CN111955486A

CN111955486A - Method for preventing and controlling plant pests, nucleic acid pesticide, and preparation method and application thereof

Info

Publication number: CN111955486A
Application number: CN202010880810.6A
Authority: CN
Inventors: 李凯龙; 傅强; 刘勇; 张德咏; 史晓斌; 陈昂; 陈武瑛
Original assignee: HUNAN PLANT PROTECTION INSTITUTE; China National Rice Research Institute
Current assignee: HUNAN PLANT PROTECTION INSTITUTE; China National Rice Research Institute
Priority date: 2020-08-27
Filing date: 2020-08-27
Publication date: 2020-11-20

Abstract

The invention discloses a method for preventing and controlling plant pests, a nucleic acid pesticide, a preparation method and application thereof, wherein the nucleic acid pesticide comprises NlUSP-dsRNA, a solvent, an emulsifier and aminoketone. The preparation method comprises the steps of synthesizing dsRNA; dissolving NlUSP-dsRNA in a solvent, and adding an emulsifier to form an oil phase solution; adding water into the oil phase solution dropwise, and stirring to form emulsion. Soaking the roots of the rice seedlings in the nucleic acid pesticide, and transporting the nucleic acid pesticide to the phloem of the rice through the transpiration of the plants; the insects eat the juice of the rice phloem, and the nucleic acid pesticide in the juice enters the bodies of the insects to kill the insects. The nucleic acid pesticide for preventing and treating the brown planthopper is prepared by taking the molting and metamorphosis gene NlUSP of the brown planthopper as a target, artificially synthesizing dsRNA of the target gene and adding a pesticide auxiliary agent, and the method for preventing and treating pests remarkably improves the death rate of the brown planthopper.

Description

Method for preventing and controlling plant pests, nucleic acid pesticide, and preparation method and application thereof

Technical Field

The invention relates to the technical field of genes, in particular to a method for preventing and controlling plant pests, a nucleic acid pesticide, a preparation method and application thereof.

Background

Chemical pesticides play an important role in agricultural production, but because the chemical pesticides are continuously and frequently used, the occurrence of drug resistance is increasingly serious, so that the serious problems of reduction of disease control effect, over-standard pesticide residue, hidden danger in food safety and the like are caused in production, and great challenges are brought to the high-quality yield increase of crops. At present, in order to cope with the above problems, in addition to the vigorous popularization of the relevant measures for integrated pest control (IPM), the development of safe and efficient green pesticides with novel action mechanisms is mainly relied on. RNA interference (RNAi) is a phenomenon widely used in animals and plants. In Drosophila, researchers have been hot in entomology to develop RNAi by expressing dsRNA in Drosophila using the Gal4-UAS system, which can efficiently induce sustainable RNAi production in multiple tissues of Drosophila and can observe efficient gene silencing in multiple generations. The nucleic acid pesticide realizes the interaction with a target by means of the complementary pairing principle of a base sequence, finally blocks the source of the generation of target protein from the mRNA level, further shows the similar regulation effect with a small molecule inhibitor, and becomes a novel post-transcriptional gene silencing regulation and control tool. Meanwhile, most pests and plants have a perfect RNAi system, and RNAi mediated gene silencing signals in the biological populations can be amplified in a cascade mode, so that the target gene is not expressed, and the growth and development of organisms are influenced. The nucleic acid pesticide takes a gene essential for the growth and development of insects as a target, realizes a lethal-level insecticidal effect by silencing a key gene, and has the characteristics of low dosage, high efficiency and sustainability. In recent years, nucleic acid pesticides taking RNAi as a main intervention form are widely applied to gene function research of insects of various orders, such as diptera, hemiptera, lepidoptera, hymenoptera, coleoptera, isoptera, orthoptera and the like, and the nucleic acid pesticides have been used in the pesticide field for some examples. Compared with the traditional micromolecule chemical pesticide, the nucleic acid pesticide has stronger target specificity, clearer action mechanism, environmental safety to non-target organisms and no residue problem, and meets the requirements of the current society on the quality safety and ecological safety of agricultural products, thereby being a potential novel green plant protection product.

The existing methods for preventing and controlling plant pests by dsRNA mainly comprise a feeding method, a transgenic plant mediated expression method, a direct dsRNA spraying method and the like, wherein the feeding method is that pests are passively fed with dsRNA, and the application in production is difficult; the transgenic plant mediated expression dsRNA uses a transgenic technology, and has larger application dispute in actual production, so the application and popularization are difficult; at present, the dsRNA is mainly applied to the prevention and the treatment of plant diseases and the prevention and the treatment of chewing pests eating plant leaves, but for pests with strong activity, particularly piercing-sucking pests eating plant juice, the dsRNA directly sprayed is difficult to be eaten by the pests so as to achieve the purpose of preventing and treating the pests.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a method for preventing and treating plant pests, a nucleic acid pesticide, a preparation method and application thereof. The invention provides a new strategy for establishing a nucleic acid pesticide technology based on a gene silencing technology to control pests.

