CN1119419C - Secretion-type bacterial strain to generate glutaryl-7-aminocephalophytenic acid acylase with high output - Google Patents

Abstract

The present invention provides a recombinant GL-7ACA acylase gene which is cloned from pseudomonas, is reformed by gene engineering and is 2.5 kb long and sequences of an expression element and a signal peptide thereof. The high secretory expression recombinant plasmid pETCA1S of the gene is established and is converted to a colibacillus strain BL21(DE3), the obtained gene engineering strain BL21(DE3)/pETCA1S can efficiently express GL-7ACA acylase in a secretory mode in an ordinary TB culture medium with the need of adding inducers, and the specific activity can achieve 82 units in 1g of strain.

Description

The new bacterial strain of secretor type high yield Glularyl-7-amino-cephalo-alkanoic acid acylase

The present invention relates to the cynnematin acylase, especially about a kind of glutaryl-7-amino-cephalo phytanic acid acylated enzyme gene and recombinant expression plasmid and the secreting, expressing of this gene in intestinal bacteria of containing this gene of recombinating.

(7-amino cephalosporanic acid 7-ACA) is the starting raw material of the synthetic most of cephalosporins derivatives of medicine industry to 7-amino-cephalosporanic acid.7-ACA can pass through tunning cephalo shoestring C, and (cephalosporin C, chemical deammoniation acidylate CPC) obtains.Because chemical process such as imines ether and nitrosyl chloride method comprise a plurality of steps that involve great expense,, people solve this problem [Vandamme E J, Voets J P.Adv Appl Micrbiol, 1974,17:311] with enzyme process so attempting to explore always.Have been found that two class cynnematin acylase (cephalosporin acylase at present; CA); be respectively Glularyl-7-amino-cephalo-alkanoic acid acylase (glutaryl-7-ACA acylase; the GL-7ACA acylase) and cephalosporin C acrylase (cephalosporin C acylase; the CPC acylase); they distinguish the hydrolysis reaction of catalysis GL-7ACA and CPC; again because CPC can (D-AAO) generate GL-7ACA[Isogai T et al J Biochem at an easy rate under the enzyme catalysis of D-amino-acid oxidase; 1990,108:1063].So the GL-7ACA acylase is the same with the CPC acylase, on the synthetic 7-ACA of enzyme process, has important use and be worth (see figure 1).

According to existing report, now the gene of existing 10 cynnematin acylases is cloned and [is seen MatsudaA, Komatsu K I.J Bacteriol, 1985,163:1222; Yang Y et al.Chin J Biotech, 1991,7:99; Ishii Y et al.J Ferment Bioeng, 1994,77:591; Matsuda A et al.JBacteriol, 1987,169:5815; Matsuda A et al.J Bacteriol, 1987,169:5821; Ishiye M, Niwa M.Biochim Biophys Acta, 1992,1132:233; Aramori I et al., J Ferment Bioeng, 1991,72:232; Aramori I et al.J Bacteriol, 1991,173:7848].Liu Yang Yun etc. are cloned into the gene [Yang Y et al.J Bacteriol, 1991,7:99] of GL-7-ACA acylase from pseudomonas, and have measured its complete sequence.This acylase and GK16 acylase [MatsudaA, Komatsu K I.J Bacteriol, 1985; 163:1222] and C430 acylase [Ishii Y et al.JFerment Bioeng; 1994,77:591] very similar, these three enzyme genes have the homology about 95%.Enzyme molecular weight is 70 kilodaltons, is made up of two subunits, and β-molecular weight subunit is that 54 kilodaltons, α-Ji are 16 kilodaltons; Their the most noticeable characteristics are that (pH6.5-9.0) all has very high hydrolysis vigor to GL-7ACA in very wide pH value scope; This point is very favourable on industrial production, because generate pentanedioic acid in the GL-7ACA hydrolytic process, the pH value of reaction solution changes greatly.

