CN111979326A - Molecular marker combination for representing lung adenocarcinoma qi deficiency phlegm dampness syndrome and screening and model building method - Google Patents
Molecular marker combination for representing lung adenocarcinoma qi deficiency phlegm dampness syndrome and screening and model building method Download PDFInfo
- Publication number
- CN111979326A CN111979326A CN202010890482.8A CN202010890482A CN111979326A CN 111979326 A CN111979326 A CN 111979326A CN 202010890482 A CN202010890482 A CN 202010890482A CN 111979326 A CN111979326 A CN 111979326A
- Authority
- CN
- China
- Prior art keywords
- lung adenocarcinoma
- deficiency
- screening
- syndrome
- phlegm
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16H—HEALTHCARE INFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR THE HANDLING OR PROCESSING OF MEDICAL OR HEALTHCARE DATA
- G16H50/00—ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics
- G16H50/50—ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for simulation or modelling of medical disorders
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A90/00—Technologies having an indirect contribution to adaptation to climate change
- Y02A90/10—Information and communication technologies [ICT] supporting adaptation to climate change, e.g. for weather forecasting or climate simulation
Abstract
The invention discloses a molecular marker combination for representing lung adenocarcinoma qi-deficiency phlegm-dampness syndrome and a screening and model establishing method, wherein the molecular marker combination is B3GNT7, METTL7B, TMEM41A, MKRN3, ANK2, EIF5, DDR2, GPER1, PPARG and MRAS; comprises obtaining mononuclear leukocytes PBMCs of a sample: collecting 2-4ml of fasting venous blood in the morning, mixing PBS and human peripheral blood in equal volume, adding lymphocyte separation liquid in equal volume on the liquid surface, 400g, room temperature, centrifuging for 30min, taking a middle leucocyte layer, adding PBS in 10 times of volume to wash away the lymphocyte separation liquid, repeating the steps twice, counting, adding RPMI 1640, and suspending the complete culture medium for later use.
Description
Technical Field
The invention belongs to the fields of clinical medicine, molecular medicine, inspection medicine, traditional Chinese medicine or Chinese and Western medicine combined medicine, and particularly relates to a molecular marker combination for representing lung adenocarcinoma qi-deficiency phlegm-dampness syndrome and a screening and model building method.
Background
The pattern of qi-deficiency and phlegm-dampness is the typical syndrome of non-small cell lung cancer in traditional Chinese medicine, and is also a special academic concept in traditional Chinese medicine. The judgment mode is that the doctor of traditional Chinese medicine obtains subjective judgment conclusion after four diagnosis and combination, the mode continues to the present, the main content refers to relevant contents in the guidance principles of clinical research on new traditional Chinese medicines (2002) and the Chinese medical diagnosis and treatment guidelines of malignant tumors, but the objective and quantitative standards are lacked, the accuracy of the result shows obvious difference due to the clinical level of the doctor of traditional Chinese medicine, and the development of clinical research and popularization are limited. The objective quantification of the syndrome type of traditional Chinese medicine is a scientific problem restricting the further development of the traditional Chinese medicine at present and is also an important reason that the traditional Chinese medicine is difficult to be brought into a modern scientific evaluation system and directly communicate with other subjects. However, the clinical curative effect of the traditional Chinese medicine and the traditional Chinese medicine are definite for lung cancer, and for people with qi deficiency and phlegm dampness syndrome, a plurality of clinical researches show that the traditional Chinese medicine and the traditional Chinese medicine can be used as independent factors for judging prognosis and are also the dominant people who benefit from targeted therapy. Therefore, the biological connotation of studying the syndrome of qi deficiency, phlegm dampness of non-small cell lung cancer can provide a research basis for solving the above scientific problems. Scientific research aiming at non-small cell lung cancer shows that molecular markers capable of reflecting the biological characteristics of malignant tumors, such as the driver genes EGFR, ALK and the like and related proteins and miRNA and the like, can be found at each molecular level of protein, gene and the like. Basic research shows that the biological connotation of qi deficiency, phlegm dampness syndrome is complex and may involve inflammation, immunity, apoptosis and other contents. Therefore, the combination of the two and the application of a scientific method to screen out the molecular marker with the function of objectively representing the traditional Chinese medicine syndrome is scientifically feasible. At present, the research of traditional Chinese medicine syndrome type biological connotation by applying multigroup technology and a plurality of molecular markers are found, but the research of the molecular markers capable of representing the qi-deficiency phlegm-dampness syndrome of the non-small cell lung cancer is not reported; the human metabolic products, protein expression and the like are easily influenced by a plurality of factors such as disease stages, living environments and the like, and the specificity and the accuracy of the human metabolic products, the protein expression and the like on the representation of the traditional Chinese medicine symptoms are not sufficient; the upstream gene has better stability in functional structure and expression, can be detected by a transcriptome second generation sequencing technology (RNA-sequence, RNA-Seq), is helpful for revealing the internal molecular mechanism and the occurrence and development process of a specific disease stage after the biogenic analysis, and is also an important technical means for exploring the biological basis of the traditional Chinese medicine syndrome at present. On the basis, the molecular marker obtained by screening is favorably converted into the core parameter for objectively quantifying the qi-deficiency phlegm-damp syndrome of the non-small cell lung cancer by using a statistical method, a mathematical modeling mode and the like, and the development of clinical research and popularization are favorably realized.