In order to achieve the above object, the present invention provides a method for controlling plant pests, comprising the steps of:

s1, soaking the roots of the rice seedlings in the nucleic acid pesticide, and transporting the nucleic acid pesticide to the phloem of the rice through the transpiration of the plants;

s2, the insects eat the bast juice of rice, and the nucleic acid pesticide in the juice enters the insects to kill the insects.

The method for controlling plant pests further comprises the step of adding dsRNA with insect killing effect, a solvent, an emulsifier and aminoketone into the nucleic acid pesticide. The solvent is methyl oleate and/or fatty acid methyl ester; the emulsifier is one or more of sucrose ester, tween and monodecanoate.

Further, the rice seedling is a rice seedling in a 3-leaf stage.

Based on a general technical concept, the invention also provides a nucleic acid pesticide which comprises NlUSP-dsRNA, a solvent, an emulsifier and aminoketone.

The nucleic acid pesticide, further, the solvent is methyl oleate and/or fatty acid methyl ester.

The nucleic acid pesticide further comprises one or more of sucrose ester, tween and monodecanoate.

Further, the concentration of the NlUSP-dsRNA is 0.5-5 v/v%, the concentration of the solvent is 5-30 v/v%, the concentration of the emulsifier is 5-10 v/v%, and the concentration of the aminoketone is 1-5 v/v%.

Based on a general technical concept, the invention also provides a preparation method of the nucleic acid pesticide, which comprises the following steps:

s1, synthesizing dsRNA according to NlUSP gene;

s2, dissolving NlUSP-dsRNA in a solvent, and adding an emulsifier and aminoketone to form an oil phase solution;

and S3, dropwise adding water into the oil phase solution, and stirring to form emulsion to obtain the nucleic acid pesticide.

In the preparation method, the S1 specifically includes the following steps:

s1-1, carrying out PCR amplification by using the brown planthopper cDNA as a template and using NlUSP-F1339 and NlUSP-R1339 as primers to obtain a PCR product; the DNA sequence of the NlUSP-F1339 is shown in SEQ ID NO.3, and the DNA sequence of the NlUSP-R1339 is shown in SEQ ID NO. 4.

S1-2, transferring the PCR product into competent cells after being connected with a vector;

s1-3, extracting a plasmid pTOP-NlUSP containing NlUSP genes in positive clones;

s1-4, designing a primer pair according to the sequence of the NlUSP gene fragment; carrying out PCR amplification by taking the plasmid pTOP-NlUSP as a template to obtain a dsDNA fragment of the NlUSP containing the T7 promoter;

s1-5, and synthesizing NlUSP-dsRNA by in vitro transcription by using a dsDNA fragment of NlUSP containing a T7 promoter as a template.

In the preparation method, the primer pair further comprises dsNlUSP-F and dsNlUSP-R, the DNA sequence of the dsNlUSP-F is shown as SEQ ID NO.6, and the DNA sequence of the dsNlUSP-R is shown as SEQ ID NO. 7.

In the preparation method, the rotation speed of stirring in the step S2 is 200-400 r/min, and the stirring time is 15-30 min.

In the preparation method, the rotation speed of stirring in the step S3 is 500-1000 r/min, and the stirring time is 15-20 min.

Based on a general technical concept, the invention also provides an application of the nucleic acid pesticide in controlling brown planthopper, and the application method comprises the following steps: soaking the roots of the rice seedlings in a nucleic acid pesticide, wherein the nucleic acid pesticide is transported to the phloem of the rice through the transpiration of the plants; the brown planthopper takes the juice of rice phloem, and the nucleic acid pesticide in the juice enters the insect body to kill the insect.

Compared with the prior art, the invention has the advantages that:

(1) the invention provides a method for preventing and controlling plant pests, which comprises the steps of soaking the roots of rice plants with nucleic acid pesticides, transporting the nucleic acid pesticides from the roots to phloem of the rice through the transpiration of the plants, then feeding the nucleic acid pesticides by plant pests which feed rice phloem juice, and leading dsRNA to silence of target genes after entering the bodies of the plant pests, so that the functions of the plant pests are influenced, and the plant pests are finally killed, thereby achieving the purpose of preventing and controlling the plant pests. The method is a green and environment-friendly nucleic acid pesticide, is more environment-friendly and safe than chemical agents, and has stronger targeting property, and on the other hand, the method is more favorable for preventing and treating plant pests, especially sucking pests compared with spraying dsRNA.

(2) The invention provides a nucleic acid pesticide, wherein an molting related gene NlUSP which plays an important role in the molting process of brown planthopper has the function of inhibiting and can cause the molting of the brown planthopper to be blocked and die; the invention is to use dsRNA of the gene fragment to prepare NlUSP-dsRNA nucleic acid pesticide, and the mortality rate of brown planthopper can reach more than 95%.