The GK16 acylase gene is at first by the clone of a tame Japanese firm [Tsuzuki K et al.NipponNougeikagaku Kaishi, 1989,63:1847], but this gene has only the full sequence of α-subunit of open report and the partial sequence of β-subunit.The C430 acylase gene has been cloned by another company of Japan subsequently, and has published complete genome sequence [Ishii Y et al.J Ferment Bioeng, 1994,77:591].Because enzyme gene expression amount in pseudomonas is extremely low, this two tame Japanese firm has all carried out high expression level work in various degree to the enzyme gene in intestinal bacteria, and the high expression level strain enzyme-producing amount that obtains is than high times of former host bacterium (pseudomonas).Liu Yang Yun etc. are about 3.5kb (kb represents that the length of DNA is 1000 base pairs) from pseudomonas clone's acylase gene fragment; this gene is expressed extremely low in pseudomonas; even it is also very low in the expression in escherichia coli amount; thick drawing liquid than vigor only be every milligram of albumen 0.42 unit (0.42u/mg) [Zhou Hongwei etc. the microorganism journal; 1997; 37:196], need through five complicated step ability purifying.Employing gene engineering method such as Li Yong are transformed this enzyme gene; improved gene obtains high expression level in intestinal bacteria; the strain enzyme-producing amount reaches the wet bacterium 2040 unit enzymes of every gram; thick drawing liquid acidylate specific activity of enzyme is every milligram of albumen 3.5 units; and just reached [the Yong Li et al.ProteinExpression and Purification of every milligram of protein 12 unit than vigor behind the simple two step chromatography column purifying of thick drawing liquid process; 1998,12:233-238].

But the method for above cance high-expression gene has all adopted the expression strain of nonsecreting type, inevitably to relate to the problem that is difficult to deal with in a series of productions such as the separation and purification of enzyme and immobilized enzyme, consequently technology, plant and instrument are required very highly, production cost is improved greatly.For this reason; Chen Jianfeng etc. have made up secretive expression vector pTrcCA1S and the pKKCA1S of GL-7ACA by Pseudomonas sp.130 Expression element and signal peptide; this Expression element mediation GL-7ACA acylase gene has obtained high expression level in intestinal bacteria; expression product is transported to periplasmic space under the guiding of signal peptide; the acidylate specific activity of enzyme that records intact cell is respectively every gram thalline 23.9 units and every gram thalline 18.3 [Chen Jianfeng etc. of unit; Acta Biochimica et Biophysica Sinica; 1998,30 (4): 393-396].Because the substrate GL-7ACA and the product 7-ACA of GL-7ACA acylase can free in and out periplasmic space, can obtain product by in substratum, adding substrate, thereby might simplify production technique, reduce production costs.But these two plasmids have a common drawback, and promptly they have amicillin resistance, have β-Nei acyl ammonia enzyme gene.Although β-Nei acyl ammonia enzyme is extremely low to GL-7ACA and CPC hydrolysis vigor, in large batch of industrial production, still might destroy substrate (GL-7ACA and CPC).Therefore spy of the present invention has made up not with the secreting, expressing plasmid of β-Nei acyl ammonia enzyme gene, makes it obtain high expression level in intestinal bacteria, so that play a significant role in the Production by Enzymes process of 7-ACA.

The object of the invention provides a kind of reorganization GL-7ACA acylase gene and Expression element and signal peptide; with the band kalamycin resistance secretor type high expression level recombinant plasmid that contains this recombination and Expression element thereof and signal peptide, and with this recombinant secretor expression plasmid be transformed into become in the specific intestinal bacteria can high this acylase of secreting, expressing engineering strain.

The invention provides a kind of that clone from pseudomonas and be reorganization GL-7ACA acylase gene and Expression element and the signal peptide of 2.5kb through the length of gene engineering method transformation, their complete sequence is seen Fig. 3 and Fig. 6, Fig. 7.The expression vector pET-28a (+) that two fragments that are cut into this reorganization GL-7ACA acylase gene and Nco I and HindIII enzyme are cut back intestinal bacteria band kalamycin resistance is connected to become recombinant secretor expression plasmid pETCA1S, this recombinant secretor expression plasmid pETCA1S is transformed into obtains secretor type cance high-expression gene engineering strain BL21 (DE3)/pETCA1S in the e. coli bl21 (DE3) again.