Disclosure of Invention
The invention provides an improvement aiming at the current situation that the lung adenocarcinoma qi-deficiency phlegm-dampness syndrome lacks objective molecular markers, provides an application of a gene combination for representing the lung adenocarcinoma qi-deficiency phlegm-dampness syndrome and a screening and model establishing method, and has been proved by earlier researches that the lung adenocarcinoma qi-deficiency phlegm-dampness syndrome is an advantageous population of EGFR-TKIs and the OS of the lung adenocarcinoma qi-deficiency phlegm-dampness syndrome reaches 26.5 months. Further, RNA-Seq technology is used for representing transcriptome of mononuclear leukocytes of lung adenocarcinoma patients with qi deficiency phlegm dampness syndrome, patients with non-qi deficiency phlegm dampness syndrome and healthy people, 10 differentially expressed genes such as B3GNT7, METTL7B, TMEM41A, MKRN3, ANK2, EIF5, DDR2, GPER1, PPARG, MRAS and the like are obtained by screening with an ROC curve judgment method, five particularly significant genes such as TMEM41A, EIF5, DDR2, PPARG and MRAS are obtained after PCR (polymerase chain reaction) group external verification and analysis, a logistic regression model is established by taking a logarithmic value of DDR2/PPARG as an independent variable, the goal of objective quantification of non-small cell lung cancer qi deficiency phlegm dampness syndrome is achieved, a method and inspection core parameters are provided for clinical popularization, and a base sequence of a molecular marker combination and reasonable deformation in the field belong to the protection content of the technical scheme of the invention.
The specific base sequences of these 10 genes are:
GTTGCCAGAGATTTCTGAAGACACA TCCACCAGGGCACAGTCAA
ATGGCTCCATGGATGTGGTG GGCCCAGCTTCCATATGGTTC
TCTACAAACAGGGCTTTGCCATC GCAGCAGGGCCACTTTATCAG
GGGTAACTGCCCATTTGGAGAC GCTGAATGACCCACCACCTG
GCTGGCAGCTACATTGTGTGG CCACTGTAAGACAGCGTGGTTTG
AACCAGCAAATGCAAAGTTGACC GTCACACAGCACATGCAACGA
GCCTCATACCCAGCCTATTTGAAAC TCCTGCAAGGCACCTGACAC
GGGTGCCAGGACAATGAAATACTC ATCCGCACATGACAGGTTTATTGA
CACATTACGAAGACATTCCATTCAC GGAGATGCAGGCTCCACTTTG
GGACCGCTTCCACCAGCTTA CTTGTTGGCCACGAGGATCA
the invention is realized by the following technical scheme:
the invention discloses a molecular marker combination for representing lung adenocarcinoma qi-deficiency phlegm-dampness syndrome, which is B3GNT7, METTL7B, TMEM41A, MKRN3, ANK2, EIF5, DDR2, GPER1, PPARG and MRAS.
As a further improvement, in the molecular marker combination, five particularly significant genes are TMEM41A, EIF5, DDR2, PPARG and MRAS.
The invention also discloses a screening method of the molecular marker combination for representing the lung adenocarcinoma qi-deficiency phlegm-dampness syndrome, which comprises the following steps:
1) and mononuclear leukocytes PBMCs for obtaining the sample: collecting 2-4ml of fasting venous blood in the morning, mixing PBS and human peripheral blood in equal volume, adding lymphocyte separation liquid in equal volume on the liquid surface, 400g, centrifuging at room temperature for 30min, taking the middle leucocyte layer, adding PBS in 10 times of volume to wash off lymphocyte separation liquid, repeating twice, counting, adding RPMI 1640, and suspending in full culture medium for standby; 2) extracting total RNA of the PBMCs by a Trizol method, detecting the purity and the integrity of the total RNA, and finishing quality control;
3) purifying the extracted total RNA, crushing, and performing reverse transcription to obtain a cDNA sample;
4) transferring into a PCR instrument, purifying, establishing a high-throughput sequencing mRNA library, and using the Qubit 2.0 and
the dsDNAHS Assay kit (Life Technologies, USA) quantitates the library; quality testing of the library was performed using an Agilent 2100-DNA 1000 chip (Agilent, Germany);
5) carrying out terminal sequencing of 2 × 150bp on a denatured library obtained by processing an mRNA library on Illumina Hiseq x-10, and controlling by using Hiseq Control software;
6) screening the molecular markers to obtain the molecular markers of B3GNT7, METTL7B, TMEM41A, MKRN3, ANK2, EIF5, DDR2, GPER1, PPARG and MRAS;
7) and five particularly significant genes TMEM41A, EIF5, DDR2, PPARG and MRAS are obtained through PCR verification.
As a further improvement, in the step 6) of the invention, the molecular markers are screened according to the three characteristics of the maximum sample distinguishing capability, the maximum significance of the difference between the groups of expression differences and the minimum Pearson coefficient of correlation of the expression quantity.
As a further improvement, the maximum sample discrimination ability according to the present invention refers to the selection of the gene having the largest area under the ROC curve from the test data.
As a further improvement, the maximum significance of the expression difference between groups in the invention refers to that when two genes have the same area under the ROC curve, the gene with smaller difference p value between groups is preferentially selected to ensure the capability of resisting detection errors of the candidate marker.
As a further improvement, the minimum Pearson coefficient related to the expression amount in the invention refers to selecting the gene with the Pearson coefficient related to the expression amount of the selected marker in all samples lower than 0.50, and ensuring that the selected candidate markers can provide information which is as complementary as possible.
As a further improvement, in step 7), after PCR verification, five significantly different genes are screened according to the criterion that the maximum ct difference between repeated samples is > 1.
The invention also discloses a model establishing method for representing lung adenocarcinoma qi-deficiency phlegm-dampness syndrome, which is characterized in that a logistic regression model is established by using the logarithmic value of DDR2/PPARG as an independent variable;
wherein Y is the operation value of the logistic and e is the natural logarithm.
The invention has the following beneficial effects:
the invention tests the transcriptome on mononuclear leucocyte in blood of lung adenocarcinoma patients with qi-deficiency phlegm-dampness syndrome, patients with non-qi-deficiency phlegm-dampness syndrome and healthy people by an RNA-Seq method, wherein the median of the sequencing depth of a sample is 79.09million reads, and the lowest is 41.61million reads; after cleaning and redundancy removal, the median alignment rate with the reference genome was 89.94%, with a minimum of 82.00%. The median of the gene covered by the sequencing data in each sample is 12149, and the lowest median is 10671, so that the transcriptome characteristics of the samples can be well characterized, and the scientificity and feasibility of the method are demonstrated. Selecting a gene with the largest area under the ROC curve from the test data to ensure that the candidate marker has the largest sample distinguishing capacity; if the two genes have the same area under the ROC curve, preferentially selecting the gene with smaller difference p value among the groups, and ensuring the detection error resistance of the candidate marker; selecting genes whose Pearson coefficient is less than 0.50 relative to the amount of expression of the selected marker in all samples ensures that the selected candidate markers provide information that is as complementary as possible. Therefore, a characterization method and a detection technology which are combined by 10 differential expression genes such as B3GNT7, METTL7B, TMEM41A, MKRN3, ANK2, EIF5, DDR2, GPER1, PPARG, MRAS and the like and have the effect of objectively quantifying lung adenocarcinoma qi-deficiency phlegm-dampness syndrome are selected and disclosed, and the method can be realized by detecting through a fluorescence quantitative PCR method in clinical popularization, is simple and rapid to operate, and provides richer and objective research basis for treating lung adenocarcinoma by combining Chinese medicine with western medicine in clinical practice.