(3) The invention provides a nucleic acid pesticide which comprises NlUSP-dsRNA, a solvent, an emulsifier and aminoketone. The solvent is used for preparing a water-in-oil emulsion to protect dsRNA; one end of the emulsifier molecule is hydrophilic, the other end is oleophilic, and is arranged in the interface of water and oil phases in an oriented way, the polar group points to water, and the nonpolar group points to oil, so that the interfacial tension is reduced, the stability of the emulsion is enhanced, the automatic aggregation of liquid drops is prevented, the emulsion tends to be stable, and the stability of the pesticide is increased; the effect of the aminoketones is to increase the permeability of nucleic acid pesticides.

(4) The invention provides a preparation method of a nucleic acid pesticide, which has simple and controllable preparation process and can be used for industrial production.

Drawings

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention.

FIG. 1 shows the dsRNA synthesis electrophoretogram of NlUSP gene, lane M is 2K Plus DNA Marker; lane 1 is dsRNA for the NlUSP gene.

Fig. 2 is a comparison of the mortality of rice seedlings after 3 instar brown planthopper feeding after drenching with dsRNA nucleic acid pesticide, and indicates that there is a very significant difference between the treatment and the control (p < 0.01).

FIG. 3 is the effect of dsRNA nucleic acid pesticides on molting of brown planthopper, A is the phenotype of control brown planthopper; and B is used for treating dead brown planthopper malformations.

Detailed Description

The invention is further described below with reference to specific preferred embodiments, without thereby limiting the scope of protection of the invention.

Examples

The materials and equipment used in the following examples are commercially available.

Example 1:

the nucleotide sequence of the brown planthopper excess air valve protein gene NlUSP is shown in SEQ ID NO.1, and specifically comprises the following steps:

GTGTCGGTGGTGCTCTTTTGGTGTTGTTATATTACATAAGAGGATCCCGCCATCATGCTAAAAAAAGAGAAACCGATGATGTCTGTGACAGCCATTATTCAGAGTGCTGCTGCTCATCACTCATGGGGACGAGGACTGAGCTTGGAGAACAATTTGTCGTTGAATTCGGTGGGACCGCAGTCGCCGCTAGAAATGAAGCCAGACACGGCCAGCCTCACGGTGGGCAACTTTAGTCCCGGCGGCGGACCAAATAGTCCTGGGTCGTACAGTATCGGCGGCCATAGCGGCGTGGGGGGGAAGATGCAGTCTGCCACGTCGCCCTACCCCCCCAACCACCCACTGTCCGGCTCCAAGCACCTCTGCGCCATCTGCGGCGACCGAGCCAGTGGCAAGCACTACGGAGTATACAGTTGTGAAGGATGTAAAGGATTTTTCAAGAGGACAGTGAGAAAAGACTTATCATACGCCTGTCGAGAAGAGAAAAGTTGCCTCATCGATAAAAGACAAAGGAATAGGTGTCAATATTGTAGATATCAGAAATGTTTGCAGATGGGCATGAAAAGAGAGGCAGTTCAGGAAGAAAGACAAAGGACAAAAGAAAGAGATCAGAATGAGGTGGAGTCAACCAGTAGTTTCCACACAGACATGCCAATCGAAAGGATTCTGGAAGCGGAGAAGCTGGTCGAGTGCAAAACCGAGAACCCAGTTACAGAGGACGATTTAACGAATATTTATGAAGCAGCTGACAAGCAATTATTCCAGTTGGTCGATTGGGCGAAACATATTCCACATTTCACTGCATTACCTCTAGAAGATCAAGTATTACTATTAAGAGCAGGGTGGAACGAGCTGCTGATAGCGGCGTTCTCGCACCGGTCGGTGGAGATCAAGGACGGCATCGTGCTGGCGACCGGACTGGTCATCCACCGCGGATCAGCCACAGCCGCCGGCGTCGCCACCATATTCGACAGAGTGCTCACCGAGATCGTCGCCAAAATGAGAGAAATGAAAATGGATAAGACTGAGCTGGGTTGTCTTAGATCTATCATACTATTCAATCCAGATGTGCGAGACCTGAAGTCGACGCAAGAGGTGGAGCTGCTGAGGGAGAAGGTGTACACAGCGCTGGAGGACTACACGCGCATCACCCACCCCGAGGAGTCGGGGCGCTTCGCCAAGCTGCTGTTGAGGCTCCCCTCCCTGCGCTCCATCGGCCTCAAGTGCTCCGAGCACCTCTTCTTCTACCGCCTCATCTCCGACCAAGCGCCCATCGACAACTTCCTCATGGACATGCTAGAAACGCCTACTGA CCAGTAGATCACCACACTTA CACGTACCT。

the amino acid sequence of the NlUSP coding protein is shown as SEQ ID NO.2, and specifically comprises the following steps:

MLKKEKPMMSVTAIIQSAAAHHSWGRGLSLENNLSLNSVGPQSPLEMKPDTASLTVGNFSPGGGPNSPGSYSIGGHSGVGGKMQSATSPYPPNHPLSGSKHLCAICGDRASGKHYGVYSCEGCKGFFKRTVRKDLSYACREEKSCLIDKRQRNRCQYCRYQKCLQMGMKREAVQEERQRTKERDQNEVESTSSFHTDMPIERILEAEKLVECKTENPVTEDDLTNIYEAADKQLFQLVDWAKHIPHFTALPLEDQVLLLRAGWNELLIAAFSHRSVEIKDGIVLATGLVIHRGSATAAGVATIFDRVLTEIVAKMREMKMDKTELGCLRSIILFNPDVRDLKSTQEVELLREKVYTALEDYTRITHPEESGRFAKLLLRLPSLRSIGLKCSEHLFFYRLISDQAPIDNFLMDMLETPTDQ。

the NlUSP gene fragment has a full length of 1339 bases and contains a development reading frame of 1263 bases. Encodes a protein sequence shown in SEQ ID NO.2 and contains 420 amino acids, and the molecular weight is about 47.10 kDa. The protein sequence of the gene is subjected to homology alignment with other insects, and the identity of the sequence and Italian bee (Apis mellifera) is up to 75%.

Example 2:

NlUSP-dsRNA is synthesized by adopting the following method:

(1) cloning of the NlUSP gene:

1.1, extraction of cDNA: RNA was extracted from 5 to 10 brown planthopper whole insects by the Trizol method of Invitrogen, and cDNA sequence was synthesized using ReverTra Aceq PCR RT Kit (10. mu.L synthesis system containing 1ng RNA, 2.0. mu.L 5XRT buffer, 0.5. mu.L primer mix, 0.5. mu.L RT enzyme mix) of Toyobo. Keeping the temperature at 37 ℃ for 45 minutes, inactivating reverse transcriptase at 98 ℃ for 5 minutes, and diluting cDNA by 10 times to be used as a template for target gene cDNA amplification.

1.2, designing a primer: obtaining USP protein sequences of Drosophila and other insects downloaded from NCBI the sequence fragment of the Nilaparvata nilotica NlUSP gene was obtained by matching sequences in the transcriptome database of the laboratory using the tBlastn program and assembling, and the upstream primer NlUSP-F1339 was designed according to NCBI primer blast: GTGTCGGTGGTGCTCTTTTG (SEQ ID NO.3), downstream primer NlUSP-R1339: AGGTACGTGTAAGTGTGGTGA (SEQ ID NO. 4).

1.3, PCR amplification:

PCR amplification system 25 μ L: contains 3.0. mu.L of diluted cDNA, 20pmol each of upstream and downstream primers, 0.2mM dNTP, 1 XPCR buffer, 2.5units of r-Taq DNA polymerase (Takara), for 2 replicates.

The PCR amplification procedure was: denaturation at 95 deg.C for 2 min; denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 90s, and 35 cycles; finally, extension is carried out for 10min at 72 ℃ to obtain an amplification product.

The amplified product was subjected to 2.0% agarose electrophoresis, and the PCR product was recovered using DNA purification recovery kit (DP214-02) from Tiangen corporation, specifically:

50 mu L of PC solution is added into 50 mu L of PCR product and mixed evenly to obtain mixed solution. Transferring the mixed solution into a filter column treated with the balance solution, and standing at room temperature for 1 min; centrifuge at 12000rpm for 1 min. The collection tube was discarded, 700. mu.L wash buffer (with absolute ethanol added) was added, and the tube was centrifuged at 12000rpm for 1min, and the collection tube was discarded. 500 μ L wash buffer (with absolute ethanol added) was added, centrifuged at 12000rpm for 1min, and the filtrate in the collection tube was discarded. After centrifugation at 12000rpm for 2min without adding liquid, the filtration column was transferred to a 1.5mL centrifuge tube, 40. mu.L of nucleic-free water was added, and the mixture was left at room temperature for 2min, centrifuged at 12000rpm for 2min, and then the PCR product was collected.

1.4, connection carrier:

the PCR product was ligated to 4.0. mu.L of the PCR product using a vector ligation kit (Invitrogen)

TOPO2.1 vector (available from Invitrogen).

Ligation system 10 μ L: containing 1.0. mu.L of 10 × Ligation Buffer, 2.0. mu.L

2.1vector (25 ng/. mu.L), 2.0. mu.L water and 1.0. mu. L T4 DNA Ligase.

Ligation of the linker system was performed at 16 ℃ for 12h to obtain the ligation product.

1.5, transformation: transferring 6.0. mu.L of the ligation product into 100. mu.L of Escherichia coli DH5 a competent cells, carrying out ice bath for 30min, carrying out heat shock at 42 ℃ for 45s, then placing on ice for 2min, adding 200. mu.L of SOC culture medium preheated to 37 ℃, uniformly plating on LB solid culture medium (containing 15g/L agar powder) containing 50mg/mL kanamycin, 0.2g/mL IPTG and 0.02g/mL X-gal after reviving at 37 ℃ for 1h, and carrying out overnight culture at 37 ℃.

The SOC culture medium comprises the following components: tryptone 20g/L, yeast powder 5g/L, NaCl 0.5g/L, KCl 0.185g/L, MgCl₂0.95g/L，MgSO₄1.2g/L, 3.6g/L glucose, deionized water as solvent and natural pH.

The LB medium consisted of: 10g/L of tryptone, 5g/L of yeast powder, 10g/L of NaCl and deionized water as a solvent, and the pH is natural.

1.6, plasmid extraction: randomly picking 5 white positive clones on LB solid medium in step 1.5 to 3.0mL LB liquid medium containing 50mg/mL kanamycin, shaking bacteria at 200rpm and 37 ℃ for 10h, carrying out amplification verification on the positive clones, and extracting plasmids according to the instructions of a plasmid extraction kit (11754785001) of Roche.

The method specifically comprises the following steps: the bacterial liquid is transferred into a 2.0mL centrifuge tube to be centrifuged at 12000rpm for 1min, and the supernatant is discarded. Adding 250 mu L of Suspension buffer containing RNase enzyme into the thallus precipitate, and uniformly mixing by shaking. Then 250. mu.L of lysine buffer was added and mixed 3-6 times by gentle inversion, at which time the solution became clear. Standing at room temperature for 5min, adding 350 μ L of Binding buffer pre-cooled on ice, reversing and mixing for 3-6 times until the solution becomes turbid, standing on ice for 5min, and centrifuging at 12000rpm for 10 min. The supernatant was transferred to a filter column and centrifuged at full speed for 1 min. The liquid in the collection tube was decanted, 700. mu.L of Wash buffer II was added to the filter column and centrifuged at full speed for 1 min. And (3) pouring out the liquid in the collecting pipe, repeatedly washing once again, pouring out the liquid in the collecting pipe, and centrifuging the empty column of the filter column for 2min at full speed. The filtration column was transferred to a 1.5mL centrifuge tube, 100. mu.L of Elution buffer was added, and the mixture was left at room temperature for 2min, centrifuged at 12000rpm for 2min, and the plasmid pTOP-NlUSP was collected.

1.7 sequencing: the plasmid pTOP-NlUSP was sequenced (done by Shanghai Yinyi Weiji Co., Ltd.), and the plasmid template sequence of pTOP-NlUSP containing NlUSP gene was shown in SEQ ID NO. 5:

AGTGCAAAACCGAGAACCCAGTTACAGAGGACGATTTAACGAATATTTATGAAGCAGCTGACAAGCAATTATTCCAGTTGGTCGATTGGGCGAAACATATTCCACATTTCACTGCATTACCTCTAGAAGATCAAGTATTACTATTAAGAGCAGGGTGGAACGAGCTGCTGATAGCGGCGTTCTCGCACCGGTCGGTGGAGATCAAGGACGGCATCGTGCTGGCGACCGGACTGGTCATCCACCGCGGATCAGCCACAGCCGCCGGCGTCGCCACCATATTCGACAGAGTGCTCACCGAGATCGTCGCCAAAATGAGAGAAATGAAAATGGATAAGACTGAGCTGGGTTGTCTTAGATCTATCATACTATTCAATCCAGATGTGCGAGACCTGAAGTCGACGCAA。

(2) and (3) synthesizing a primer:

the ds NlUSP-F forward primer and the dsNlUSP-R downstream primer were designed and synthesized using NCBI primer blast based on the sequence of the verified NlUSP gene fragment.

dsNlUSP-F upstream primer:

taatacgactcactatagggAGTGCAAAACCGAGAACCCA(SEQ ID NO.6)。

dsNlUSP-R downstream primer:

taatacgactcactatagggTTGCGTCGACTTCAGGTCTC(SEQ ID NO.7)。

lower case letters are T7 promoter sequence: TAATACGACTCACTATAGG.

(3) And (3) PCR amplification:

PCR amplification is carried out by taking a plasmid pTOP-NlUSP containing NlUSP gene as a template to obtain a dsDNA fragment of NlUSP containing a T7 promoter.

The PCR system is as follows: mu.L of the plasmid DNA of step (1), 20pmol each of the dsNlUSP-F forward primer, dsNlUSP-F forward primer of step (2), 0.2mM dNTP, 1 XPCR buffer, 2.5units of r-Taq DNA polymerase (Takara), 25. mu.L in total, was repeated 10 times.

The PCR amplification procedure was: denaturation at 95 deg.C for 2 min; 35 cycles of denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 40 s; finally, extension is carried out for 10min at 72 ℃.

The obtained PCR product is separated by agarose gel electrophoresis at the concentration of 2.0 percent, and the sequence of the PCR product is shown in SEQ ID NO. 5. 10 replicates of PCR products were recovered using the DNA purification recovery kit from Tiangen.

(4) Synthesizing dsRNA:

dsRNA was synthesized using the PCR product recovered in step (3) as a template and an RNAi synthesis kit available from Life technology.

The synthesis system is as follows: mu.g template, 2.0. mu.L 10 XT 7 buffer, 2.0. mu.L ATP, 2.0. mu.L GTP, 2.0. mu.L CTP, 2.0. mu.L UTP, 2.0. mu.L L T7 enzyme, 20.0. mu.L total.

Synthesis procedure: incubate at 37 ℃ for 5 hours and inactivate at 72 ℃ for 5 minutes.

To 20.0. mu.L of dsRNA, 21.0. mu.L of water ucrase-free, 5.0. mu.L of 10xdigestion buffer, 2.0. mu.L of DNase, and 2.0. mu.L of RNase were added. Incubate at 37 ℃ for 45min to degrade and remove DNA and single stranded RNA.

(5) And (3) purification:

in step (4), 50.0. mu.L of dsRNA-containing product was taken and added with 150.0. mu.L of Nuclear-free water, 50.0. mu.L of 10 binding buffer, 250.0. mu.L of 100% ethanol.

Mixing, transferring into a filter column, standing at room temperature for 2min, centrifuging at 12000rpm for 2min, and discarding the filtrate in the collection tube.

The filtration column was centrifuged at 12000rpm for 2min with 500. mu.L washing buffer added, without liquid, for 2min at 12000rpm, and then transferred to a 1.5mL centrifuge tube.

Add 50. mu.L of Elution buffer preheated to 95.0 ℃, leave at room temperature for 2min, centrifuge at 12000rpm for 2min, collect the purified NlUSP-dsRNA, and store at-80.0 ℃ for further use.

The 2.0% agarose gel electrophoresis is shown in FIG. 1.

Example 3:

a nucleic acid pesticide comprising 3 v/v% NlUSP-dsRNA; 20 v/v% methyl oleate; 5 v/v% tween; 5 v/v% azone, balance sterile water.

The preparation method comprises the following steps:

(1) 3mL of NlUSP-dsRNA was slowly added to 20mL of methyl oleate with stirring to form a clear water-in-oil emulsion.

(2) 5mL of Tween and 5mL of azone were slowly added to the emulsion obtained in the above step (1), and the mixture was sufficiently stirred to form a uniform emulsion.

(3) 67mL of water was slowly added to the emulsion in step (2) under magnetic stirring, and magnetic stirring was carried out at 300r/min while adding.

(4) After the water is dripped, the mixture is continuously magnetically stirred for 15min at the speed of 600r/min, and then the uniform and stable emulsion is prepared.

Comparative example 1:

a dsRNA-GFP (green fluorescent protein gene, an interfering gene fragment commonly used in RNAi) nucleic acid pesticide comprising: 3 v/v% dsRNA-GFP, 20 v/v% methyl oleate; 5 v/v% tween; 5 v/v% azone, balance sterile water.

The preparation process was identical to example 3.

Example 4:

an application of a nucleic acid pesticide in killing brown planthopper in rice, which comprises the following steps:

(1) the NlUSP-dsRNA nucleic acid pesticide of example 3 and the dsRNA-GFP nucleic acid pesticide of comparative example 1 were each diluted 10-fold with water to form drug-containing soaking solutions at a concentration of 0.3%.

(2) Soaking the rice seedlings in the 3-leaf stage in the medicine-containing soaking solution in the step (1) for 24 hours.

(3) And (3) inoculating the brown planthopper nymphs at the 3 th age to the rice seedlings, observing the morphological change and survival condition of the nymphs every day, taking out the nymph periodically to detect the gene expression condition, and recording.

Fig. 2 is a comparison of the mortality of rice seedlings after 3 instar brown planthopper feeding after drenching with dsRNA nucleic acid pesticide, and indicates that there is a very significant difference between the treatment and the control (p < 0.01). As can be seen from the figure: the survival rate of 3-year-old brown planthoppers is obviously reduced from that of a dsGFP control group at the third day after rice seedlings eating the root-drenched dsRNA pesticide, and the survival rate is continuously reduced along with the prolonging of the eating time, the survival rate of the brown planthoppers treated by the nucleic acid pesticide is only 4.6% at the 7 th day after the rice seedlings are eaten, and the survival rate of the control group is 62.3%.

FIG. 3 is the effect of dsRNA nucleic acid pesticides on molting of brown planthopper, A is the phenotype of control brown planthopper; and B is used for treating dead brown planthopper malformations. As can be seen from the figure: the growth of dead insects is hindered, the old cuticle is not successfully molted to form a tail at the tail, and a newly formed new cuticle forms double molting.

The method of the embodiment is not limited to NlUSP-dsRNA nucleic acid pesticide, other nucleic acid pesticides capable of acting on insects can be adopted, and the method of the embodiment can be adopted to achieve the same technical effect.

The foregoing is merely a preferred embodiment of the invention and is not intended to limit the invention in any manner. Although the present invention has been described with reference to the preferred embodiments, it is not intended to be limited thereto. Those skilled in the art can make many possible variations and modifications to the disclosed embodiments, or equivalent modifications, without departing from the spirit and scope of the invention, using the methods and techniques disclosed above. Therefore, any simple modification, equivalent replacement, equivalent change and modification made to the above embodiments according to the technical essence of the present invention are still within the scope of the protection of the technical solution of the present invention.

Sequence listing

<110> plant protection institute of Hunan province

China Rice Research Institute

<120> method for controlling plant pests, nucleic acid pesticide, preparation method and application thereof

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1339

<212> DNA

<213> Brown planthopper (Nilaparvata lugens)

<400> 1

gtgtcggtgg tgctcttttg gtgttgttat attacataag aggatcccgc catcatgcta 60

aaaaaagaga aaccgatgat gtctgtgaca gccattattc agagtgctgc tgctcatcac 120

tcatggggac gaggactgag cttggagaac aatttgtcgt tgaattcggt gggaccgcag 180

tcgccgctag aaatgaagcc agacacggcc agcctcacgg tgggcaactt tagtcccggc 240

ggcggaccaa atagtcctgg gtcgtacagt atcggcggcc atagcggcgt gggggggaag 300

atgcagtctg ccacgtcgcc ctaccccccc aaccacccac tgtccggctc caagcacctc 360

tgcgccatct gcggcgaccg agccagtggc aagcactacg gagtatacag ttgtgaagga 420

tgtaaaggat ttttcaagag gacagtgaga aaagacttat catacgcctg tcgagaagag 480

aaaagttgcc tcatcgataa aagacaaagg aataggtgtc aatattgtag atatcagaaa 540

tgtttgcaga tgggcatgaa aagagaggca gttcaggaag aaagacaaag gacaaaagaa 600

agagatcaga atgaggtgga gtcaaccagt agtttccaca cagacatgcc aatcgaaagg 660

attctggaag cggagaagct ggtcgagtgc aaaaccgaga acccagttac agaggacgat 720

ttaacgaata tttatgaagc agctgacaag caattattcc agttggtcga ttgggcgaaa 780

catattccac atttcactgc attacctcta gaagatcaag tattactatt aagagcaggg 840

tggaacgagc tgctgatagc ggcgttctcg caccggtcgg tggagatcaa ggacggcatc 900

gtgctggcga ccggactggt catccaccgc ggatcagcca cagccgccgg cgtcgccacc 960

atattcgaca gagtgctcac cgagatcgtc gccaaaatga gagaaatgaa aatggataag 1020

actgagctgg gttgtcttag atctatcata ctattcaatc cagatgtgcg agacctgaag 1080

tcgacgcaag aggtggagct gctgagggag aaggtgtaca cagcgctgga ggactacacg 1140

cgcatcaccc accccgagga gtcggggcgc ttcgccaagc tgctgttgag gctcccctcc 1200

ctgcgctcca tcggcctcaa gtgctccgag cacctcttct tctaccgcct catctccgac 1260

caagcgccca tcgacaactt cctcatggac atgctagaaa cgcctactga ccagtagatc 1320

accacactta cacgtacct 1339

<210> 2

<211> 420

<212> PRT

<213> Brown planthopper (Nilaparvata lugens)

<400> 2

Met Leu Lys Lys Glu Lys Pro Met Met Ser Val Thr Ala Ile Ile Gln

1 5 10 15

Ser Ala Ala Ala His His Ser Trp Gly Arg Gly Leu Ser Leu Glu Asn

20 25 30

Asn Leu Ser Leu Asn Ser Val Gly Pro Gln Ser Pro Leu Glu Met Lys

35 40 45

Pro Asp Thr Ala Ser Leu Thr Val Gly Asn Phe Ser Pro Gly Gly Gly

50 55 60

Pro Asn Ser Pro Gly Ser Tyr Ser Ile Gly Gly His Ser Gly Val Gly

65 70 75 80

Gly Lys Met Gln Ser Ala Thr Ser Pro Tyr Pro Pro Asn His Pro Leu

85 90 95

Ser Gly Ser Lys His Leu Cys Ala Ile Cys Gly Asp Arg Ala Ser Gly

100 105 110

Lys His Tyr Gly Val Tyr Ser Cys Glu Gly Cys Lys Gly Phe Phe Lys

115 120 125

Arg Thr Val Arg Lys Asp Leu Ser Tyr Ala Cys Arg Glu Glu Lys Ser

130 135 140

Cys Leu Ile Asp Lys Arg Gln Arg Asn Arg Cys Gln Tyr Cys Arg Tyr

145 150 155 160

Gln Lys Cys Leu Gln Met Gly Met Lys Arg Glu Ala Val Gln Glu Glu

165 170 175

Arg Gln Arg Thr Lys Glu Arg Asp Gln Asn Glu Val Glu Ser Thr Ser

180 185 190

Ser Phe His Thr Asp Met Pro Ile Glu Arg Ile Leu Glu Ala Glu Lys

195 200 205

Leu Val Glu Cys Lys Thr Glu Asn Pro Val Thr Glu Asp Asp Leu Thr

210 215 220

Asn Ile Tyr Glu Ala Ala Asp Lys Gln Leu Phe Gln Leu Val Asp Trp

225 230 235 240

Ala Lys His Ile Pro His Phe Thr Ala Leu Pro Leu Glu Asp Gln Val

245 250 255

Leu Leu Leu Arg Ala Gly Trp Asn Glu Leu Leu Ile Ala Ala Phe Ser

260 265 270

His Arg Ser Val Glu Ile Lys Asp Gly Ile Val Leu Ala Thr Gly Leu

275 280 285

Val Ile His Arg Gly Ser Ala Thr Ala Ala Gly Val Ala Thr Ile Phe

290 295 300

Asp Arg Val Leu Thr Glu Ile Val Ala Lys Met Arg Glu Met Lys Met

305 310 315 320

Asp Lys Thr Glu Leu Gly Cys Leu Arg Ser Ile Ile Leu Phe Asn Pro

325 330 335

Asp Val Arg Asp Leu Lys Ser Thr Gln Glu Val Glu Leu Leu Arg Glu

340 345 350

Lys Val Tyr Thr Ala Leu Glu Asp Tyr Thr Arg Ile Thr His Pro Glu

355 360 365

Glu Ser Gly Arg Phe Ala Lys Leu Leu Leu Arg Leu Pro Ser Leu Arg

370 375 380

Ser Ile Gly Leu Lys Cys Ser Glu His Leu Phe Phe Tyr Arg Leu Ile

385 390 395 400

Ser Asp Gln Ala Pro Ile Asp Asn Phe Leu Met Asp Met Leu Glu Thr

405 410 415

Pro Thr Asp Gln

420

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gtgtcggtgg tgctcttttg 20

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

aggtacgtgt aagtgtggtg a 21

<210> 5

<211> 404

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

agtgcaaaac cgagaaccca gttacagagg acgatttaac gaatatttat gaagcagctg 60

acaagcaatt attccagttg gtcgattggg cgaaacatat tccacatttc actgcattac 120

ctctagaaga tcaagtatta ctattaagag cagggtggaa cgagctgctg atagcggcgt 180

tctcgcaccg gtcggtggag atcaaggacg gcatcgtgct ggcgaccgga ctggtcatcc 240

accgcggatc agccacagcc gccggcgtcg ccaccatatt cgacagagtg ctcaccgaga 300

tcgtcgccaa aatgagagaa atgaaaatgg ataagactga gctgggttgt cttagatcta 360

tcatactatt caatccagat gtgcgagacc tgaagtcgac gcaa 404

<210> 6

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

taatacgact cactataggg agtgcaaaac cgagaaccca 40

<210> 7

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

taatacgact cactataggg ttgcgtcgac ttcaggtctc 40

Claims

1. A method of controlling plant pests, comprising the steps of:

(1) soaking the roots of the rice seedlings in a nucleic acid pesticide, wherein the nucleic acid pesticide is transported to the phloem of the rice through the transpiration of the plants;

(2) the insects eat the juice of the rice phloem, and the nucleic acid pesticide in the juice enters the bodies of the insects to kill the insects.

2. The method for controlling plant pests according to claim 1, wherein the nucleic acid pesticide comprises dsRNA having an insecticidal action, a solvent, an emulsifier, aminoketone.

3. The method for controlling plant pests according to claim 1, wherein the young rice plants are young rice plants at 3-leaf stage.

4. A nucleic acid pesticide, which is characterized by comprising NlUSP-dsRNA, a solvent, an emulsifier and aminoketone.

5. The nucleic acid pesticide of claim 4, wherein the solvent is methyl oleate and/or fatty acid methyl ester; the emulsifier is one or more of sucrose ester, tween and monodecanoate.

6. The nucleic acid pesticide of claim 4 or 5, wherein the concentration of the NlUSP-dsRNA is 0.5-5 v/v%, the concentration of the solvent is 5-30 v/v%, the concentration of the emulsifier is 5-10 v/v%, and the concentration of the aminoketone is 1-5 v/v%.

7. A method for producing a nucleic acid pesticide according to any one of claims 4 to 6, which comprises the steps of:

s1, synthesizing dsRNA according to NlUSP gene;

8. The preparation method according to claim 7, wherein the S1 specifically comprises the following steps:

s1-1, carrying out PCR amplification by using the brown planthopper cDNA as a template and using NlUSP-F1339 and NlUSP-R1339 as primers to obtain a PCR product; the DNA sequence of the NlUSP-F1339 is shown in SEQ ID NO.3, and the DNA sequence of the NlUSP-R1339 is shown in SEQ ID NO. 4;

9. The method for preparing the primer set according to claim 8, wherein the primer set comprises dsnlUSP-F and dsnlUSP-R, the DNA sequence of the dsnlUSP-F is shown as SEQ ID NO.6, and the DNA sequence of the dsnlUSP-R is shown as SEQ ID NO. 7.

10. The use of the nucleic acid pesticide as claimed in any one of claims 4 to 6 for controlling brown planthopper, which is characterized in that the method for controlling the brown planthopper comprises the following steps: soaking the roots of the rice seedlings in a nucleic acid pesticide, wherein the nucleic acid pesticide is transported to the phloem of the rice through the transpiration of the plants; the brown planthopper takes the juice of rice phloem, and the nucleic acid pesticide in the juice enters the insect body to kill the insect.