Reorganization GL-7ACA acylase gene with and the clone of Expression element, signal peptide

The GL-7ACA acylase gene with and Expression element, signal peptide by clones [Liu Yang Yun etc., biotechnology journal, 1991,7 (2): 99-107] such as Yang Yunliu, but the unexposed sequence of delivering them.The plasmid pMR24 that Liu Yang Yun etc. make up, it has long from pseudomonas is the segmental GL-7ACA acylase gene of 3.5kb.After pMR24 cut with restriction enzyme BamH I enzyme, obtain the fragment of 0.7kb, it includes the corresponding nucleotide sequence of GL-7ACA acylase α-subunit and expression original paper, the signal peptide of this enzyme.Expression element mediation GL-7ACA acylase gene obtains high expression level in intestinal bacteria, signal peptide guiding GL-7ACA acylase is secreted into periplasmic space.This 0.7kb fragment and the carrier pBluescript SKII after restriction enzyme BamH I enzyme is cut are connected into recombinant plasmid pBlue3.Chen Jianfeng etc. utilize pBlue3 and pKKCA1[Yong Li et al.Protein Expression and Purification; 1998; 12:233-238] made up recombinant secretor expression plasmid pKKCA1S[Chen Jian peak etc.; Acta Biochimica et Biophysica Sinica; 1998; 30 (4): 393-396], it includes length and is the reorganization GL-7ACA acylase gene of 2.5kb, but unexposed its sequence of delivering.

2. the structure of recombinant secretor type expression plasmid pETCA1S

Behind above-mentioned expression plasmid pKKCA1S usefulness restriction enzyme Nco I and Hind III double digestion, the reorganization GL-7ACA acylase gene that comprises in this plasmid can be cut into two fragments that length is respectively 1.0kb and 1.5kb.The fragment of 1.5kb and the coli expression carrier pET-28a (+) behind Nco I and Hind III double digestion are connected into transitional plasmid pETCA1S-B.PETCA1S-B successively through Nco I enzyme cut with Roll alkaline phosphatase dephosphorylation after, connect into recombinant secretor type expression plasmid pETCA1S (as shown in Figure 2) with the fragment of 1.0kb.In this plasmid, acylase gene relies on the T7 promotor of coli expression carrier pET28-a (+), self Expression element and transcription terminator and terminator codon and express, and relies on signal peptide guiding GL-7ACA acylase to be secreted into periplasmic space then.

3. the acquisition of engineering strain BL21 (DE3)/pETCA1S

PETCA1S is transformed in the e. coli bl21 (DE3) { hereditary feature is hsdSgal (λ cIts857indl Sam7 nih5 lacUV5-T7 genel) }, transformant BL21 (the DE3)/pETCA1S that obtains is engineering strain of the present invention (culture presevation number: CGMCC NO.0473, date: on July 11st, 2000, preservation ground: Beijing, China Committee for Culture Collection of Microorganisms common micro-organisms center).Though plasmid pETCA1S has the lacI gene, because the specificity of T7 promotor and host bacterium BL21 (DE3) can the high expression level t7 rna polymerases, in that do not add also can high expression level under the IPTG inductive condition.

4. intact cell GL-7ACA acylase vitality test

The mensuration of intact cell GL-7ACA acylase vigor is carried out with reference to people's such as Ichikawa method [Ichikawa et al.Argric Biol Chem, 1981,45 (10), 2225-2229.].Enzyme activity unit (unit) is defined as 37 ℃, per minute hydrolysis GL-7ACA produces the needed enzyme amount of 1 micromolar 7-ACA during pH7.0.The ratio vigor of enzyme is defined as the enzyme activity unit that every gram thalline is had.This bacterial strain is cultured to the logarithm later stage in 30 ℃ in general T B substratum, recording than vigor is 82 units of every gram thalline (these data are the mean value of eight experiments), is higher than TG1/pTrcCA1S (23.9 units of every gram thalline) and TG1/pKKCA1S (18.3 units of every gram thalline).

The enzyme activity determination of the proteinic classification just of 5 periplasmic spaces, SDS-PAGE and thick enzyme

The proteic classification just of periplasmic space is carried out (Sambrook according to the method that Molecular Cloning:A Laboratory Manual introduces, J et al.1989, Molecular Cloning:A LaboratoryManual.Cold Spring Harbor, New York:843).After the thick drawing liquid that obtains concentrates 5 times, carry out the enzyme activity of SDS-PAGE and the thick drawing liquid of mensuration again.The enzyme activity determination of thick drawing liquid is with reference to people's such as Ichikawa method [Ichikawa et al.Argric Biol Chem, 1981; 45:773] carry out, the enzyme activity that records every milliliter of thick drawing liquid is 1.35 units.

6. stability experiment

Containing on the LB flat board that kantlex concentration reaches 10 mcg/ml streak culturely, continuous passage reaches 50 times, measures the 10th, 20,30,40,50 ratio vigor, and vigor is stable, as seen this gene very stable (see figure 5) in intestinal bacteria.

Advantage of the present invention:

The present invention is a kind of high yield GL-7ACA acylase, secretor type and have the novel gene engineering bacteria of kalamycin resistance.Clone and be reorganization GL-7ACA acylase gene and the secreting, expressing element thereof of 2.5kb from pseudomonas through the length of gene engineering method transformation.The coli expression carrier pET-28a (+) that has kalamycin resistance after cutting with this reorganization GL-7ACA acylase gene and Nco I and HindIII enzyme is connected to become recombinant expression plasmid pETCA1S, this plasmid pETCA1S is transformed into engineering strain BL21 (the DE3)/pETCA1S that obtains high expression level GL-7ACA acylase in the e. coli bl21 (DE3) again.With JM109/pKKCA1, TG1/pKKCA1S and TG1/pTrcCA1S compare, and it has following advantage:

1. secreting, expressing

Compare JM109/pKKCA1[Yong Li et al.Protein Expression and Purification, 1998,12:233-238], because it is non-secreting, expressing bacterial strain, in case be used to produce with regard to complicated technology problems such as the separation and purification that unavoidably will relate to enzyme and immobilized enzyme, production cost improves greatly.And because the present invention has used the signal peptide of GL-7ACA acylase; engineering strain BL21 (the DE3)/pETCA1S that obtains is the secreting, expressing bacterial strain; the GL-7ACA acylase of expressing direct secretion under the guiding of signal peptide arrives periplasmic space; and GL-7ACA and 7-ACA can both free in and out periplasmic space; so can adopt the traditional zymotic method to produce fully, thereby reduce production costs greatly.

2. be not with β-alanyl enzyme gene

Though TG1/pTrcCA1S and TG1/pKKCA1S[Chen Jian peak etc., Acta Biochimica et Biophysica Sinica, 1998,30 (4): 393-396] all be the secreting, expressing bacterial strain, because plasmid is an amicillin resistance, all has β-alanyl enzyme gene, although β-Nei acyl ammonia enzyme is extremely low to GL-7ACA and CPC hydrolysis vigor, but in large batch of industrial production, still might destroy substrate (GL-7ACA and CPC).Bacterial strain of the present invention has replaced amicillin resistance with kalamycin resistance, has overcome this shortcoming.

3. do not need to use inductor

Though TG1/pTrcCA1S can secrete high expression level GL-7ACA acylase, need expensive and deleterious IPTG induces.Bacterial strain of the present invention does not need to add any inductor, has reduced cost, has avoided the importing toxic substance.

4. secreting, expressing output improves a lot

The genetic engineering bacterium of the initial structure of expression rate ratio of the engineering strain that Li Yong and Chen Jianfeng make up has improved a lot [Yong Li et al.Protein Expression and Purification, 1998,12:233-238; Chen Jianfeng etc., Acta Biochimica et Biophysica Sinica, 1998,30 (4): 393-396].But the BL21 that makes up among the present invention (DE3)/pETCA1S has special T7 promotor; the expression amount of GL-7ACA acylase in the transformant that contains this plasmid is improved greatly; the ratio vigor of intact cell can reach every gram thalline 82 units, is about 3.4 times of TG1/pTrcCA1S (23.9 units of every gram thalline), 4.5 times of TG1/pKKCA1S (18.3 units of every gram thalline).

5. bacterial strain of the present invention is easily cultivated and is expressed stable

Bacterial strain of the present invention got final product in 30 ℃ of cultivations in general T B substratum in 24 hours.Bacterial strain of the present invention is expressed GL-7ACA acylase stabilizer pole, and 50 generations of going down to posterity do not see Table and reach output decline and enzyme forfeiture alive.

The present invention is further elaborated by the following drawings and embodiment.

Description of drawings

Fig. 1 is GL-7ACA acylase and the catalytic reaction synoptic diagram of CPC acylase.CPC: cephalosporin; The D-AAO:D-amino-acid oxidase; The 7-ACA:7-amino-cephalo-alkanoic acid; GL-7ACA: Glularyl-7-amino-cephalo-alkanoic acid.

Fig. 2 is the structure synoptic diagram of recombinant secretor expression plasmid pETCA1S.

Fig. 3 is the nucleotide sequence and the amino acid sequence corresponding of the reorganization GL-7ACA acylase gene of 2.5kb of the present invention.

Fig. 4 is the proteic SDS-PAGE figure of periplasmic space.

Among the figure: 1. protein molecular weight standard, molecular weight is respectively 66,43,31,20 kilodaltons (kD); 2. the thick drawing liquid of periplasmic space; 3.BL21 (DE3)/the intact cell lysate of pETCA1S bacterial strain; 4.BL21 (DE3) bacterial strain intact cell lysate contrast.

Fig. 5 is stability experiment the 1st, 10,20,30,40,50 generation GL-7ACA acylase vigor.

Fig. 6 is the Expression element nucleotide sequence.

Fig. 7 is the nucleotide sequence and the amino acid sequence corresponding of signal peptide.

The structure of embodiment 1 recombinant secretor type expression plasmid pETCA1S

Plasmid pKKCA1S[Chen Jian peak etc.; Acta Biochimica et Biophysica Sinica; 1998; 30 (4): 393-396] behind NcoI and HindIII double digestion; reorganization GL-7ACA acylase gene is cut into two sections; wherein the long segment of 1.5kb has NcoI and HindIII sticky end, and the short-movie section two ends of 1.0kb all have the NcoI sticky end.Coli expression carrier pET28-a (+) [for Novagen company product] length is 5369bp, it includes a specific strong T7 promotor, NcoI multiple clone site, the lacI operon to XhoI, lacZ ribosome bind site AGGA and initiator codon ATG; Duplicate for fear of unsettled, and then a strong transcription terminator is the T7 terminator in the downstream of multiple clone site; This carrier has a kalamycin resistance gene, therefore has kalamycin resistance; This plasmid has ColE1 and two replicons of f1.With the T4DNA ligase enzyme 1.5kb fragment and NcoI are connected with expression vector pET28-a (+) behind the HindIII double digestion, obtain transitional plasmid pETCA1S-B.PETCA1S-B connects into secretion expression plasmid pETCA1S (see figure 2) with the small segment of 1.0kb successively after NcoI single endonuclease digestion and calf intestinal alkaline phosphatase (CIP) are handled.

The acquisition of embodiment 2 engineering strain BL21 (DE3)/pETCA1S

With e. coli bl21 (DE3) { hereditary feature is hsdSgal (λ cIts857 indl Sam7 nin5lacUV5-T7 genel) } Calcium Chloride Method (Sambrook, J et al. (1989) Molecular Cloning:ALaboratory Manual.Cold Spring Harbor, New York) (transformation efficiency is 10 to be prepared into competent cell ⁶Pfu).PETCA1S is transformed in this cell, and transformant called after BL21 (the DE3)/pETCA1S that obtains is engineering strain of the present invention.In general T B substratum (super broth substratum, every liter of culture medium preparation: in 900 ml deionized water, add 12 gram microbial culture with tryptone, 24 gram microbial culture yeast extracts, 4 milliliters of glycerine, 1.034 * 10 ⁵Steam sterilizing is 20 minutes under pascal's high pressure; this solution is cooled to below 60 ℃ or 60 ℃; adding 100 milliliters of 0.17 mol potassium primary phosphate, 0.72 mol dipotassium hydrogen phosphate solutions through sterilization again forms) in 30 ℃ cultivate 24 hours after; centrifugal collection thalline is also surveyed GL-7ACA acylase vigor, and recording than vigor is 82 units of every gram thalline.

The enzyme activity determination of embodiment 3 intact cells

The mensuration of the GL-7ACA acylase vigor of intact cell is carried out with reference to people's such as Ichikawa method [Ichikawa et al.Argric Biol Chem, 1981,45 (10), 2225-2229.].Enzyme activity unit (unit) is defined as 37 ℃, per minute hydrolysis GL-7ACA produces the needed enzyme amount of 1 micromolar 7-ACA during pH7.0.The ratio vigor of enzyme is defined as the enzyme activity unit that every gram thalline is had.In general T B substratum (with embodiment 2) in 30 ℃ cultivate 24 hours after, get 4 milliliters of bacterium liquid, collected thalline in centrifugal 10 minutes for 8000 rev/mins, precipitation is suspended in 3 milliliters of pH7.0,0.1 mole every liter the sodium phosphate buffer.Get 100 microlitre bacterium liquid in 37 ℃ of preheatings 5 minutes, add 100 microlitres simultaneously in 37 ℃ of preheatings 5 minutes 16 mmoles/liter GL-7ACA, mix insulation 30 minutes in 37 ℃; Add 600 microlitre stop buffers (NaOH that 20% acetic acid and 50 mmoles are every liter mixes with 2: 1 volume ratio) and mix, 15000 rpms centrifugal 10 minutes, get supernatant; Paradimethy laminobenzaldehyde (Merk company, the U.S.) colour developing that adds 100 microlitres 0.5% at last; Measure the absorbance value of final blending liquid, can calculate the amount of hydrolysate 7-ACA in 415 nanometers.In addition, get bacterium liquid and do suitably dilution, survey absorbance value in 600 nanometers.Can calculate the mycoplasma amount with 7-ACA output and to compare vigor.

Embodiment 4 periplasmic space acylases are slightly carried, the enzyme activity determination of SDS-PAGE and thick enzyme

The proteic classification just of periplasmic space is carried out (Sambrook according to the method that Molecular Cloning:A Laboratory Manual introduces, J et al. (1989) Molecular Cloning:A Laboratory Manual.Cold Spring Harbor, New York:843).Get 50 milliliters of bacterium liquid, 13000 rpms of centrifugal 3 minutes sedimentation cells in the time of 4 ℃; Precipitation is suspended in (1 milligram every milliliter of N,O-Diacetylmuramidase, mass volume ratio are 20% sucrose, the Tris.Cl of 30 mmole pH8.0, the EDTA of 1 mmole pH8.0) in the 5 lysozyme ml lysates, ice bath 10 minutes; 13000 rpms of centrifugal 3 minutes sedimentation cells in the time of 4 ℃ are collected supernatant then; Supernatant pack in the dialysis tubing polyoxyethylene glycol concentrated 5 times after, carry out the SDS-PAGE (see figure 4) again and survey heavy manual labour.Thick drawing liquid of periplasmic space and intact cell lysate all can be seen β-subunit band of 54kD; As seen α-subunit only has faint band 16KD at the thick drawing liquid of periplasmic space because molecular weight is too small.Method [Ichikawa et al.Argric Biol Chem, 1981 with reference to people such as Ichikawa are measured in heavy manual labour; 45:773] carry out.Enzyme activity is defined as 37 ℃, per minute hydrolysis GL-7ACA produces the needed enzyme amount of 1 micromolar 7-ACA during pH7.0.Surveying live body is 600 microlitres, reaction buffer be 100 mmoles/liter, the sodium phosphate buffer of pH7.0, concentration of substrate be 16 mmoles/liter; Add an amount of enzyme, in 37 ℃ of insulations 20 minutes; Stop buffer (20% acetic acid mixes with 2: 1 volume ratio with the NaOH of every liter of the 50 mmole) termination reaction that adds 1.8 milliliters; Paradimethy laminobenzaldehyde (Merk company, the U.S.) colour developing that adds 100 microlitres 0.5% at last; Measure the absorbance value of final blending liquid, can calculate the amount of hydrolysate 7-ACA in 415 nanometers.The enzyme activity that records every milliliter of thick drawing liquid is 1.35 units.

Claims (2)

1, a kind of engineering strain of secretor type high yield Glularyl-7-amino-cephalo-alkanoic acid acylase is characterized in that this bacterial strain is that recombinant secretor expression plasmid pETCA1S is transformed into engineering strain BL21 (DE3)/pETCA1S that the preserving number that obtains in the e. coli bl21 (DE3) is CGMCC No.0473.

2. engineering strain as claimed in claim 1 is characterized in that this expression plasmid is the recombinant secretor expression plasmid pETCA1S of the band kalamycin resistance that forms of coli expression carrier pET28-a (+) structure after being cut with Nco I and Hind III enzyme by the reorganization GL-7ACA acylase gene of the corresponding nucleotide sequence of band Expression element and signal peptide; The nucleotide sequence of this Expression element is as follows:

ATCCGTGGTTCGTACGCGCCGCCTACAAGTGGTGATCTAGGGGAACGTTCCGGGGGCGTCGCTTCAACG

The nucleotide sequence and the amino acid sequence corresponding of this signal peptide of GCGTCTCCGGATCTGGGTGAGAGGGGAAATCC are as follows:

ATGCTGAGAGTTCTGCACCGGGCGACGTCCGCCCTGGTTATGGCGACTGCGATCGGCCTTGCGCCCGGC

MetLeuArgValLeuHisArgAlaThrSerAlaLeuValMetAlaThrAlaIleGlyLeuAlaProGly

GTCGCCCTTGCG

ValAlaLeuAla

Images