The invention carries out PCR verification on the screened molecular marker in the group, further discovers five particularly significant genes TMEM41A, EIF5, DDR2, PPARG and MRAS (p <0.0005), establishes a logistic regression model for objectively quantifying the qi-deficiency phlegm dampness syndrome of the non-small cell lung cancer by using the PCR relative expression quantity of the genes and taking the logarithm value of the DDR2/PPARG as an independent variable, and proves that the model is used for representing the stable and reliable conclusion of the qi-deficiency phlegm dampness syndrome, is obviously superior to the representation forms of a plurality of gene expressions in simple Roots, obtains core parameters of the Chinese medicine syndrome type of in-depth research and clinical popularization, has universality and scientificity, and can be used for clinical examination, experimental research, popularization and application and the like based on the design and construction of a test kit.
Compared with the conventional clinical routine examination level, the invention has one level deeper, the clinical examination is the level of leucocytes, the invention adopts mononuclear leucocytes, has better accuracy, can reflect the immune condition of organisms, and has no relevant clinical report at present.
The invention obtains objective molecular markers by screening, and proves that the traditional Chinese medicine syndrome has objective biological basis.
The invention establishes a set of standardized lung adenocarcinoma qi-deficiency phlegm-dampness syndrome tools with high accuracy and high consistency for assisting in improving the accuracy of subjective judgment of doctors, provides research basis and core operation parameters for subsequent development and examination kit conversion and the like, and simultaneously provides a clinical auxiliary tool for diagnosis and treatment of lung adenocarcinoma qi-deficiency phlegm-dampness syndrome, improves the scientific connotation of traditional Chinese medicine treatment, and promotes the improvement of the lung cancer prevention and treatment level by combining traditional Chinese medicine and traditional Chinese medicine.
Drawings
FIG. 1 shows 10 differential expression genes and their corresponding gene expression levels obtained by screening the transcriptome of PBMC of lung adenocarcinoma with qi deficiency phlegm-dampness syndrome and lung adenocarcinoma with non-qi deficiency phlegm-dampness syndrome discovered by RNA-Seq characterization;
FIG. 2 is a ROC curve and corresponding AUC values of 10 differentially expressed genes in the lung adenocarcinoma qi-deficiency phlegm-dampness syndrome;
FIG. 3 shows 10 molecular markers of lung adenocarcinoma qi-deficiency phlegm-dampness syndrome obtained after PCR group external verification and their corresponding gene expression levels in the discovery group and the verification group;
FIG. 4 is ROC curves and corresponding AUC values of 10 molecular markers for lung adenocarcinoma qi-deficiency phlegm-dampness syndrome verified in vitro by PCR;
FIG. 5 is the AUC values of the logistic regression model found in the group lung adenocarcinoma qi-deficiency phlegm-dampness in the examples;
FIG. 6 is AUC values of the logistic regression model for verifying qi-deficiency phlegm-damp syndrome of lung adenocarcinoma in the examples in vitro.
The specific implementation method comprises the following steps:
the technical scheme of the invention is further explained by the following specific embodiments and the accompanying drawings of the specification:
the invention discloses application of a gene combination for representing lung adenocarcinoma qi-deficiency phlegm-dampness syndrome, wherein the gene combination comprises B3GNT7, METTL7B, TMEM41A, MKRN3, ANK2, EIF5, DDR2, GPER1, PPARG and MRAS, and five particularly significant genes are TMEM41A, EIF5, DDR2, PPARG and MRAS.
The invention also discloses a method for screening and establishing a model of the gene combination for representing the lung adenocarcinoma qi-deficiency phlegm-dampness syndrome, which specifically comprises the following steps:
1) collection of mononuclear leukocytes PBMCs:
2ml of early morning fasting venous blood of a patient with lung adenocarcinoma qi-deficiency phlegm-dampness syndrome is extracted by using an anticoagulant blood collection tube;
diluting an anticoagulated blood sample and a PBS solution in equal volume, and uniformly mixing;
slowly adding the diluted blood into a centrifuge tube filled with lymphocyte separation liquid (Ficoll) according to the proportion of 1:0.5-1 (diluted blood: lymphocyte separation liquid);
regulating the acceleration and deceleration of the centrifuge to minimum, centrifuging at 20 deg.C and 400g/min for 30 min; after the centrifugation is finished, sucking the middle leucocyte layer into a new 50ml centrifuge tube by using a 1000ul gun head, adding sterile PBS solution with the volume of 3-4 times of that of the centrifuge tube, reversing and mixing uniformly, centrifuging for 10min at 300g/min, and discarding the supernatant. Adding 5-10 ml of sterile PBS solution into the cell sediment, mixing uniformly, counting 10ul of cell suspension, centrifuging for 10min at a speed of 300g/min, and removing supernatant;
adding a proper amount of serum-free frozen stock solution into a centrifuge tube to ensure that the cell concentration is about 1-5 multiplied by 106cells/ml, and slowly and uniformly mixing to prepare a cell mixed solution;
and (4) subpackaging the cell mixed solution in the centrifugal tube into a completely marked cryopreservation tube, and storing in a refrigerator at the temperature of-80 ℃.
2) And extracting RNA:
pouring a proper amount of cooling liquid into a precooled mortar in a centrifuge at 4 ℃, adding a sample for grinding, and temporarily storing the ground sample in the cooling liquid;
adding an extraction reagent, violently mixing uniformly, carrying out instantaneous centrifugation, incubating at room temperature, immediately adding the extraction reagent into a centrifugal tube, and carrying out vortex mixing uniformly;
centrifuging, taking the supernatant, transferring to a new tube, adding a compatible reagent, and reversing and uniformly mixing;
centrifuging after precipitation, discarding the supernatant, rinsing with a rinsing reagent once, drying at room temperature, and adding R-f-w for dissolution;
moving to an ice box, quantitatively detecting the purity of RNA by using Nanodrop, accurately quantifying the amount of the Qubit, and detecting the integrity of the RNA by gel electrophoresis. (quality control qualification standard: A.OD260/OD280 is between 1.8-2.2, B.OD260/OD230 is more than or equal to 2.0, C.RIN is more than or equal to 7, D.28S:18S is more than or equal to 1.0).
3) And purifying RNA:
extracting a Total RNA sample, and incubating;
taking out the reaction tube, adding Buffer R2, flicking, mixing, and centrifuging instantly;
adding 250ul ethanol (96-100%), and mixing;
transferring the sample to a centrifugal column, centrifuging for 15s, and discarding waste liquid;
adding 500ul Buffer R3, centrifuging for 15s, and discarding the waste liquid;
transferring the centrifugal column to a new collecting column, and centrifuging for 1 min;
transferring the centrifugal column to a new 1.5ml centrifuge tube, sucking with a 10ul pipette, and drying at room temperature for 3 min;
adding 30ul RNase-Free Water, standing at room temperature for 3min, centrifuging at 10000rpm for 1min, discarding RNeasy Mini spin column after centrifugation, reverse transcribing to obtain cDNA, and standing for use.
4) Establishing a mRNA library for high-throughput sequencing:
rinsing O-Beads with a reagent, then re-suspending, adding cDNA, and uniformly mixing;
transferring to a PCR instrument, and incubating at room temperature;
discarding the supernatant, washing for 2 times, adding T-Buffer, and mixing;
moving the mixture into a PCR instrument, adding B-Buffer after the operation is finished, and incubating at room temperature;
discarding the supernatant, washing magnetic Beads, adding B-Mix, transferring the supernatant to a new tube, adding F-Mix, mixing uniformly, running the program, performing instant centrifugation after the program is finished, adding MIX 1 and MIX 2 into a PCR tube containing the product, performing light-flick mixing uniformly, performing instant centrifugation, transferring the PCR tube into a PCR instrument, running the program, supplementing ddH2O after the program is finished, adding X-Beads, and purifying;
adding A-Mix into the purified product, and moving the product to a PCR instrument for purification;
adding the L-mix into the obtained product, uniformly mixing, transferring to a PCR instrument, and purifying and screening;
adding the P-mix into the product obtained in the previous step, uniformly mixing, transferring to a PCR instrument, and purifying;
using the qubits 2.0 and
the dsDNAHS Assay kit (Life Technologies, USA) quantitates the library;
the library was quality checked using an Agilent 2100-DNA 1000 chip (Agilent, Germany).
5) And high-throughput sequencing:
the library was standardized to the desired mixed library concentration using 10mm/LpH 8.5.5 Tris-HCl, an appropriate amount of each standardized library was loaded into a new microfuge tube, 1% unmodified PhiX was injected into the mixed standardized library, and the mixed library and the PhiX control were denatured with 0.2M/LNaOH solution. Loading the denatured library into library tubes and into cluster generation cassettes;
taking out a new flow groove package at the temperature of 2-6 ℃, and placing at room temperature for 10-15 minutes;
placing the prepared clamping box into a reagent cooler drawer and placing the reagent cooler drawer at a specified position;
the cluster generating cartridge containing the library tubes with the removed caps is placed in the designated location. The drawer is slid into the cooler and the reagent cooler door is then closed. Selecting a double flow groove to operate on a tester interface;
ligated to Illumina sequencing adapter, PCR amplified, and 2X 150bp paired end sequencing on Illumina Hiseq x-10, controlled with Hiseq Control Software (HCS).
6) And screening molecular markers:
the area under the ROC curve of each gene for distinguishing the syndrome of phlegm-dampness due to qi deficiency from the syndrome of phlegm-dampness due to non-qi deficiency is calculated. Among the genes whose expression differences were significant, the gene having the largest area under the ROC curve was selected first. To ensure that the selected candidate markers provide information as complementary as possible, only genes having a Pearson coefficient less than 0.50 correlated with the amount of expression of the selected markers in all samples were selected. The expression level of each gene relative to GAPDH is used as the basis for selecting molecular markers. FIG. 1 shows 10 differential expression genes and their corresponding gene expression levels obtained by screening the transcriptome of PBMC of lung adenocarcinoma with qi deficiency phlegm-dampness syndrome and lung adenocarcinoma with non-qi deficiency phlegm-dampness syndrome discovered by RNA-Seq characterization; FIG. 2 is a ROC curve and corresponding AUC values of 10 differentially expressed genes in the lung adenocarcinoma qi-deficiency phlegm-dampness syndrome; based on the steps, 10 molecular markers of qi-deficiency phlegm-dampness syndrome, namely B3GNT7, METTL7B, TMEM41A, MKRN3, ANK2, EIF5, DDR2, GPER1, PPARG and MRAS are screened out.
7) And PCR verification:
total RNA was extracted using TRIzol reagent (Invitrogen);
reverse transcription of RNA into cDNA using RT kit (TaKaRa, chinese large).
Polymerase Chain Reaction (PCR) was performed using SYBR Green master mix (TaKaRa);
we used glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and U6 as internal references;
mRNA level analysis comparison 2- Δ Δ Ct method.
FIG. 3 shows 10 molecular markers of lung adenocarcinoma qi-deficiency phlegm-dampness syndrome obtained after PCR group external verification and their corresponding gene expression levels in the discovery group and the verification group;
FIG. 4 is ROC curves and corresponding AUC values of 10 molecular markers for lung adenocarcinoma qi-deficiency phlegm-dampness syndrome verified in vitro by PCR;
after verification, five particularly significant genes TMEM41A, EIF5, DDR2, PPARG and MRAS are obtained from 10 molecular markers of qi deficiency and phlegm dampness according to the standard that the maximum ct difference value among repeated samples is greater than 1, (difference detection method: wilcoxon rank-sum test, and logarithm value of DDR2/PPARG is used as an independent variable to establish a logistic regression model.
Wherein Y is the operation value of the logistic and e is the natural logarithm.
FIG. 5 is the AUC value of the logistic regression model for the lung adenocarcinoma qi-deficiency phlegm-damp syndrome found in the examples, which is 0.891;
FIG. 6 is the AUC value of the logistic regression model for verifying qi-deficiency phlegm-dampness syndrome of lung adenocarcinoma in the examples, which is 0.777;
the AUC in the sample group was found to be 0.891, and the AUC in the sample group was confirmed to be 0.777. Abu represents abondance and refers to PCR relative expression of the sequenced gene, AUC value is an industry standard for evaluating the marker, and the closer the AUC value is to 1, the stronger the distinguishing force of the marker is; determining whether to select the molecular marker based on the value of AUC; the higher the AUC value of the logistic model is, the more accurate the operation result of the model is.
The above is a preferred embodiment of the present invention, the present invention is not limited to the above, and other modifications and variations directly derived or suggested to one skilled in the art without departing from the spirit and concept of the present invention should be considered to be included in the scope of the present invention.
Claims (9)
1. A molecular marker combination for characterizing the syndrome of qi deficiency and phlegm dampness of lung adenocarcinoma is B3GNT7, METTL7B, TMEM41A, MKRN3, ANK2, EIF5, DDR2, GPER1, PPARG and MRAS.
2. The molecular marker combination for characterizing lung adenocarcinoma qi-deficiency phlegm-dampness syndrome according to claim 1, wherein two particularly significant genes in the molecular marker combination are DDR2, PPARG.
3. A screening method of a molecular marker combination for characterizing lung adenocarcinoma qi deficiency phlegm dampness syndrome is characterized by comprising the following steps:
1) and mononuclear leukocytes PBMCs for obtaining the sample: collecting 2-4ml of fasting venous blood in the morning, mixing PBS and human peripheral blood in equal volume, adding lymphocyte separation liquid in equal volume on the liquid surface, centrifuging at room temperature, taking the middle leucocyte layer, adding PBS to wash away the lymphocyte separation liquid, repeating the steps twice, counting, adding RPMI 1640, and suspending in a complete culture medium for later use;
2) extracting total RNA of the PBMCs by a Trizol method, detecting the purity and the integrity of the total RNA, and finishing quality control;
3) purifying the extracted total RNA, crushing, and performing reverse transcription to obtain a cDNA sample;
4) after purification, a high-throughput sequencing mRNA library is established, and the Qubit 2.0 and the Qubit are used
The library was quantified using the dsDNA HS Assay kit (Life Technologies, USA); quality testing of the library was performed using an Agilent 2100-DNA 1000 chip (Agilent, Germany);
5) carrying out terminal sequencing of 2 × 150bp on a denatured library obtained by processing an mRNA library on Illumina Hiseq x-10, and controlling by using Hiseq Control software;
6) screening the molecular markers to obtain molecular markers of B3GNT7, METTL7B, TMEM41A, MKRN3, MKRN3, ANK2, EIF5, DDR2, GPER1, PPARG and MRAS;
7) and five particularly significant genes TMEM41A, EIF5, DDR2, PPARG and MRAS are obtained through PCR verification.
4. The method for screening combinations of molecular markers for the syndrome of lung adenocarcinoma with qi deficiency and phlegm dampness according to claim 3, wherein in step 6), the molecular markers are screened according to the three characteristics of the maximal sample discrimination ability, the maximal significance of the difference between the group expression and the minimal Pearson coefficient related to the expression level.
5. The method for screening a combination of molecular markers for the syndrome of qi deficiency and phlegm dampness of lung adenocarcinoma according to claim 3 or 4, wherein the maximum sample discrimination ability is to select the gene having the largest area under the ROC curve from the test data.
6. The method for screening molecular marker combinations for characterizing lung adenocarcinoma with syndrome of qi deficiency and phlegm dampness according to claim 5, wherein the maximum significance of differences in expression among groups means that when two genes have the same area under the ROC curve, a gene with a smaller p value of difference among groups is preferentially selected to ensure the capability of a candidate marker in resisting detection errors.
7. The method for screening a combination of molecular markers for characterizing lung adenocarcinoma with qi deficiency and phlegm dampness according to claim 4 or 6, wherein the minimum Pearson coefficient related to expression level is selected from genes with Pearson coefficient related to expression level of the selected markers in all samples below 0.50, so as to ensure that the selected candidate markers provide information as complementary as possible.
8. The method for screening a combination of molecular markers for the characterization of lung adenocarcinoma with qi deficiency and phlegm dampness according to claim 3, wherein in step 7), five differentially expressed genes are screened according to the criterion that the maximum ct difference between repeated samples is >1 after PCR verification.
