosure of Invention
The invention aims to provide an ELISA kit for specifically and quantitatively detecting rabies virus glycoprotein antigen, which utilizes a monoclonal antibody RV1 capable of being specifically combined with rabies virus glycoprotein antigen as a capture antibody and a detection antibody, establishes a rabies virus glycoprotein antigen detection method with good specificity, sensitivity and repeatability, and is used for detecting the rabies virus glycoprotein antigen content in culture solution, inactivated solution, purified solution, concentrated solution, demulsified finished vaccine and the like in the vaccine production process.
Based on the purpose, the enzyme-linked immunosorbent assay kit for specifically and quantitatively detecting rabies virus glycoprotein antigen comprises an enzyme-linked reaction plate coated with a capture antibody and an enzyme-labeled detection antibody. The enzyme-labeled detection antibody is preferably a horseradish-labeled antibody, and the horseradish peroxidase can be crosslinked on the detection antibody by a glutaraldehyde method or a periodic acid method. Both the capture antibody and the detection antibody are monoclonal antibodies RV1 which specifically bind to rabies virus glycoprotein antigen.
The capture antibody and the detection antibody (monoclonal antibody RV1 specifically combined with rabies glycoprotein antigen) are heavy chain variable region RV1-V H And light chain variable region RV1-V L The method comprises the steps of carrying out a first treatment on the surface of the The RV1-V H And RV1-V L Are composed of a determinant complementary region and a framework region; the RV1-V H And said RV1-V L Is composed of CDR1, CDR2 and CDR 3; the RV1-V H The amino acid sequence of CDR1 of (1) is shown as 31-36 amino acids of SEQ ID No. 1; the RV1-V H The amino acid sequence of CDR2 of (1) is shown as 51-66 th amino acid of SEQ ID No. 1; the RV1-V H The amino acid sequence of CDR3 of (1) is shown as 99 th to 105 th amino acids of SEQ ID No. 1; the RV1-V L The amino acid sequence of CDR1 of (1) is shown as 24-40 th amino acid of SEQ ID No. 2; the RV1-V L The amino acid sequence of CDR2 of (2) is shown as 56-62 th amino acid of SEQ ID No. 2; the RV1-V L The amino acid sequence of CDR3 of (2) is shown as 95 th-103 th amino acid of SEQ ID No. 2;
preferably, the RV1-V H The amino acid sequence of (2) is shown as the 1 st to 116 th positions of SEQ ID No.1 in the sequence table; RV1-V of L The amino acid sequence of (2) is shown as the 1 st to 113 rd positions of SEQ ID No.2 in the sequence table;
the optimal coating preparation method and the optimal coating conditions of the ELISA plate are that a specific monoclonal antibody RV1 of rabies virus is diluted into 0.5-10 mug/ml (preferably 0.5-4 mug/ml, more preferably 1-4 mug/ml, and finally 1 mug/ml) by a carbonate solution with the pH of 9.6, then the solution is added into a 96-hole polystyrene ELISA plate, 100 mug/hole is placed for 8-12 hours at the temperature of 2-8 ℃ to enable the specific monoclonal antibody RV1 to be fully combined with the ELISA plate, then PBS buffer solution with the pH of 10mg/ml bovine serum albumin 7.4 is added according to 300 mug/hole, the solution is sealed for 2-3 hours at the temperature of 37 ℃, and after the ELISA plate is dried, the solution is sealed and stored at the temperature of 2-8 ℃.
Preferably, the kit further comprises an antigen standard, wherein the antigen standard is rabies glycoprotein antigen, the purity is not lower than 80%, the antigen content is 4IU, and when in use, the antigen standard is diluted to (6.2 mIU-200 mIU) by a sample diluent, and the OD is measured 450nm The values are used to plot a standard curve.
The kit is a double-antibody sandwich method enzyme-linked immunosorbent assay kit prepared from a rabies virus specific monoclonal antibody, and quantitatively detects the antigen content of rabies virus in a sample by detecting signal change generated by an enzyme catalytic substrate.
Further, the kit also comprises a sample diluent, a 20-time concentrated washing solution, a substrate solution A, a substrate solution B and a stop solution. The ELISA plate is a detachable 96-hole ELISA plate. The sample dilution was a phosphate buffer with a value of 7.4 of 0.01M, pH containing 5mg/ml casein. The 20-time concentrated washing liquid is phosphate buffer solution with the pH value of 7.4 and 0.01M containing Tween-20 with the concentration of 0.8% -1.2% (ml/ml). The substrate solution A is a citric acid phosphate buffer solution containing 0.6mg/ml of urea hydrogen peroxide, the substrate solution B is a tetramethyl benzidine solution with the concentration of 0.2mg/ml, and the substrate solution A and the substrate solution B are mixed in a ratio of 1:1 when the substrate solution A is used. The stop solution is 2mol/L sulfuric acid solution.
The invention also claims monoclonal antibodies that specifically bind to rabies virus glycoprotein antigen, which are the following monoclonal antibodies:
1) Comprising heavy chain variable regions RV1-V H And light chain variable region RV1-V L The method comprises the steps of carrying out a first treatment on the surface of the The RV1-V H And RV1-V L Are composed of a determinant complementary region and a framework region; the RV1-V H And said RV1-V L Is composed of CDR1, CDR2 and CDR 3; the RV1-V H The amino acid sequence of CDR1 of (1) is shown as 31-36 amino acids of SEQ ID No. 1; the RV1-V H The amino acid sequence of CDR2 of (1) is shown as 51-66 th amino acid of SEQ ID No. 1; the RV1-V H The amino acid sequence of CDR3 of (1) is shown as 99 th to 105 th amino acids of SEQ ID No. 1; the RV1-V L The amino acid sequence of CDR1 of (1) is shown as 24-40 th amino acid of SEQ ID No. 2; the RV1-V L The amino acid sequence of CDR2 of (2) is shown as 56-62 th amino acid of SEQ ID No. 2; the RV1-V L The amino acid sequence of CDR3 of (2) is shown as 95 th-103 th amino acid of SEQ ID No. 2;
2) Containing a heavy chain variable region RV1-V H And light chain variable region RV1-V L The method comprises the steps of carrying out a first treatment on the surface of the The RV1-V H The amino acid sequence of (2) is shown as the 1 st to 116 th positions of SEQ ID No.1 in the sequence table; RV1-V of L The amino acid sequence of (2) is shown as the 1 st to 113 rd positions of SEQ ID No.2 in the sequence table; the application of the ELISA kit in the specific quantitative detection of rabies virus glycoprotein antigen also belongs to the protection scope of the invention.
The application of the monoclonal antibody capable of specifically combining with rabies virus glycoprotein antigen in preparing a kit for detecting rabies virus is also the protection scope of the invention. In particular to the application in preparing a kit for detecting rabies virus.
The method for obtaining the monoclonal antibody capable of specifically binding to rabies virus glycoprotein antigen comprises the following steps: the rabies virus-specific monoclonal cell strain of the present invention is selected according to conventional methods known in the art. Specifically, the specific monoclonal antibody of rabies virus of the present invention may comprise the steps of:
1) The inactivated rabies virus glycoprotein antigen is obtained by a hollow fiber purification method, the purity is not lower than 80 percent, and the inactivated rabies virus glycoprotein antigen is used as an immunogen;
2) Immunizing animals with rabies virus inactivated antigen as immunogen, continuously immunizing for 4 times at intervals of 14 days, adopting multipoint subcutaneous immunization mode for the first 3 times, adopting intraperitoneal injection immunization mode for the 4 th time, and 1 mg/animal each time;
3) Separating spleen cells of the immunized animal, fusing the spleen cells with myeloma cells, screening hybridoma cells by using a HAT selective medium, and screening specific positive clones from hybridoma cell supernatants by using an indirect ELISA method; when the serum antibody level of the immunized animal is detected by indirect ELISA to a titer exceeding 1:50000, spleen cells of the animal can be isolated and prepared as a single cell suspension, and fused with myeloma cells (preferably, mouse myeloma cells SP 2/0) under the induction of an appropriate fusion agent (such as polyethylene glycol) to form hybridomas, and then cultured in HAT medium to screen the fused hybridoma cells, and further a desired specific monoclonal antibody cell line can be identified by indirect ELISA or the like, and pairing test, preferably, a monoclonal cell line secreting RV1 as a monoclonal cell line for detecting rabies glycoprotein antigen can be performed.
7) Expression and purification of specific monoclonal antibodies: rabies virus specific monoclonal antibody RV1 isolated and purified from culture solution of hybridoma cell strain RV1 or ascites of inoculated animals.
8) The above-mentioned immunized animal for producing a monoclonal antibody may be a mammal such as a mouse, a rat, a rabbit, a goat, a sheep, a pig, etc., preferably a mouse.
The detection program of the kit provided by the invention is as follows:
1) Balance: taking the kit out of the refrigeration environment, and standing at room temperature for 30min for standby; the liquid reagent is mixed evenly before use.
2) Preparing liquid: diluting the concentrated washing solution with distilled water or deionized water for 20 times to obtain a washing buffer solution;
3) Sample dilution: the antigen standard substance is serially diluted by sample diluent in a ratio of 1:20-1:1280, the corresponding antigen concentration is respectively 200mIU, 100mIU, 50mIU, 25mIU, 12.5mIU and 6.2mIU, and the sample to be tested is also serially diluted by sample diluent in a ratio of 4-8.
4) Sample adding: taking out the required strips, putting the rest strips into an aluminum foil bag, sealing, and storing at 2-8 ℃ for standby. The diluted sample to be detected and the serial diluted antigen standard substance are added into a coating plate, 100 mu l/hole is provided, 1 hole is used as negative quality control, and only sample diluent is added. The time span of the sample adding process should be as short as possible. Sample addition as shown in fig. 1: S1-S6: 1:20-1:640 times ratio of diluted antigen standard, N: indicating a negative quality control well, only adding sample diluent; t1: indicating the addition of each sample to be tested.
5) Incubation: shaking and mixing uniformly, and placing in a 37 ℃ incubator for reaction for 30min.
6) Washing the plate: the reaction solution was discarded, 300. Mu.l of the diluted washing buffer was added to each well, the mixture was immersed for 15 seconds, the washing solution was discarded, and the plate was washed continuously for 4 times and then dried by pipetting.
7) Adding enzyme: 100 μl of enzyme-labeled antibody was added to each well.
8) Incubation: placing in a 37 ℃ incubator for reaction for 30min.
9) Washing the plate: the reaction solution was discarded, 300. Mu.l of the diluted washing buffer was added to each well, immersed for 15 seconds, the washing solution was thrown away, and the plate was washed continuously for 4 times and then dried by shaking.
10 Adding 100 μl of substrate working solution (substrate working solution A and substrate working solution B are mixed in equal amounts to obtain substrate working solution, and mixing immediately before use), shaking, mixing, placing in a 37 deg.C incubator, and reacting for 15min in dark place.
11 50. Mu.l of a color development stop solution was added to each well, and the mixture was stirred and stirred to terminate the reaction.
12 Determination of OD per well 450nm Value (the reaction plate with stop solution should read OD within 15 min) 450nm Values).
13 Result analysis: antigen standard (200 mIU) well OD 450nm The value is more than or equal to 1.5, otherwise, the method is invalid; negative quality control hole OD 450nm The value is less than or equal to 0.15, otherwise, the method is invalid; concentration calculation: according to the OD of each well of antigen standard 450nm And drawing a standard curve according to the values, and calculating the rabies virus content in each sample to be tested.
In the above detection method, the samples to be detected may be selected from various types, such as culture solution, inactivating solution, purified solution, concentrated solution, and demulsified vaccine product in vaccine production process.
The result analysis method in step 13) may be: detection of wells with antigen standards at each dilution OD 450nm Value and negative quality control well OD 450nm The values were taken as X-axis and protein concentration was taken as Y-axis, using the EXCEL program, → "insert" → "scatter plot", selecting "scatter plot with smooth line and data marker" → "trend line" → "polynomial" → "display formula" and "display R square value". Usually R 2 A value of 0.98 or more indicates that the standard curve is authentic (where points with too high or too low an OD should be discarded). Each 96-well plate should be set with a set of standards and a corresponding standard curve drawn. Sample well OD according to polynomial equation 450nm The values are taken into calculation to obtain the antigen concentration in the sample.
The invention has the positive effects that: the ELISA kit for quantitatively detecting the rabies virus provided by the invention has the advantages of high sensitivity, good specificity and convenience in operation, and can be used for stably detecting the content of the rabies virus glycoprotein antigen. The kit is a double-antibody sandwich method enzyme-linked immunosorbent assay kit prepared by a specific monoclonal antibody RV1 of rabies virus, and can quantitatively detect the content of rabies virus glycoprotein antigen in a sample by detecting signal change generated by an enzyme catalytic substrate.
In conclusion, the kit adopts the double-antibody sandwich method ELISA quantitative detection kit prepared from the specific monoclonal antibody of the rabies virus, has high sensitivity and strong specificity, and can effectively distinguish and detect the content of rabies virus glycoprotein antigen in a sample. Meanwhile, the operation method can finish the detection of 88 samples except the antigen standard product and the negative quality control hole at most within 1.5 hours, greatly shortens the detection period, does not need an expensive ultracentrifuge, provides a more convenient and effective method for quality control in vaccine production, and has wide market prospect and good economic and social benefits.
Drawings
FIG. 1 is a schematic diagram of the ELISA plate loading of the kit of the invention.
Detailed Description
The methods in the following examples are conventional methods unless otherwise specified.
The various biomaterials described in the examples were obtained by merely providing an experimental route for achieving the objectives of the specific disclosure and should not be construed as limiting the source of biomaterials of the present invention. In fact, the source of the biological material used is broad, and any biological material that is not legal or ethical in violation of availability may be substituted as suggested in the examples.
Examples detailed embodiments and specific operation procedures are given on the premise of the technical scheme of the present invention, and examples will help to understand the present invention, but the protection scope of the present invention is not limited to the following examples.
EXAMPLE 1 screening of specific hybridoma cell lines for rabies Virus monoclonal antibodies
The method comprises the following steps:
1) The rabies virus inactivated antigen (provided by Jiangxi biological pharmaceutical factories of the middle-grazing practice Co., ltd.) is obtained by a hollow fiber method, and the purity is more than or equal to 80 percent and is used as an immunogen;
2) The immunized animals were BALB/c mice (purchased from Beijing vitamin Toril laboratory animal technology Co., ltd.) continuously immunized 4 times at 14 days intervals, the first 3 times adopting a multipoint subcutaneous immunization mode, the 4 th time adopting an intraperitoneal injection immunization mode, and each mouse being injected with 1mg of antigen;
3) 7 days after final immunization, separating serum from mouse tail blood, detecting by indirect ELISA, separating spleen cells of immunized animals after titer is more than 1:50000, fusing the spleen cells with myeloma cells SP2/0 with good growth state, and screening by HAT selective medium to obtain hybridoma cells;
4) Screening specific positive clones from hybridoma cell supernatant by using an indirect ELISA method to finally obtain 3 specific positive clones; the specific operation steps are as follows: the rabies virus inactivated antigen is dissolved in a carbonate solution with pH of 9.6 to dilute the concentration to 2 mug/ml, then the diluted solution is added into a 96-hole polystyrene enzyme-linked reaction plate, 100 mug/hole is placed at the temperature of 2-8 ℃ for 8-12 hours, the specific monoclonal antibody is fully combined with the enzyme-linked reaction plate, then PBS buffer solution containing 10mg/ml bovine serum albumin with pH of 7.4 is added into the solution according to 300 mug/hole, the sealing treatment is carried out for 2-3 hours at 37 ℃, after the solution is dried, the solution is sealed by aluminum foil paper after the enzyme-linked reaction plate is dried, and the solution is preserved at the temperature of 2-8 ℃ for standby.
The cell culture supernatant was added to an ELISA plate coated with virus antigen, reacted at 37℃for 30 minutes, washed 4 times with a washing solution (0.01M phosphate buffer containing Tween-20 at a concentration of 0.8% -1.2% (ml/ml) and having a pH of 7.4, diluted 20 times with double distilled water when used), and after drying by shaking, a 1:5000 dilution of a rabbit anti-mouse IgG-HRP marker (available from Sigma Co. Of America) was added to each well, reacted at 37℃for 30 minutes, washed 4 times, and after drying by shaking, 50. Mu.l each of substrate working solution, substrate solution A (0.6 mg/ml hydrogen peroxide in 0.2mg/ml tetramethyl benzidine) and substrate solution B (in 0.2mg/ml tetramethyl benzidine) were added to each well, and reacted at 37℃for 15 minutes in a dark place. To each well was added 50. Mu.l of a stop solution (2 mol/L sulfuric acid solution), and the mixture was stirred and stirred to terminate the reaction. OD per well was measured within 15min 450nm Values. With absorbance value > yinThe specificity monoclonal antibody titer in the cell culture supernatant is measured by taking the positive judgment standard of the sex control (namely the plate washing culture solution) multiplied by 2.1 times, meanwhile, whether the monoclonal antibody plate washing strain has cross reaction with other viruses or not is measured, and finally, 2 specific cell clones which only have strong signal reaction with rabies viruses but do not react with the negative control are obtained, and the 2 strains are respectively numbered RV1 and RV2.
Example 2 pairing test of rabies virus monoclonal purified antibody
1) Preparation of coated plates with specific monoclonal antibodies to rabies virus
Diluting the purified specific monoclonal antibody into 0.5 mug/ml, 1 mug/ml, 2 mug/ml and 4 mug/ml coating working solution by using carbonate solution with the pH of 9.6, adding the solution into a 96-hole polystyrene enzyme-linked reaction plate, placing the solution at the temperature of 2-8 ℃ for 8-12 hours at the temperature of 100 mug/hole, fully combining the specific monoclonal antibody with the enzyme-linked reaction plate, adding PBS buffer solution with the pH of 10mg/ml bovine serum albumin 7.4 into the solution according to the temperature of 300 mug/hole, sealing the solution for 2-3 hours at the temperature of 37 ℃, and drying the solution, and sealing and storing the solution at the temperature of 2-8 ℃ after the enzyme-linked reaction plate is dried.
2) Preparation of horseradish peroxidase-labeled rabies virus-specific monoclonal antibodies
Coupling the specific monoclonal antibody of rabies virus with horseradish peroxidase (HRP) by glutaraldehyde oxidation, dialyzing thoroughly with PBS buffer solution of pH7.4, adding equal amount of high-quality glycerol, and preserving below-20deg.C. The method comprises the following specific steps:
(1) 5mg of HRP is dissolved in 0.2ml of PBS buffer solution containing 1.25 percent of glutaraldehyde and having the pH value of 0.1mol/L and 6.8, and the solution is placed at room temperature for coupling for 18 hours, and redundant glutaraldehyde is fully dialyzed out;
(2) adding physiological saline to 1ml, then adding 2.5mg of purified rabies virus specific monoclonal antibody and 0.1ml of 1mol/L carbonate buffer solution with pH value of 9.6, and placing at 2-8 ℃ for 24 hours;
(3) 0.1ml of a 0.3mol/L lysine solution was added thereto, and the mixture was left at room temperature for 2 hours;
(4) the precipitate was removed by centrifugation after sufficient dialysis against PBS buffer pH7.4, and the supernatant was the enzyme conjugate. The enzyme label is diluted by the enzyme label diluent according to a certain proportion (1:1000, 1:2000 and 1:4000 times dilution) to obtain the working fluid of the enzyme label.
3) The pairing test between 2 specific antibodies was determined using checkerboard titration.
(1) Adding an antigen: diluting the antigen with a sample diluent, wherein one part of the antigen has the concentration of 100mIU, and one part of the antigen has the concentration of 10mIU,100 mu l/hole, and reacting for 30 minutes at 37 ℃;
(2) adding the ELISA monoclonal antibody: after the plates are washed for 4 times continuously, adding the ELISA monoclonal antibodies (RV 1 and RV 2), and reacting for 30 minutes at 37 ℃;
(3) color development: after the plate is washed continuously for 4 times, 100 mul of substrate working solution (substrate working solution A and substrate working solution B are mixed in equal quantity to be substrate working solution which is prepared at present) is added, and the mixture is vibrated and mixed uniformly and placed in a 37 ℃ incubator to react for 15min in a dark place;
(4) reading: 50 μl of the color development stop solution was added to each well, and the reaction was stopped by shaking and mixing. Determination of OD per well 450nm Values. OD with 100mIU sample 450nm Value (A) divided by OD of 10mIU sample 450nm The larger the A/B value, the higher the detection sensitivity of the monoclonal antibody pair, and the results are shown in tables 1-3, so RV1 is preferably used as a capture antibody and a detection antibody for simultaneous detection, RV1 can be selected to be 1 mug/ml as the capture antibody, and RV1 can be selected to be 1:2000 as the detection antibody for dilution.
TABLE 1 pairing test results (A/B values) with RV1 as the capture antibody
TABLE 2 pairing test results (A/B values) with RV2 as the capture antibody
EXAMPLE 3 subculture and preservation of rabies Virus monoclonal antibody
The subculture of hybridoma cells comprises the following steps:
1) Culturing and passaging the hybridoma cells RV1 screened in a DMEM medium containing 10% of fetal calf serum (containing 100U/ml penicillin and 100 mug/ml streptomycin);
2) After culturing until the 10 th generation, the hybridoma cell strain can still grow well and stably pass, the titer in the supernatant can still reach more than 1:50, and the result shows that the hybridoma cell strain capable of stably passing and continuously and stably secreting the anti-rabies monoclonal antibody is obtained.
The preservation of hybridoma cells includes the following steps: in subculturing hybridoma cells, since mutation may occur during serial passage and thus the ability to secrete monoclonal antibodies is lost, and further in order to prevent contamination which may occur during the culturing, it is necessary to preserve a portion of the hybridoma cells;
1) Removing the culture solution in the cell culture dish, and adding DMEM culture medium suspension cells containing 10% fetal bovine serum;
2) Centrifugation at 1000r/min for 10min, the supernatant was discarded, and the cell pellet was washed with cell cryopreservation solution (dimethyl sulfoxide: fetal bovine serum: dmem=1:3:6) suspension cells at a concentration of 5×10 5 Cells/ml;
3) Cell counting with trypan blue, the activity rate should be above 95%;
4) The cells were aseptically dispensed into cryopreservation tubes, 1 ml/tube, placed at 4℃for 2 hours, then at-20℃for 2 hours, overnight at-80℃and finally transferred into liquid nitrogen for long-term storage.
The hybridoma cell strain which can continuously and stably secrete the rabies virus specific monoclonal antibody and is prepared by the method is named RV1.
EXAMPLE 4 preparation of rabies virus-specific monoclonal antibodies
1) Monoclonal antibodies were prepared in large quantities using animal bodies: adult BALB/c mice were selected, and the immunosuppressant was inoculated intraperitoneally with 0.5 ml/mouse of a reduced alkane which could cause an inflammatory response;
2) The hybridoma cells RV1,2 multiplied by 10 are inoculated in the abdominal cavity after 7 to 10 days 6 ～3×10 6 Individual/mouse. After 5 days, when the abdomen is obviously enlarged and the skin has tension, the ascites can be collected by a 9-gauge needle；
3) Centrifuging the ascites (10,000 r/min, centrifuging for 30 minutes) to remove cellular components and other sediments, and collecting the supernatant;
4) Diluting the supernatant with 15-30 times volume of PBS buffer pH7.4, purifying with Protein A affinity chromatography column, and purifying with Na 3 PO 4 And (3) balancing the protein A pre-packed column by using a solution with the pH value of 7.0, balancing the column volume for 3-5 columns, combining the supernatant with the protein A pre-packed column, and eluting by using a Glycine-HCL eluent with the pH value of 3.0 after the sample is combined, thus obtaining the purified RV1.
Example 5 Gene sequencing of rabies Virus-specific hybridoma cell lines, establishment of monoclonal antibody recombinant expression System and purification of monoclonal antibody
The method comprises the following steps:
1) Specific positive clone hybridoma cell strain total RNA extraction, reverse transcription, PCR and sequence determination:
(1) total RNA extraction: mu.l of hybridoma cell suspension was taken, 750. Mu.l of Trizol was added, mixed upside down, 200. Mu.l of chloroform was added, mixed, and centrifuged at 12000rpm at 4℃for 15min. The supernatant was aspirated into a fresh 1.5ml EP tube, 600. Mu.l of isopropanol was added, mixed well and centrifuged for 10min. The isopropanol was discarded, washed with 75% DEPC ethanol and centrifuged. The ethanol was discarded, dried, and RNA was dissolved in 20. Mu.l RNase-free water.
(2) Reverse transcription: the cDNA of the hybridoma cell was obtained by reverse transcription using Invitrogen reverse transcription kit according to the instructions.
(3) Clone sequencing of PCR reactions and their products: universal primers were designed for the heavy and light chain variable regions with the following sequence information:
TABLE 3 heavy and light chain variable region Universal primers
Name of the name Sequence (5 '-3')
V H -1 (Forward) GTGAATTCATGCAGGTGCAGCTGTTGGAGTCTGG
V H -2 (reverse) ATGTCGACTGAGGAGACGGTGACCAGGGTGCC
V L -1 (Forward) GTGAATTCATGGACATTGTGATGACCCAGTCTCC
V L -2 (reverse) CAGTCGACTTACGTTTGATCTCCAGCTTGGTCCC
Amplifying the target fragment by using an amplification primer, recovering the fragment by using gel after the amplification, and then connecting a carrier for sequence determination to obtain the sequence information of the heavy chain and the light chain variable regions of the monoclonal antibody.
2) Synthesis of gene sequence of specific monoclonal antibody and establishment of recombinant expression system
(1) Synthesis of the gene sequence: according to the sequences of the heavy chain and the light chain variable regions of the monoclonal antibody RV1, the sequences of the heavy chain and the light chain constant regions of the murine antibody are supplemented at the variable region part, then the murine antibody heavy chain and the light chain constant regions are sent to Shanghai JieRui biological engineering Limited company for gene sequence synthesis and insect cell codon optimization, the nucleotide sequence of the heavy chain of the RV1 is shown as SEQ ID No.3 (full-length sequence is a coding sequence) in a sequence table, and the nucleotide sequence of the light chain is shown as SEQ ID No.4 (full-length sequence is a coding sequence) in the sequence table.
(2) Construction of shuttle vector: corresponding primers (sequences see Table 2 below) were designed based on the sequence information of the heavy and light chains and the pFastBactral (available from Thermo Fisher Co., ltd., cat. No. 10712024) vector sequence information, the full-length fragments of the heavy and light chains were amplified, and after the gel was recovered, the primers were ligated into the pFastBactral vector containing two promoters, namely the PH promoter and the P10 promoter, and the GP67 signal peptide sequence information was contained after the PH promoter sequence, the HDM signal peptide sequence information was contained after the P10 promoter sequence, and sequence determination was performed after the ligation into the vector to ensure the accuracy of the sequence.
TABLE 4 expression vector construction primer sequence information
Name of the name Sequence (5 '-3')
RV1-HF TCATACATCTACGCGGCCGCTAGCGACGTGCAGTTGCAG
RV1-HR TCCCCCATCTCCCGGTACCCTTTCCGGGGGA
RV1-LF CTGCCTTTGCGGCGGATGAATTCGACATCGTGATGACCCAGA
RV1-LR CTAGTACTTCTCGACAAGCTTGGAGCACTCGGTTGGA
(3) Screening and extracting recombinant Bacmid: the constructed shuttle vector is transformed into DH10Bac competent, then a three-antibody flat plate (kanamycin, gentamicin and tetracyclomycin) is coated, white spots are selected after culturing for 48 hours in a 37 ℃ incubator, M13 primers are used for identification, the size of a target fragment of positive clone is 4600bp, negative clone is 300bp, clone shaking bacteria without 300bp strips is selected, the extraction of Bacmid is carried out by adopting an isopropanol precipitation method after 12 hours, and then the concentration measurement is carried out by utilizing Nanodrop.
(4) Rescue of recombinant baculoviruses: density was 2X 10 before transfection 6 The SF9 cells of (2) are spread into six pore plates, the recombinant Bacmid is transfected according to the amount of 5 mug and 2.5 mug, the dosage of the transfection reagent is 8 mug, the liquid is changed for 4 to 6 hours after the transfection, the culture is carried out at 28 ℃, the amplified P2 generation virus is harvested after 72 hours, and the P3 generation virus amplification is carried out by adopting the same method. Amplification of the P4 generation virus adopts shake flask amplification, and the virus inoculation ratio is 1:100.
3) Expression and purification of specific monoclonal antibodies: the P4 generation virus is inoculated at the density of 2 multiplied by 10 according to the proportion of 1:5 6 Culturing Hi5 cells at 28deg.C, harvesting cells after 48h, centrifuging at 8000r/min for 1h to obtain supernatant, and filtering with 0.22 μm filter membrane. With Na 3 PO 4 And (3) balancing the protein A pre-packed column by using a solution with the pH value of 7.0, balancing the volume of the column for 3-5, combining the cell supernatant with the protein A pre-packed column, and eluting by using a Glycine-HCL eluent with the pH value of 3.0 after the sample is combined, thereby obtaining the purified rabies virus G protein specific monoclonal antibody RV1. Determination of OD with ultraviolet Spectrophotometer 280nm Value of the OD 280nm The value divided by the empirical factor of 1.48 is the concentration of monoclonal antibody in mg/ml. The results showed that RV1 secreted monoclonal antibody at a concentration of 1.26mg/ml.
Example 6 preparation of an ELISA kit for quantitative detection of rabies Virus glycoprotein antigen
1) Preparation of antigen coated plate using rabies virus specific monoclonal antibody
The purified specific monoclonal antibody obtained in example 5 was diluted with a carbonate solution having a pH of 9.6 to prepare a coating working solution of 1. Mu.g/ml, then the solution was added to a 96-well polystyrene ELISA plate, 100. Mu.l/well and left at 2 to 8℃for 8 to 12 hours to allow the specific monoclonal antibody to bind well to the ELISA plate, then 300. Mu.l/well of PBS buffer containing 10mg/ml bovine serum albumin pH7.4 was added, the solution was subjected to blocking treatment at 37℃for 2 to 3 hours, and after drying, the plate was subjected to sealing preservation at 2 to 8℃after drying.
2) Preparation of horseradish peroxidase-labeled rabies virus-specific monoclonal antibodies
The specific monoclonal antibody of rabies virus prepared in example 5 was conjugated with horseradish peroxidase (HRP) by glutaraldehyde oxidation, thoroughly dialyzed against PBS buffer at pH7.4, and stored at-20deg.C or below with an equal amount of high-quality glycerol. The method comprises the following specific steps:
(1) 5mg of HRP is dissolved in 0.2ml of PBS buffer solution containing 1.25 percent of glutaraldehyde and having the pH value of 0.1mol/L and 6.8, and the solution is placed at room temperature for coupling for 18 hours, and redundant glutaraldehyde is fully dialyzed out;
(2) adding physiological saline to 1ml, then adding 2.5mg of purified rabies virus specific monoclonal antibody and 0.1ml of 1mol/L carbonate buffer solution with pH value of 9.6, and placing at 2-8 ℃ for 24 hours;
(3) 0.1ml of a 0.3mol/L lysine solution was added thereto, and the mixture was left at room temperature for 2 hours;
(4) the precipitate was removed by centrifugation after sufficient dialysis against PBS buffer pH7.4, and the supernatant was the enzyme conjugate. And diluting the enzyme label diluent according to a certain proportion to obtain the working solution of the enzyme label.
3) Preparation of rabies virus glycoprotein antigen standard
In order to facilitate the analysis of results, the kit also comprises a rabies virus glycoprotein antigen standard substance, in particular a rabies virus glycoprotein antigen purified solution produced by a rabies virus vaccine factory, the purity is not lower than 80%, the antigen content is 4IU, the rabies virus glycoprotein antigen purified solution is packaged into 1.0 ml/tube, when in use, the rabies virus glycoprotein antigen purified solution is diluted by a sample diluent (1:20-1:640) in a ratio, a label is attached, and the rabies virus glycoprotein antigen purified solution is preserved below-20 ℃ for standby.
4) Sample dilutions were prepared as phosphate buffer, 1 bottle (24 ml/bottle) with a value of 7.4, 0.01M, pH containing 5mg/ml casein.
5) Preparation of substrate solution A was a citrate phosphate buffer (1 bottle, 12 ml/bottle) containing 0.6mg/ml urea hydrogen peroxide
6) The substrate solution B was prepared as a 0.2mg/ml solution of Tetramethylbenzidine (TMB) (1 bottle, 12 ml/bottle).
7) A20-fold concentrated washing solution was prepared as a phosphate buffer (50 ml/bottle, 2 bottles) containing Tween-20 at a concentration of 0.8% to 1.2% (ml/ml) at 0.01M and a pH of 7.4.
8) Preparation of stop solution 2mol/L sulfuric acid solution (1 bottle, 12 ml/bottle).
9) The kit may also have sample dilution plates (2, 96 wells/block) for sample dilution, as desired.
Example 7 use of enzyme-Linked immunosorbent assay kit for quantitative detection of rabies virus glycoprotein antigen
1) Balance: taking the kit out of the refrigeration environment, and standing at room temperature for 30min for standby; the liquid reagent is mixed evenly before use.
2) Preparing liquid: diluting the concentrated washing solution with distilled water or deionized water for 20 times to obtain a washing buffer solution;
3) Sample dilution: the antigen standard substance is serially diluted by sample diluent in a ratio of 1:20-1:640, the corresponding antigen concentration is 200mIU, 100mIU, 50mIU, 25mIU, 12.5mIU and 6.2mIU respectively, and the sample to be tested is also serially diluted by sample diluent in a ratio of 4-8.
4) Sample adding: taking out the required strips, putting the rest strips into an aluminum foil bag, sealing, and storing at 2-8 ℃ for standby. The diluted sample to be detected and the serial diluted antigen standard substance are added into a coating plate, 100 mu l/hole is provided, 1 hole is used as negative quality control, and only sample diluent is added. The time span of the sample adding process should be as short as possible. As shown in fig. 1, the sample was added: S1-S6: 1:20-1:640 times ratio of diluted antigen standard, N: indicating a negative quality control well, only adding sample diluent; t1: indicating the addition of each sample to be tested.
5) Incubation: shaking and mixing uniformly, and placing in a 37 ℃ incubator for reaction for 30min.
6) Washing the plate: the reaction solution was discarded, 300. Mu.l of the diluted washing buffer was added to each well, the mixture was immersed for 15 seconds, the washing solution was discarded, and the plate was washed continuously for 4 times and then dried by pipetting.
7) Adding enzyme: 100 μl of enzyme-labeled antibody was added to each well.
8) Incubation: placing in a 37 ℃ incubator for reaction for 30min.
9) Washing the plate: the reaction solution was discarded, 300. Mu.l of the diluted washing buffer was added to each well, immersed for 15 seconds, the washing solution was thrown away, and the plate was washed continuously for 4 times and then dried by shaking.
10 Adding 100 μl of substrate working solution (substrate working solution A and substrate working solution B are mixed in equal amounts to obtain substrate working solution, and mixing immediately before use), shaking, mixing, placing in a 37 deg.C incubator, and reacting for 15min in dark place.
11 50. Mu.l of a color development stop solution was added to each well, and the mixture was stirred and stirred to terminate the reaction.
12 Determination of OD per well 450nm Value (the reaction plate with stop solution should read OD within 15 min) 450nm Values).
13 Result analysis: antigen standard (200 mIU) well OD 450nm The value is more than or equal to 1.5, otherwise, the method is invalid; negative quality control hole OD 450nm The value is less than or equal to 0.15, otherwise, the method is invalid; concentration calculation: according to the OD of each well of antigen standard 450nm And drawing a standard curve according to the values, and calculating the rabies virus content in each sample to be tested.
In the above detection method, the samples to be detected may be selected from various types, such as culture solution, inactivating solution, purified solution, concentrated solution, and demulsified vaccine product in vaccine production process.
The result analysis method in step 13) may be: detection of wells with antigen standards at each dilution OD 450nm Value and negative quality control well OD 450nm The values were taken as X-axis and protein concentration was taken as Y-axis, using the EXCEL program, → "insert" → "scatter plot", selecting "scatter plot with smooth line and data marker" → "trend line" → "polynomial" → "display formula" and "display R square value". Usually R 2 A value of 0.98 or more indicates that the standard curve is authentic (where points with too high or too low an OD should be discarded). Each 96-well plate should be set with a set of standards and a corresponding standard curve drawn. Sample well OD according to polynomial equation 450nm The values are taken into calculation to obtain the antigen concentration in the sample.
The above test procedure takes about 1.5 hours, and a maximum of 88 samples can be tested in one experiment.
Example 8 sensitivity test
3 batches of kits were used, the sample dilution was used, 100. Mu.l/well was repeated for 8 wells, and the detection was performed according to the kit of example 6 and the detection method of example 7, and the average value (X) +3×standard deviation (SD) was calculated as the detection sensitivity of the present kit, with the maximum value being the sensitivity of the present kit.
TABLE 5 sensitivity test
Kit lot Average value (X) Standard Deviation (SD) X+3SD
1 0.75 0.38 1.89
2 1.59 0.46 2.97
3 1.61 0.49 3.08
The results of 3 replicates (Table 4) showed that the sensitivity of the kit was 3.08mIU, but that less than this sensitivity could also be detected with the kit.
Example 9 specificity test
BHK21 cell host protein, canine parvovirus antigen, canine distemper antigen, canine adenovirus antigen and canine parainfluenza antigen are selected, diluted by sample diluent in the kit, and detected according to the kit of example 6 and the detection method of example 7, and meanwhile, negative quality control holes (namely only the sample diluent is added) are arranged, so that the detection result shows that the kit has no nonspecific reaction and 100% of specificity to the pathogens.
Example 10 comparison of the kit of the invention and its detection method with the mouse NIH method
In order to verify the accuracy and convenience of the detection result of the invention, a comparison test is carried out with a mouse NIH method. 3 rabies PV strain samples are detected simultaneously by using the kit and a mouse NIH method. The detection results are shown in Table 6, and the coincidence rate of the two detection methods is high.
Table 6 results of comparative test of the kit and mouse NIH method
Meanwhile, in the aspect of operation convenience, the whole operation of the kit only needs 1.5 hours, 88 samples can be detected at most, the verification time of rabies vaccine can be shortened from 28 days to 1.5 hours, the waiting time of the vaccine is shortened, the production and sales efficiency of the vaccine is improved, and finally the NIH animal method is replaced.
<110> Medium-grazing practice Co., ltd
<120> ELISA kit for detecting rabies virus glycoprotein antigen and application thereof
<130> WHOI201056
<170> Patent-In 3.5
<160> 4
<210> 1
<211> 116
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 1
Asp Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln
1 5 10 15
Ser Leu Ser Leu Thr Cys Ser Val Thr Gly Tyr Ser Ile Thr Ser Lys
20 25 30
Tyr Asn Trp Trp Trp Ile Arg Gln Phe Pro Gly Asn Lys Leu Glu Trp
35 40 45
Met Gly Tyr Ile Tyr Tyr Asp Gly Ser Tyr Asn Tyr Pro Pro Ser Leu
50 55 60
Lys Asn Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn Gln Phe Phe
65 70 75 80
Leu Asn Leu Asn Ser Val Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys
85 90 95
Ala Arg Gly Gly Ser Ser Arg Thr Asn Trp Gly Gln Gly Thr Thr Leu
100 105 110
Thr Val Ser Ser
115
<210> 2
<211> 113
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 2
Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Ala Met Ser Val Gly
1 5 10 15
Gln Lys Val Thr Met Ser Cys Asn Tyr Ser Gln Ser Leu Leu Tyr Ser
20 25 30
Ser Asn Gln Lys Tyr Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln
35 40 45
Ser Pro Lys Leu Leu Val Tyr Phe Ala Ser Gly Gly Glu Ser Gly Val
50 55 60
Pro Asp Arg Phe Ile Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr
65 70 75 80
Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Asp Tyr Phe Cys Asn Thr
85 90 95
His Tyr Ser Thr Gly Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu
100 105 110
Lys
<210> 3
<211> 1023
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
gacgtgcagt tgcaggagtc cggtcccgga ttggtgaagc catcccagtc cttgtccttg 60
acctgctccg tgactggcta ctccatcacc tccaagtaca actggtggtg gatcaggcag 120
ttccccggaa acaagttgga gtggatggga tacatctact acgacggtag ctacaactac 180
cctcctagct tgaagaaccg tatctccatc acccgcgaca ccagcaagaa ccagttcttc 240
ctcaacttga acagcgtgac caccgaggac accgctacct actactgcgc tcgcggcggt 300
agcagccgta ccaactgggg acagggaacc accttgaccg tcagctccac ccacacctgc 360
cctccatgcc ccgccccaga gttgctcggc ggcccatccg tcttcctgtt ccctccaaag 420
cctaaggaca ccctcatgat cagccgtacc ccagaggtca cctgcgtcgt cgtcgatgtg 480
tcccacgagg accctgaggt caagttcaac tggtacgtgg acggtgtgga ggtgcacaac 540
gctaagacca agcctagaga ggagcagtac aacagcacct acagagtcgt gagcgtgctg 600
accgtgttgc accaggactg gctgaacgga aaggagtaca agtgcaaggt gagcaacaag 660
gctttgcccg ccccaatcga gaaaaccatc agcaaggcta agggtcagcc acgcgagcca 720
caggtgtaca ccttgcctcc tagccgcgac gagttgacca agaaccaggt ttccctcacc 780
tgcctcgtga agggtttcta ccctagcgac atcgctgtcg agtgggagag caacggccag 840
cctgagaaca actacaagac cacccctcct gtgctcgact ccgacgggtc gttcttcttg 900
tactccaagc tgaccgtaga taagtccaga tggcagcagg gtaacgtctt ctcttgtagc 960
gtcatgcacg aggctttgca caaccactac acccagaaga gcttgagctt gtcccccgga 1020
aag 1023
<210> 4
<211> 642
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
gacatcgtga tgacccagag cccatccagc ttggctatgt ccgtcggaca gaaggtcacc 60
atgtcctgca actactccca gtccctgttg tacagctcca accagaagta ctacctcgcc 120
tggtatcagc agaagccagg tcagtcccca aagttgctcg tgtacttcgc ctcgggtgga 180
gagagcggtg tgcccgacag attcatcggt tccggcagcg gaaccgactt caccttgacc 240
atcagcagcg tgcaggctga ggacctcgcc gactacttct gcaacaccca ctacagcacc 300
ggattgacct tcggcgctgg aaccaagctg gagttgaagg cccctagcgt caccttgttc 360
cctcctagct ccgaggagtt gcaggctaac aaggctacct tggtctgcct gatcagcgac 420
ttctaccccg gcgctgtgac cgtggcttgg aaggccgact ccagccctgt caaggccggc 480
gtcgagacca ccacccctag caagcagtcc aacaacaagt acgccgcttc ctcctacttg 540
agcctcaccc ctgagcagtg gaagagccac agatcctaca gctgccaggt gacccacgag 600
ggtagcaccg tcgaaaaaac cgtcgctcca accgagtgct cc 642

Claims (11)

1. An ELISA kit for specifically and quantitatively detecting rabies virus glycoprotein antigen comprises an ELISA plate coated with a capture antibody and an enzyme-labeled detection antibody; both the capture antibody and the detection antibody are monoclonal antibodies RV1 which specifically bind to rabies virus glycoprotein antigen; the monoclonal antibody specifically binding to rabies virus glycoprotein antigen contains heavy chain variable region RV1-V H And light chain variable region RV1-V L The method comprises the steps of carrying out a first treatment on the surface of the The RV1-V H And RV1-V L Are composed of a determinant complementary region and a framework region; the RV1-V H And said RV1-V L Is composed of CDR1, CDR2 and CDR 3; the RV1-V H The amino acid sequence of CDR1 of the polypeptide is shown as 31 th to 36 th amino acids of SEQ ID No. 1; the RV1-V H The amino acid sequence of CDR2 of the polypeptide is shown as 51-66 th amino acid of SEQ ID No. 1; the RV1-V H The amino acid sequence of CDR3 of the polypeptide is shown as 99 th to 105 th amino acids of SEQ ID No. 1; the RV1-V L The amino acid sequence of CDR1 of the polypeptide is shown as 24 th to 40 th amino acid of SEQ ID No. 2; the RV1-V L The amino acid sequence of CDR2 of the polypeptide is shown as 56 th to 62 th amino acids of SEQ ID No. 2; the RV1-V L The amino acid sequence of CDR3 of the polypeptide is shown as 95 th to 103 th amino acid of SEQ ID No. 2.
2. The enzyme-linked immunosorbent assay kit according to claim 1, wherein: the RV1-V H The amino acid sequence of (1) is shown as 1 st to 116 th positions of SEQ ID No.1 in a sequence table; RV1-V of L The amino acid sequence of (2) is shown as 1 st to 113 rd positions of SEQ ID No.2 in a sequence table.
3. The enzyme-linked immunosorbent assay kit according to claim 1, wherein: the kit also comprises an antigen standard substance, wherein the antigen standard substance is rabies virus glycoprotein antigen.
4. The enzyme-linked immunosorbent assay kit according to claim 1, wherein: the method for obtaining the ELISA plate comprises the steps of dissolving the capture antibody in a carbonate solution with the pH value of 9.6, adding the carbonate solution into a 96-well polystyrene ELISA plate, placing 50 ng-1000 ng of the capture antibody in each well at the temperature of 2-8 ℃ for 8-12 hours, enabling the capture antibody to be fully combined with the ELISA plate, adding PBS buffer solution with the pH value of 10mg/ml bovine serum albumin (pH 7.4) into the ELISA plate according to 300 mu l/well, sealing the ELISA plate at the temperature of 37 ℃ for 2-3 hours, spin-drying, and sealing and storing at the temperature of 4 ℃ after the ELISA plate is dried.
5. The enzyme-linked immunosorbent assay kit according to claim 1, wherein: the kit also comprises a substrate solution A, a substrate solution B and a stop solution; the substrate solution A is a citric acid phosphate buffer solution containing 0.6mg/ml of urea hydrogen peroxide, the substrate solution B is a tetramethyl benzidine solution of 0.2mg/ml, and the two solutions are mixed in a ratio of 1:1 when in use; the stop solution is 2mol/L sulfuric acid solution.
6. The enzyme-linked immunosorbent assay kit according to claim 1, wherein: the kit also comprises a sample diluent and a 20-time concentrated washing liquid; the sample diluent is phosphate buffer solution with the value of 0.01M, pH and 7.4 and containing 5mg/ml casein; the 20-time concentrated washing liquid is phosphate buffer solution with the concentration of 0.8% -1.2% Tween-20 and the pH value of 7.4.
7. Use of the enzyme-linked immunosorbent assay kit as claimed in any one of claims 1 to 6 for the specific quantitative detection of rabies virus glycoprotein antigen.
8. The use according to claim 7, wherein the sample to be tested is a culture solution, an inactivated solution, a purified solution, a concentrated solution or a demulsified finished vaccine during the production of the vaccine.
9. Monoclonal antibodies specifically binding to rabies virus glycoprotein antigen, comprising heavy chain variable region RV1-V H And light chain variable region RV1-V L The method comprises the steps of carrying out a first treatment on the surface of the The RV1-V H And RV1-V L Are all determinants of each otherThe repair area and the frame area are formed; the RV1-V H And said RV1-V L Is composed of CDR1, CDR2 and CDR 3; the RV1-V H The amino acid sequence of CDR1 of the polypeptide is shown as 31 th to 36 th amino acids of SEQ ID No. 1; the RV1-V H The amino acid sequence of CDR2 of the polypeptide is shown as 51-66 th amino acid of SEQ ID No. 1; the RV1-V H The amino acid sequence of CDR3 of the polypeptide is shown as 99 th to 105 th amino acids of SEQ ID No. 1; the RV1-V L The amino acid sequence of CDR1 of the polypeptide is shown as 24 th to 40 th amino acid of SEQ ID No. 2; the RV1-V L The amino acid sequence of CDR2 of the polypeptide is shown as 56 th to 62 th amino acids of SEQ ID No. 2; the RV1-V L The amino acid sequence of CDR3 of the polypeptide is shown as 95 th to 103 th amino acid of SEQ ID No. 2.
10. The monoclonal antibody of claim 9, wherein the RV1-V H The amino acid sequence of (1) is shown as 1 st to 116 th positions of SEQ ID No.1 in a sequence table; RV1-V of L The amino acid sequence of (2) is shown as 1 st to 113 rd positions of SEQ ID No.2 in a sequence table.
11. Use of the monoclonal antibody of claim 9 or 10 in the preparation of a kit for detecting rabies virus glycoprotein antigen.
CN202010854943.6A 2020-08-24 2020-08-24 ELISA kit for detecting rabies virus glycoprotein antigen and application thereof Active CN111999497B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010854943.6A CN111999497B (en) 2020-08-24 2020-08-24 ELISA kit for detecting rabies virus glycoprotein antigen and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010854943.6A CN111999497B (en) 2020-08-24 2020-08-24 ELISA kit for detecting rabies virus glycoprotein antigen and application thereof

Publications (2)

Publication Number Publication Date
CN111999497A CN111999497A (en) 2020-11-27
CN111999497B true CN111999497B (en) 2023-08-08

Family

ID=73474007

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010854943.6A Active CN111999497B (en) 2020-08-24 2020-08-24 ELISA kit for detecting rabies virus glycoprotein antigen and application thereof

Country Status (1)

Country Link
CN (1) CN111999497B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112684185B (en) * 2020-12-25 2024-01-12 苏州旭光科星抗体生物科技有限公司 Soluble B7-H4 quantitative detection kit and application thereof
CN113009139B (en) * 2021-02-26 2022-07-29 中牧实业股份有限公司 Enzyme linked immunosorbent assay kit for detecting porcine pseudorabies virus antigen and application thereof
CN114958774B (en) * 2022-05-08 2023-10-27 中国医学科学院医学生物学研究所 Anti-rabies virus monoclonal antibody, hybridoma cell strain secreting antibody and application

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011080765A2 (en) * 2010-01-04 2011-07-07 Indian Immunologicals Limited Recombinant human bivalent diabody against rabies virus and uses thereof
CN103848915A (en) * 2012-12-03 2014-06-11 长春百克生物科技股份公司 Preparation and application of novel anti-rabies virus glycoprotein human-derived genetically-engineered antibody
CN105481979A (en) * 2016-01-07 2016-04-13 中国疾病预防控制中心病毒病预防控制所 Humanized anti-rabies-virus glycoprotein neutralizing antibody RV3A5 and application thereof
CN109580945A (en) * 2018-12-11 2019-04-05 中牧实业股份有限公司 Detect enzyme linked immunological kit and its application of the O-shaped Guangxi Strain antigen of aftosa
CN109900902A (en) * 2019-03-29 2019-06-18 中牧实业股份有限公司 A kind of porcine pseudorabies virus gB blocks ELISA antibody assay kit and its application

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011080765A2 (en) * 2010-01-04 2011-07-07 Indian Immunologicals Limited Recombinant human bivalent diabody against rabies virus and uses thereof
CN103848915A (en) * 2012-12-03 2014-06-11 长春百克生物科技股份公司 Preparation and application of novel anti-rabies virus glycoprotein human-derived genetically-engineered antibody
CN105481979A (en) * 2016-01-07 2016-04-13 中国疾病预防控制中心病毒病预防控制所 Humanized anti-rabies-virus glycoprotein neutralizing antibody RV3A5 and application thereof
CN109580945A (en) * 2018-12-11 2019-04-05 中牧实业股份有限公司 Detect enzyme linked immunological kit and its application of the O-shaped Guangxi Strain antigen of aftosa
CN109900902A (en) * 2019-03-29 2019-06-18 中牧实业股份有限公司 A kind of porcine pseudorabies virus gB blocks ELISA antibody assay kit and its application

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
狂犬病病毒糖蛋白抗原表位富集区单克隆抗体的制备;郑佳琳等;《中国畜牧兽医学会畜牧兽医生物技术学分会暨中国免疫学会兽医免疫分会第八次学术研讨会论文集》;332-335页 *

Also Published As

Publication number Publication date
CN111999497A (en) 2020-11-27

Similar Documents

Publication Publication Date Title
CN111999497B (en) ELISA kit for detecting rabies virus glycoprotein antigen and application thereof
CN109900902B (en) Porcine pseudorabies virus gB blocking ELISA antibody detection kit and application thereof
CN113740536B (en) African swine fever virus p30 blocking ELISA antibody detection kit and application thereof
CN111848786B (en) Monoclonal antibody, preparation method and application thereof
CN107973850B (en) Recombinant classical swine fever virus E2 protein swine-derived monoclonal antibody, and preparation method and application thereof
CN103048459B (en) Immune detection reagent for detecting respiratory syncytial virus
CN109580945B (en) Enzyme linked immunosorbent assay kit for detecting O-type Guangxi strain antigen of foot-and-mouth disease and application thereof
CN109900903B (en) Porcine pseudorabies virus gE blocking ELISA antibody detection kit and application thereof
CN111349161A (en) Monoclonal antibody of anti-CD 19 antibody and application thereof
CN113045662B (en) Nano antibody for specifically recognizing PD-L1 and application thereof
Yan et al. Recombinant soluble Henipavirus glycoprotein preparation
CN113687073B (en) African swine fever virus p54 blocking ELISA antibody detection kit and application thereof
CN113009139B (en) Enzyme linked immunosorbent assay kit for detecting porcine pseudorabies virus antigen and application thereof
WO2019165019A1 (en) Antibodies to human respiratory syncytial virus protein f pre-fusion conformation and methods of use therefor
Munasinghe et al. Immuno-dominant dengue NS1 peptides as antigens for production of monoclonal antibodies
CN116143909A (en) anti-HIV-1P 24 antibody and preparation method and application thereof
CN109824775B (en) Foot-and-mouth disease A type Wuhan strain monoclonal antibody, composition and application thereof
CN114966013B (en) ELISA kit for detecting African swine fever virus antigen and application thereof
CN112903996A (en) nCoV-N protein detection kit and nCoV-N protein detection method
CN109613238B (en) Enzyme linked immunosorbent assay kit for detecting foot-and-mouth disease A type Wuhan strain antigen and application thereof
CN110655572A (en) Monoclonal antibody for resisting filovirus GP protein and application thereof
CN118731351A (en) ELISA kit for specific quantitative detection of foot-and-mouth disease O-type antigen and application thereof
CN117487005B (en) Broad-spectrum neutralizing antibody targeting Huntipa virus fusion protein DIII region and application thereof
CN116718765A (en) Bovine sarcoidosis blocking ELISA antibody detection kit and application thereof
CN117402238B (en) Broad-spectrum neutralizing antibody targeting henipa virus fusion protein DI and DIII region and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant