CN111996129B

CN111996129B - New strain of cicada fungus and its use in anti-tumor and bacteriostasis

Info

Publication number: CN111996129B
Application number: CN202010929239.2A
Authority: CN
Inventors: 胡惠萍; 吴清平; 李向敏; 刘远超; 卓丽君; 谢意珍
Original assignee: Guangdong Detection Center of Microbiology of Guangdong Institute of Microbiology
Current assignee: Guangdong Detection Center of Microbiology of Guangdong Institute of Microbiology
Priority date: 2020-09-07
Filing date: 2020-09-07
Publication date: 2022-06-17
Anticipated expiration: 2040-09-07
Also published as: CN111996129A

Abstract

The invention relates to a new strain of cicada fungus and application thereof in the aspects of tumor resistance and bacteriostasis, wherein the new strain is separated from Fujian Wuyi mountain, an original strain is obtained by tissue separation and purification of a sporocarp, the new strain is identified as a new strain of cicada fungus Isaria cicada fungus by morphology and molecular biology, is named as cicada fungus Isaria cicada fungus HMGIM-N140534, is preserved in 7 and 8 days in 2020 to Guangdong province microorganism strain preservation center (Guangzhou, China), and has the preservation number as follows: GDMCC No. 61083. The strain of the cordyceps sobolifera is a new strain which is collected from the field and has stronger activity, the new strain is collected and separated from the field and is preserved in a patent strain preservation center, the strain is confirmed to be the cordyceps sobolifera through the traditional identification and the molecular identification, the mass preparation can be realized through artificial fermentation, and the strain has obvious inhibiting effect on antitumor and candida albicans and has development prospect.

Description

New strain of cicada fungus and its use in anti-tumor and bacteriostasis

Technical Field

The invention relates to a new strain of rare medicinal bacteria and application thereof, in particular to a new strain of cordyceps sobolifera and application thereof in the aspects of tumor resistance and bacteriostasis.

Background

According to the statistics of the edible fungus association in China, the total yield of edible and medicinal fungi in 28 provinces, autonomous regions and direct jurisdictions in 2018 is continuously increased to 3789.03 ten thousand tons (fresh products) in the fifth major planting industry after the edible and medicinal fungi become grains, vegetables, fruits and oil in China, and the yield reaches 2938.38 million yuan. The edible and medicinal fungi have balanced nutritional ingredients and rich secondary metabolites, contain various natural active ingredients such as polysaccharides, flavonoids, terpenoids, alkaloids and the like, and have remarkable effects on invigorating stomach, promoting digestion, reducing blood sugar, reducing blood fat, resisting bacteria, resisting virus, resisting tumor, enhancing immunity and the like. Some edible and medicinal fungi resources are developed into products such as cosmetics, health-care food, medicines and the like. The domestic fungus industry accounts for more than 75% of the world in China, and the number of practitioners exceeds 2000 thousands, so that the domestic fungus industry is an industry with great development potential.

At present, the edible and medicinal fungi industry is vigorously developed, more and more rare edible and medicinal fungi varieties gradually enter the visual field of people, and a plurality of original rare varieties are gradually domesticated, such as dictyophora indusiata, agrocybe chaxingu huang, Lyophyllum japonicum, morel and the like. However, there are also a large number of wild edible and medicinal fungi which have not been studied because they have not been recognized by human beings. According to research, about more than 300 ten thousand fungus species are existed in the world at present, only 1% of the species are known, wherein about 14000 large fungi are known, 1789 edible fungi and 798 medicinal fungi are recognized in China, and only less than 100 wild edible and medicinal fungi are domesticated by human beings, and the variety of large-scale cultivation is more than 30. There is a considerable road for the study and utilization of human beings from large fungi. With the gradual rise of the living standard of people and higher requirements on the living quality, the macrofungi have very good effect on the health of human bodies and are increasingly paid more attention by people.

Cordyceps cicadae is also called golden cicada fungus, belongs to the fungus of Isaria cicadae of Cordyceps sinensis, and is a dry complex formed by nymphs of cicada fungus Isaria cicadae Miquel (old called Paecilomyces cicadae). Cicada fungus is a traditional famous and precious traditional Chinese medicine, and is sweet, cold and nontoxic according to records of compendium of materia medica. It can be used for treating infantile convulsion mud eel, night cry and palpitation. Modern researches show that the cordyceps sobolifera has multiple effects of regulating immunity, relieving fever and pain, tranquilizing and hypnotizing, improving renal function and the like, wherein more research reports are provided for improving the renal function by the cordyceps sobolifera. Cordyceps sobolifera as a precious cordyceps, wild resources of the cordyceps sobolifera are increasingly rare, and the cordyceps sobolifera is listed in protection directory of agricultural plant varieties in the people's republic of China (the eleventh batch) in 2019. At present, the research and the demand for artificial culture of cordyceps sobolifera are increasing.

Disclosure of Invention

In view of the above disadvantages, the present invention provides a new wild rare medicinal strain of Isaria cicadae, having in vitro anti-tumor activity and bacteriostatic action, and the anti-tumor use of its fermented extract and the use of its fermented liquid for inhibiting Candida albicans.

The invention achieves the above purpose through the following scheme:

the invention provides a new strain of cordyceps sobolifera, which is separated from Fujian Wuyi mountain, obtains an original strain by carrying out tissue separation and purification on sporocarp, is identified as a new strain of cordyceps sobolifera Isaria cicadae through morphology and molecular biology, is named as cordyceps sobadaae HMGIM-N140534, is preserved in 7 and 8 days of 2020 to Guangdong province microorganism strain preservation center, and has the address as follows: building 5 of the Jieli Zhonglu No. 100 yard 59 in Guangzhou city, China, the preservation number is: GDMCC NO. 61083.

The inventor separates the obtained strain, completes the sequencing of the strain, carries out sequence Blast on the sequencing result in GenBank, finds that the similarity with the Isaria cicadae is up to 100 percent, combines with morphological identification, the macroscopic characteristics and the microscopic characteristics of the fungus specimen are consistent with the description of the Isaria cicadae, and the identification result is P Isaria cicadae Miq.

On the basis, the inventor also realizes artificial culture of the novel cordyceps sobolifera strain, and extracts a solid fermentation product and a liquid fermentation broth of the novel cordyceps sobolifera HMGIM-N140534 strain, so that the novel cordyceps sobolifera strain has a remarkable effect on in-vitro and in-vivo anti-tumor, and the fermentation broth of the novel cordyceps sobolifera strain also has a remarkable effect on inhibiting candida albicans.

The cordyceps sobolifera strain is a new strain which is collected from the field and has stronger activity, is separated out through field collection and is stored in a patent strain preservation center, is confirmed to be cordyceps sobolifera through traditional identification and molecular identification, can realize mass preparation through artificial fermentation, has obvious inhibiting effect on antitumor and candida albicans, and has development prospect.

Drawings

FIG. 1 is a diagram of a wild fruiting body of Isaria cicadae.

FIG. 2 shows ITS sequencing results.

FIG. 3 is a technical scheme of test example 2.

FIG. 4 shows a route of the extraction process of crude polysaccharide extract of test example 2.

FIG. 5 shows the results of comparing the tumor mass of mice in the animal experiments of Experimental example 2.

FIG. 6 is a comparison of tumor volumes of mice in the animal experiments of Experimental example 2.

Detailed Description

The present invention is further illustrated by the following examples.

In a first aspect, the invention provides a new strain of cordyceps sobolifera, which is isolated from fujian wuyishan, an original strain is obtained by performing tissue isolation and purification on sporophores, the strain is identified as a new strain of cordyceps sobolifera Isaria cicadae through morphology and molecular biology, the strain is named as cordyceps sobolifera HMGIM-N140534, and the strain is preserved in 7-8 th month 2020 to Guangdong province microbial strain preservation center, and the addresses are as follows: china Guangzhou, the preservation number is: GDMCC No. 61083.

The inventor completes sequencing on the strain, carries out sequence Blast on the sequencing result in GenBank, finds that the similarity with Isaria cicadae of cicada is up to 100 percent, combines with morphological identification, the macroscopic characteristics and the microscopic characteristics of the fungus specimen are consistent with the description of Isaria cicadae, and the identification result is P Isaria cicadae Miq.

The conidiophores of Isaria cicadae of the present invention consist of the bundles of the coremium growing from the heads of the pupae of cicada. The surface of the worm is brownish yellow and is coated by gray or white hypha. The bundle of the sporophores is 1.6-6cm long and branched or not. The upper fertile part is 5-8mm long, 2-3mm in diameter, and has an overall oblong shape, an oval shape, a spindle shape or a spike shape, and a large number of white powdery conidia are grown. Sterile stipe is 1-5cm long, 1-2mm in diameter, and yellow to yellow brown. Conidiophores of 5-8X 2-3 μm, bottle-shaped, expanded in the middle, tapered or suddenly narrowed at the end, and often clustered on fasciculus. Conidium 5-14 × 1.8-3.5 μm, oblong, spindle or nearly semicircular, and has 1-3 oil drops. Scattered on cicada pupa in loose soil. Is used for medicine. Domestic records are distributed in the central China, and the strain is collected from the Fujian region in the southeast.

In a second aspect, the present invention provides an artificial culture method of the novel strain of cordyceps sobolifera, comprising: strain separation, strain purification and solid fermentation, wherein the solid fermentation comprises the steps of filling a solid fermentation culture medium into a polypropylene strain bag, sterilizing, cooling, inoculating the purified strain in an aseptic operation, carrying out dark culture at a constant temperature of 25 ℃ for 44-46 days with humidity of 50% -60% and keeping carbon dioxide concentration below 4000ppm to obtain a solid fermentation culture, wherein the solid fermentation culture medium comprises 1:1(g/ml) of rice and water.

Wherein the culture is carried out in dark at a constant temperature of 25 ℃ for 45 days.

Wherein, the strain separation comprises the following steps: wiping the surface of the collected wild cordyceps sobolifera with 75% alcohol under aseptic condition, tearing, inoculating 0.2-0.5mm × 0.2-0.5mm internal mushroom flesh tissue into the isolated culture medium in an aseptic operation mode, culturing at constant temperature and in dark at 25 ℃, and transferring after the hyphae grow over the inclined plane.

Preferably, the hyphae are overgrown for a period of 10 to 15 days.

Wherein the strain isolation culture medium is a comprehensive PDA culture medium and 0.5 weight percent of silkworm chrysalis powder.

The method specifically comprises the following steps: the strain isolation culture medium comprises, by weight, 20% of potatoes, 2% of glucose, 2% of agar, 0.3% of monopotassium phosphate, 0.15% of magnesium sulfate, trace vitamin B1 and 0.5% of silkworm chrysalis powder.

Wherein the purification comprises: inoculating the separated strain infected with bacteria, culturing at 25 deg.C in dark at constant temperature, and picking and inoculating tip mycelium when mycelium grows and bacteria do not grow.

Wherein, the purification culture medium is a Bengal red culture medium.

The method specifically comprises the following steps: every 1000ml of the purified culture medium comprises the following components in percentage by weight: peptone 0.5%, glucose 1%, potassium dihydrogen phosphate 0.1%, magnesium sulfate (MgSO)₄·7H₂O) 0.05%, agar 2%, 1/3000 bengal solution 10%, chloramphenicol 0.01%, and water as the rest.

Preferably, the water used in the above-mentioned culture method is distilled water.

In a third aspect, the present invention provides the use of an extract of a solid fermentation product of Isaria cicadae HMGIM-N140534 for anti-tumor purposes.

In a fourth aspect, the invention provides the use of an extract from a solid fermentation product of Isaria cicadae HMGIM-N140534 of Isaria cicadae for the preparation of an anti-tumor medicament.

Wherein the extract of the solid fermentation product of the Isaria cicadae Cicadae HMGIM-N140534 is an ethyl acetate extract of the solid fermentation product of the Isaria cicadae Cicadae HMGIM-N140534.

Wherein the tumor is breast cancer.

In a fifth aspect, the invention provides the use of an extract from a liquid fermentation broth of Isaria cicadae HMGIM-N140534 of Isaria cicadae for combating tumours.

In a sixth aspect, the invention provides the use of an extract from a liquid fermentation broth of Isaria cicadae HMGIM-N140534 of Isaria cicadae for the preparation of an anti-tumor medicament.

Wherein the extract of the liquid fermentation broth of the Isaria cicadae HMGIM-N140534 is a crude polysaccharide extract of the liquid fermentation broth of the Isaria cicadae HMGIM-N140534.

Wherein the crude polysaccharide extract is obtained by extracting with ethyl acetate.

Wherein the tumor is breast cancer.

In a seventh aspect, the present invention provides the use of a liquid fermentation broth of Isaria cicadae HMGIM-N140534 for inhibiting Candida albicans.

In an eighth aspect, the invention provides the use of a liquid fermentation broth of Isaria cicadae HMGIM-N140534 for the preparation of a medicament for inhibiting Candida albicans.

The invention proves that the ethyl acetate extract of the cordyceps cicadae HMGIM-N140534 solid fermentation product has obvious effect of inhibiting tumors in vitro, the crude polysaccharide extract of the cordyceps cicadae HMGIM-N140534 liquid fermentation product has obvious effect of inhibiting mouse breast cancer cells in vivo, and meanwhile, the liquid fermentation liquid can strongly inhibit candida albicans.

Researches prove that the artificially cultured cordyceps sobolifera also has the same or similar effect as the wild cordyceps sobolifera, and the cordyceps sobolifera cultured by solid fermentation is particularly advantageous.

Example 1

A new strain of cicada fungus is separated from Fujian Wuyi mountain, the original strain is obtained by tissue separation and purification of sporocarp, the strain is identified as the new strain of cicada fungus Isaria cicadae by morphology and molecular biology, the strain is named as cicada fungus Isaria cicadae HMGIM-N140534, and the strain is preserved in 7 and 8 days of 2020 to Guangdong province microorganism strain preservation center, and the address is as follows: china Guangzhou, the preservation number is: GDMCC NO. 61083.

The conidiophores of Isaria cicadae consist of the bundles of the coreopsis which grow from the heads of the cicada pupae. The surface of the worm is brownish yellow and is coated by gray or white hypha. The bundle of the sporophores is 1.6-6cm long and branched or not. The upper fertile part is 5-8mm long, 2-3mm in diameter, and has an overall oblong shape, an oval shape, a spindle shape or a spike shape, and a large number of white powdery conidia are grown. Sterile stipe is 1-5cm long, 1-2mm in diameter, and yellow to yellow brown. Conidiophores of 5-8X 2-3 μm, bottle-shaped, expanded in the middle, tapered or suddenly narrowed at the end, and often clustered on fasciculus. Conidium 5-14 × 1.8-3.5 μm, oblong, spindle or nearly semicircular, and has 1-3 oil drops. Scattered on cicada pupa in loose soil. Is used for medicine. Domestic records are distributed in the central China, and the strain is collected from the Fujian region in the southeast.

Example 2

Identification of Isaria cicadae Miq

A sample of cordyceps sobolifera (preliminary identification) is collected from Caochen Runzhong and Chensheng Zhen in Fujian Wuyi mountain in 2014 7 months. Obtaining a PDA pure culture by a tissue isolation method, collecting hyphae by liquid culture, drying at low temperature (40 ℃), grinding by using liquid nitrogen, extracting DNA genome by using an Ezup column type fungus genome DNA extraction kit, and refrigerating the obtained DNA solution at-20 ℃ for later use. An ITS-PCR experiment was performed using the fungal ribosomal intergenic region universal primer ITS1/ITS4(ITS1: TCCGTAGGTGAACCTGCGG, ITS4: TCCTCCGCTTATTGATATGC), amplification was performed on a Biometra PCR instrument, and the PCR reaction solution consisted of (50. mu.l total):

TaKaRaTaq(5units/μl)0.25μl

10×PCR Buffer 5μl

dNTP mix (2.5 mM each) 4. mu.l

DNA template 2. mu.l

Primer 1 (10. mu. mol. L)^-1)5μl

Primer 2 (10. mu. mol. L)^-1)5μl

Sterilized distilled water 28.75. mu.l

The reaction conditions are that the reaction is carried out for 5min at 94 ℃; reacting at 94 ℃ for 1min, at 55 ℃ for 1min, at 72 ℃ for 1min, and performing 30 cycles; the reaction was carried out at 72 ℃ for 10 min. The PCR product is directly checked for bidirectional sequencing. The ITS sequence is shown in FIG. 2.

Sequence Blast is carried out on sequencing results in GenBank, the similarity with Isaria cicadae is found to be up to 100 percent, and the macroscopic characteristics and the microscopic characteristics of the fungus specimen are consistent with those described by Isaria cicadae in combination with morphological identification, and the identification result is P Isaria cicadae Miq. The strain N140534 is preserved in Guangdong province microorganism culture collection center (China, Guangzhou) at 7-8.7.2020, and the preservation number is GCMCC NO: 61083.

Example 3

Artificial culture

Firstly, the method comprises the following steps: culture medium

1. Isolation medium (in weight percent)

Comprehensive PDA (potato 20% + glucose 2% + agar 2% + potassium dihydrogen phosphate 0.3% + magnesium sulfate 0.15% + vitamin B1 trace) + 0.5% silkworm chrysalis powder

2. Purification Medium (in weight percent)

The formula is as follows: bengal Red Medium (peptone 0.5% + glucose 1% + Potassium dihydrogen phosphate 0.1% + magnesium sulfate (MgSO)₄·7H₂O) 0.05% + agar 2% +1/3000 Bengal Red solution 10% + Chloramphenicol 0.01% + distilled water)

3. Solid fermentation medium

The formula is as follows: 50g of rice and 50ml of distilled water

Secondly, the method comprises the following steps:

1. strain isolation

Subpackaging the separated culture medium into test tubes, performing moist heat sterilization at 0.11MPa atmospheric pressure and 121 deg.C for 30min, taking out, cooling, and placing into inclined plane. The collected wild cordyceps sobolifera is wiped on the surface of the wild cordyceps sobolifera under the aseptic condition by using 75% alcohol, and then the wild cordyceps sobolifera is torn open, and the internal bacon tissue with the diameter of 0.2-0.5mm multiplied by 0.2-0.5mm is inoculated into the separation culture medium in an aseptic operation mode. Culturing in 25 deg.C incubator at constant temperature, transferring after mycelium grows over the inclined plane, and culturing for 10-15 days.

2. Strain purification

Preparing a purified culture medium according to the formula, subpackaging test tubes, carrying out moist heat sterilization for 30min at the atmospheric pressure of 0.11MPa and the high temperature of 121 ℃ under high pressure, carrying out transfer on the separated strain infected with the bacteria, placing the strain in an incubator at 25 ℃ for constant-temperature dark culture, and carrying out picking and transfer on tip hyphae when the hyphae grow but the bacteria do not grow.

3. Solid fermentation

Filling 5-silk-meter-thick polypropylene strain bags (15 x 30cm) into a solid fermentation culture medium according to a formula, carrying out moist heat sterilization at the atmospheric pressure of 0.11MPa and the high temperature of 121 ℃ for 30min, taking out, cooling and carrying out aseptic operation, and inoculating the strains which are successfully purified. Placing in an incubator at 25 ℃ for dark culture at constant temperature with humidity of 50-60%, and keeping carbon dioxide concentration below 4000ppm for about 45 days.

Test example 1

Tumor cell inhibiting function of solid fermentation product extract

The method comprises the following steps:

1. preparation of ethyl acetate extract

The method of example 3 is adopted to carry out solid fermentation of the cicada fungus strain, the culture medium is rice and water, after 45 days of culture, the rice culture medium full of mycelia is soaked in ethyl acetate, ultrasonic extraction is carried out after 10 hours, ultrasonic extraction is carried out for 100min, extraction is carried out twice, and organic phases at the two times are combined. And (3) after the collected organic phase is subjected to suction filtration, carrying out rotary evaporation on the liquid obtained by suction filtration by using a rotary evaporator until no liquid drops exist, and preserving at a low temperature (4 ℃) for later use.

Meanwhile, other wild strains are fermented in the same operation and are used as a control in advance. Paclitaxel was used as a positive control at a concentration of 0.5 mg/ml.

2. Tumor cell culture

Breast cancer cells MCF-7 were cultured in DMEM medium containing penicillin, streptomycin and 10% Fetal Bovine Serum (FBS). DMEM cell suspension containing 10% FBS was seeded at a cell concentration of 2X 10 onto 96 well tissue culture plates⁴cells/ml. The culture was incubated at 37 ℃ with 5% CO₂Cultured in a tissue culture box for 4 hours for later use.

3. Tumor inhibition assay

The ethyl acetate extract was dissolved in DMSO to prepare a mother liquor having a concentration of 20mg/ml, and the mother liquor was diluted to a sample solution of 100. mu.g/ml with a DMEM culture solution containing 10% Fetal Bovine Serum (FBS). The cell culture medium in the 96-well plate was carefully aspirated off and the sample solutions at final concentrations of 100. mu.g/ml and 200. mu.g/ml were added. Triplicate wells per sample. At the same time, a zero setting well (culture medium) and a control well (cells, culture solution) are arranged. Placing at 37 ℃ and 5% CO₂The culture was carried out in a tissue culture incubator for 48 hours. After the culture was completed, the cells were collected and mixed with dolichol blue 1:1 mixing and dyeing by a dye-repelling method. According to the fact that dead cells were stained blue and living cells were not stained due to intact cell membranes, the number of living cells was measured by a cell counter, and the sample was repeated three times.

4. Data analysis

Statistics were performed using spss.21 proprietary statistical software, with P <0.05 significantly different using paired t-test.

Second, result in

The results of comparison of the inhibition of MCF-7 cells by ethyl acetate extracts of edible and medicinal fungi in vitro at concentrations of 100. mu.g/ml and 200. mu.g/ml are shown in Table 1, using SPSS.21 special statistical software for statistics.

TABLE 1

As can be seen from Table 1, the inhibition rates of cordyceps sobolifera HMGIM-N140534 on breast cancer cells MCF-7 are 92.13% and 99.84% respectively at the concentrations of 100 mug/ml and 200 mug/ml, which shows that the cordyceps sobolifera HMGIM-N140534 has strong in-vitro tumor cell inhibition effect. Meanwhile, the contrast experiment of the ethyl acetate extracts of the 14 other edible and medicinal fungi for inhibiting the tumor cells in vitro exceeds the other edible and medicinal fungi tested at the same time. The inonotus obliquus is a famous medicinal fungus, and experiments under the same conditions show that the effect of inhibiting breast cancer cells MCF-7 in vitro is far better than that of the new bacterial strain.

Test example 2

In vivo tumor cell inhibiting function of crude polysaccharide extract of liquid fermentation broth

Method and device

The overall method flow is shown in fig. 3, and specifically includes the following steps:

1. preparation of crude polysaccharide extract

The strain is fermented by liquid, and the culture medium is as follows: comprehensive PDA (calculated by weight percentage, 20% of potato, 2% of glucose, 0.3% of monopotassium phosphate, 0.15% of magnesium sulfate and trace vitamin B1) is cultured under the conditions of 25 ℃, shaking flask fermentation and 140rpm in dark place. Culturing for 7 days, vacuum filtering and collecting mycelia, lyophilizing, pulverizing, extracting with ethyl acetate, extracting the extractive solution with water, precipitating with ethanol, centrifuging, removing supernatant, dissolving the precipitate with pure water, and lyophilizing to obtain crude polysaccharide extract, wherein the specific extraction process is shown in FIG. 4.

2. Administration of drugs

The extracted polysaccharide extract is sterile filtered and administered by intraperitoneal injection, and administration is started from the next day after animal molding for 30 days continuously. According to the experimental design of table 2, experiments were performed with low and medium doses, and paclitaxel was selected as the positive control. Animal experimental dosing groups are shown in table 2.

TABLE 2 grouping of animal experiments for inhibiting breast cancer by cicada fungus

3. Tumor cell culture

(1) The tumor cells (the murine breast cancer cells 4T1) are revived one week in advance, and the cells need to be observed to meet the requirements of rapid growth, strong activity and the like.

(2) The mice are modeled after treating the cells, trypsinizing, counting with a counting plate, and injecting subcutaneously at 1.5X 105 cells/mouse, and the injection volume of each mouse is preferably 0.2ml, so the required concentration is 7.5X 105. Note the rapidity of action, preventing the cells from re-attaching to the wall.

(3) The tumor cells which are blown evenly are subpackaged into a small centrifuge tube of 1.5ml, and the centrifuge tube is placed by an ice box (to prevent the tumor cells from dying) and taken to an animal room.

(4) Before tumor cells are injected, the cells need to be mixed again, and the concrete operation is to slightly invert the centrifuge tube for a few times and lightly blow the centrifuge tube by using a pipette gun.

4. Animal experiments

Modeling with 18-22g active mouse, and 1.5 × 10 weight ratio of 4T1 cells⁵One/only was injected subcutaneously into the anterior dorsal cavity of the mice. From the day of molding, each group was intraperitoneally injected with 0.2ml of the corresponding liquid per day according to the previously prepared samples, wherein the positive control group was injected 2 times per week. 7 days and later tumor initiationMice were formed, observed and recorded. Sacrifice after 30 days, weigh for the first day, record, sacrifice next day with dislocation of the neck, measure tumor volume, weigh tumor mass, and evaluate drug action.

5. Statistics of

Tumor volume V ═ a × b2/2 (a-longest tumor diameter; b-shortest tumor diameter)

Tumor inhibition rate (1-Qtest/Qcontrol) 100% (Qtest-tumor mass of test sample; Qcontrol-tumor mass of control)

Second, experimental results

The results obtained by weighing the tumor weight, measuring the tumor volume and calculating the tumor inhibition rate are shown in table 3, fig. 5 and fig. 6.

TABLE 3 animal experiment of tumor mass, tumor volume and tumor inhibition rate

The capital letters in the values in the same column in the table indicate p <0.01, indicating that the difference is very significant. The lower case in the same column of values represents p <0.05, the difference is significant.

FIG. 5 comparison of tumor mass in mice in animal experiments

FIG. 6 comparison of tumor volumes in mice in animal experiments

The results of table 3, fig. 5 and fig. 6 show that the crude polysaccharide extract of fermentation mycelium of fermentation broth of cordyceps sobolifera HMGIM-N140534 shows very significant difference in the experiment of inhibiting the growth of tumor cells of mice, and is in dependence on dosage, compared with positive control taxol, the effect of inhibiting the growth of tumors is more prominent under medium dosage (100mg/kg), and the cancer inhibition rate reaches 84%.

Meanwhile, the inventor also observes and finds that the mice injected with the cordyceps sobolifera crude polysaccharide extract have certain nervous excitability, and particularly in the first week of injection, the injection of the polysaccharide with low and medium doses can ensure that the mice are very excitable and have dry stools, and the water drinking amount is greatly reduced. However, after one week, the symptom of nerve excitation gradually disappears, and finally, the animal experiment result shows a better effect on tumor inhibition, which may be related to the nerve excitation effect of cordyceps sobolifera, and is worthy of further intensive research.

Test example 3 test for inhibiting Candida albicans

1. Preparation of the culture Medium

SDB medium: 40g of glucose, 10g of peptone and 1000ml of water, and the pH value is 5.6 +/-0.2

SDA culture medium: 40g of glucose, 10g of peptone, 20g of agar and 1000ml of water, and the pH value is 5.6 +/-0.2

2. Preparation of samples

Preparation of positive control: weighing amphotericin, dissolving with 10% Tween aqueous solution, performing ultrasonic treatment, centrifuging, collecting supernatant, filtering, sterilizing, and making into 25 μ g/mL solution.

3. Preparation of the bacterial suspension

The test bacteria are taken out from a refrigerator at the temperature of-80 ℃ and inoculated on a fresh slant culture medium for activation. Inoculating the fungi into SDB culture medium with sterile inoculating loop, and culturing at 28 deg.C under shaking at 20r/min for 48 h. Uniformly spreading the fungus on SDA plate, culturing at 28 deg.C for 48 hr, and repeating each concentration for 3 times; the concentration of the bacterial suspension was determined by plate counting.

4. Determination of zone of inhibition

Diluting the counted bacterial solution by using a coating plate method to make the final concentration of the candida albicans be 10⁵cfu/mL, sucking 200 μ L of the prepared bacterial suspension on a flat plate by using a pipette, and uniformly coating by using a coater; punching holes on the plate containing bacteria with sterilized puncher, removing culture medium, sucking 200 μ L of reference/test sample under aseptic condition, punching into the holes, culturing fungus at 28 deg.C for 2 days, and observing the size of inhibition zone. The positive control was 25. mu.g/mL amphotericin.

Second, experimental results

The test result shows that the bacteriostasis zone of the strain fermentation liquor of the invention to the candida albicans is larger than that of the positive control, which shows that the strain fermentation liquor of the invention has obvious function of inhibiting the candida albicans.

The inventor further researches the fermentation liquor of the strain on staphylococcus aureus (ATCC 6538P) and finds that the inhibition zone of the fermentation liquor on the staphylococcus aureus is less than or equal to the positive control, which indicates that the fermentation liquor of the strain has no obvious effect of inhibiting the staphylococcus aureus.

The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art should be considered to be within the technical scope of the present invention, and the technical solutions and their concepts should be considered to be equivalent or modified within the technical scope of the present invention.

Claims

1. A Cordyceps sobolifera (Isaria cicadae) HMGIM-N140534 strain characterized by the accession number: GDMCC NO. 61083.

2. The use of the liquid fermentation broth of cordyceps sobolifera HMGIM-N140534 strain of claim 1 in the preparation of a medicament for inhibiting candida albicans.