9. A model building method for representing lung adenocarcinoma qi-deficiency phlegm-dampness syndrome is characterized in that a logistic regression model is built by using a DDR2/PPARG logarithm value as an independent variable;
wherein Y is the running value of logistic and e is the natural logarithm.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010890482.8A CN111979326B (en) | 2020-08-29 | 2020-08-29 | Molecular marker combination for representing lung adenocarcinoma qi deficiency and phlegm dampness syndrome, screening and model building method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010890482.8A CN111979326B (en) | 2020-08-29 | 2020-08-29 | Molecular marker combination for representing lung adenocarcinoma qi deficiency and phlegm dampness syndrome, screening and model building method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111979326A true CN111979326A (en) | 2020-11-24 |
| CN111979326B CN111979326B (en) | 2023-07-07 |
Family
ID=73441238
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010890482.8A Active CN111979326B (en) | 2020-08-29 | 2020-08-29 | Molecular marker combination for representing lung adenocarcinoma qi deficiency and phlegm dampness syndrome, screening and model building method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111979326B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107475363A (en) * | 2017-06-26 | 2017-12-15 | 深圳大学 | Biomarker combination, the screening and its application of biomarker combination of a kind of non-small cell lung cancer |
-
2020
- 2020-08-29 CN CN202010890482.8A patent/CN111979326B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107475363A (en) * | 2017-06-26 | 2017-12-15 | 深圳大学 | Biomarker combination, the screening and its application of biomarker combination of a kind of non-small cell lung cancer |
Non-Patent Citations (2)
| Title |
|---|
| 刘光明 等: "晚期非小细胞肺癌中医证型与血清OPN、MMP-9、VEGF的相关性研究", 辽宁中医药大学学报 * |
| 张曙红 等: "非小细胞肺癌中医证型与临床客观指标相关性研究概况", 中医学报 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111979326B (en) | 2023-07-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220205038A1 (en) | Single-molecule sequencing of plasma dna | |
| JP2009529878A (en) | Primary cell proliferation | |
| WO2018151601A1 (en) | Swarm intelligence-enhanced diagnosis and therapy selection for cancer using tumor- educated platelets | |
| Parsons et al. | Circulating plasma tumor DNA | |
| CN108588230B (en) | Marker for breast cancer diagnosis and screening method thereof | |
| CN107488726A (en) | A kind of kidney prognosis evaluation biomarker and its detection reagent and application | |
| CN114107509B (en) | Liver cancer prognosis marker and application thereof | |
| CN110564858A (en) | RT-PCR kit for predicting curative effect of immunodetection point regulation type medicines and prediction method thereof | |
| CN108866187B (en) | Long-chain non-coding RNA marker related to lung cancer auxiliary diagnosis and application thereof | |
| Li et al. | Discovering a qualitative transcriptional signature of homologous recombination defectiveness for prostate cancer | |
| AU2020364225B2 (en) | Fragment size characterization of cell-free DNA mutations from clonal hematopoiesis | |
| CN108148908A (en) | Atherosclerotic renal artery stenosis diagnoses the application of molecular marked compound | |
| CN107641650B (en) | Application of NR1H 3in accurate target detection and prognosis evaluation of acute myelogenous leukemia | |
| Wilmott et al. | Tumour procurement, DNA extraction, coverage analysis and optimisation of mutation-detection algorithms for human melanoma genomes | |
| CN111979326A (en) | Molecular marker combination for representing lung adenocarcinoma qi deficiency phlegm dampness syndrome and screening and model building method | |
| CN111979325B (en) | Application of molecular marker combination in characterization of lung adenocarcinoma qi-yin deficiency syndrome, screening and model building method | |
| CN110564851A (en) | Group of genes for molecular typing of non-hyper-mutant rectal cancer and application thereof | |
| CN115747217B (en) | Long-chain non-coding RNA PDXDC1-AS1 and application thereof | |
| CN117448319A (en) | PCR internal reference of serum small extracellular vesicle miRNA and preparation method thereof | |
| Krasnicanova et al. | Optimizing mixed sample analysis as a step to comprehensive desease screening: a pilot study | |
| Hu et al. | Circulating DNA Quantification | |
| Abdueva et al. | Extracting Regulatory Active Chromatin Footprint from Cell-Free DNA | |
| CN115896284A (en) | Marker, reagent, kit and detection system for lung disease diagnosis | |
| CN114921531A (en) | Application of exosome RNA in curative effect evaluation of RTK inhibitor for treating advanced non-small cell lung cancer | |
| CN114613423A (en) | Biomarker for predicting curative effect of diffuse large B cell lymphoma chemotherapy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |