CN111926088A - Primer group, kit and method for detecting plecoglossus altivelis population - Google Patents
Primer group, kit and method for detecting plecoglossus altivelis population Download PDFInfo
- Publication number
- CN111926088A CN111926088A CN202010881847.0A CN202010881847A CN111926088A CN 111926088 A CN111926088 A CN 111926088A CN 202010881847 A CN202010881847 A CN 202010881847A CN 111926088 A CN111926088 A CN 111926088A
- Authority
- CN
- China
- Prior art keywords
- sample
- dna
- primer
- edna
- environment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer group, a kit and a method for detecting a plecoglossus herd, belonging to the technical field of species distribution detection, wherein the primer group comprises an upstream primer, a downstream primer and a fluorescent probe; the nucleotide sequence of the upstream primer is shown as SEQ ID No.1, the nucleotide sequence of the downstream primer is shown as SEQ ID No.2, and the nucleotide sequence of the fluorescent probe is shown as SEQ ID No. 3. The method comprises the following steps: 1) collecting an environment eDNA sample from an environment to be detected, 2) extracting DNA in the environment eDNA sample to obtain DNA sample liquid; 3) and (3) performing qPCR amplification by using the primer group by using the DNA sample solution as a template, determining a Ct value, and judging a result according to the Ct value. The method can be used for rapidly and efficiently detecting the atlantic fish species group by adopting the environmental DNA technology on the premise of not damaging the environment and the native fish species group.
Description
Technical Field
The invention belongs to the technical field of species distribution detection, and particularly relates to a primer group, a kit and a method for detecting a pleiones herd.
Background
The Charpy fish Astrontus ocellatus (Agassiz,1831) is a fish belonging to Cichlioidea (Cichliformes), Liyuridae (Cichlidae), and Charpy (Astrontus). The maximum body length can reach 33 cm, and the maximum body weight is about 1.1 kg. The fish body is oval, flat on the side, big in head and big in mouth. Not only has teeth in its jaw, but also has a set of pharyngeal teeth. The teeth in the jaw are small and can be used for grasping, while the teeth in the throat (pharyngeal teeth) are used for manipulating and handling the game. The basic tone of the body color is black or blackish brown, irregular orange-red patches are scattered on the body side, red stripes are embedded among the patches, and the body is in a map shape and is named as map fish. The round black spot is arranged above the base part of the tail fin, and the periphery of the round black spot is provided with an orange red ring which flashes and shines when swimming, is similar to a summer star and is also named as a tail star fish. The big black spot on the handle of the adult fish tail is like eyes, can be used as a protective color and an attractive color, so that other fishes can easily become the charpy fish mouth Chinese meal before and after being indistinct. The plecoglossus altivelis has low requirement on water quality and can normally live in weakly acidic, neutral and slightly alkaline water. Middle and lower layers of carnivorous fish. Although the body is thick and stubborn and the action is slow, the predation reaction is agile and accurate. Staple food such as small fish, shrimp, and tubificidae. The origin is in Guiyan province in south America, and Amazon river basin in Venezuela, Peru, and Brazil. The 20 th century and the 70 th century are introduced into China, and particularly, the fish is popular and favored by people as a high-grade tropical ornamental fish. However, the mary fish invades a fresh water ecosystem such as Hainan as a foreign species due to artificial reproduction and the like, and causes a certain damage to native fishes.
The method is an important content for the resource protection and the biodiversity research of the native fishes by timely mastering the distribution pattern and the population size of the marbled fish species group. Traditional monitoring of mary fish population distribution, mainly by field investigation methods, such as harvesting fish from a net, has the disadvantages of time and labor consumption, high cost, low capture rate, potential damage to target species or disruption of the ecosystem of the investigation site. Environmental DNA (eDNA) analysis is a new tool for biological research combining DNA analysis techniques with traditional methods. This method was first in the 80's of the last century. In the next 20 years, with the breakthrough of key technologies such as sample sampling, DNA extraction, analysis and sequencing, the eDNA analysis is developed into a complete species distribution detection technical means. The application of the method extends from microbiological analysis to identification of high-grade aquatic or semi-aquatic species, and diversity analysis of population and biological community. Fluorescent Quantitative PCR (qPCR) has high specificity, can quantitatively analyze DNA, and has become an important means for eDNA analysis in recent years instead of general PCR.
At present, no report is found about the related research of the specific amplification primer and the fluorescent probe between the marmoreus species. The qPCR analysis of the Pansy is established, and the realization of simple, quick, accurate and objective molecular identification of the Pansy is the problem which is urgently needed to be solved by developing eDNA monitoring of the Pansy at present.
Disclosure of Invention
In view of the above, the present invention aims to provide a primer set, a kit and a method for detecting a population of marbled fish; the method can be used for rapidly and efficiently detecting the atlantic fish species group by adopting the environmental DNA technology on the premise of not damaging the environment and the native fish species group.
In order to achieve the above purpose, the invention provides the following technical scheme:
the invention provides a primer group for detecting a plecoglossus herd, which comprises an upstream primer, a downstream primer and a fluorescent probe; the nucleotide sequence of the upstream primer is shown as SEQ ID No.1, the nucleotide sequence of the downstream primer is shown as SEQ ID No.2, and the nucleotide sequence of the fluorescent probe is shown as SEQ ID No. 3.
The invention provides a kit for detecting plecoglossus altivelis population, which comprises a primer group, a DNA extraction reagent and a qPCR amplification reagent.
The invention provides a method for detecting plecoglossus altivelis population, which comprises the following steps:
1) collecting an environmental eDNA sample from an environment to be detected,
2) extracting DNA in the environment eDNA sample to obtain a DNA sample solution;
3) and (3) carrying out qPCR amplification by using the DNA sample solution as a template and the primer group, determining the Ct value, determining that the result is positive when the Ct value is less than or equal to 35, namely the pleione population exists in the environment to be detected, and determining that the result is negative when the Ct value is more than 35, namely the pleione population does not exist in the environment.
Preferably, the environmental eDNA sample is a water sample or a sediment sample.
Preferably, when the environment eDNA sample is a water sample, carrying out filter membrane suction filtration on the water sample, soaking the filter membrane subjected to suction filtration in alcohol, and extracting DNA.
Preferably, when the environmental eDNA sample is a sediment sample, the sediment sample is mixed and ground with liquid nitrogen, and then DNA is extracted.
Preferably, the qPCR amplification system is calculated by 20 μ L and comprises the following components: PremixExTaq10 μ L, 10 μ M upstream primer 0.4 μ L, 10 μ M downstream primer 0.4 μ L, 10 μ M fluorescent probe 0.4 μ L, 100g/μ L DNA sample solution 1 μ L and deionized water 7.8 μ L.
Preferably, the qPCR amplification procedure comprises: pre-denaturation at 95 ℃ for 10 s; denaturation at 95 ℃ for 10s, annealing at 56 ℃ for 15s, and extension at 72 ℃ for 10s for 40 cycles; extending for 3min at 72 ℃, and storing at 4 ℃.
The invention has the beneficial effects that: the primer group for detecting the plecoglossus pelagicus population provided by the invention can realize specific amplification among the plecoglossus species, can realize quick and efficient detection of the plecoglossus species, and reduces the subsequent sequencing cost and the time required by sequencing. The environmental eDNA samples collected by the method are substrate sludge samples and water samples (the substrate sludge samples and the water samples have substance residues such as tissue components and secretions of species living therein, and the eDNA samples are obtained from the substrate sludge samples and the water samples), the detection points are not damaged, species individuals, particularly native fishes, are not adversely affected, and compared with a field investigation method used in traditional detection of the population distribution of Pangolian fishes, the method has the advantages of time and labor saving, low cost, high efficiency, and no damage to target species or damage to an ecological system of the investigation points.
Detailed Description
The invention provides a primer group for detecting a plecoglossus herd, which comprises an upstream primer, a downstream primer and a fluorescent probe; the nucleotide sequence of the upstream primer is shown as SEQ ID No.1, and specifically comprises the following steps: 5'-TTGGACTACTTACTGCCTTAGAACT-3', the nucleotide sequence of the downstream primer is shown in SEQ ID No.2, and the sequence is as follows: 5'-TCCTAGTATATTGGAGAAGTGGTGAAG-3', the nucleotide sequence of the fluorescent probe is shown as SEQ ID No.3, and the specific sequence is as follows: 5 '-FAM-CCTCCCTAACCGCTAAACAACTCAAACCCT-TAMRA-3'. In the invention, two ends of the fluorescent probe are connected with the fluorescent groups, and the fluorescent PCR fluorescent probe can detect more accurately and specifically. In the invention, the upstream primer, the downstream primer and the fluorescent probe in the primer group are all interspecific specific sequences, so that the specific amplification of the pleiones population can be realized, the influence of other closely related species is avoided, and the detection accuracy and the result reliability can be greatly improved.
The invention also provides a kit for detecting the pleiones fish population, which comprises the primer group, the DNA extraction reagent and the qPCR amplification reagent. The DNA extraction reagent is not particularly limited, and the DNA extraction reagent is conventional in the field, and is carried out by adopting a DNA extraction kit in the specific implementation process of the invention. In the present invention, the qPCR amplification reagent preferably comprises PremixExTaq.
The invention also provides a method for detecting the plecoglossus altivelis population, which comprises the following steps: 1) collecting an environment eDNA sample from an environment to be detected, 2) extracting DNA in the environment eDNA sample to obtain DNA sample liquid; 3) and (3) carrying out qPCR amplification by using the DNA sample solution as a template and the primer group, determining the Ct value, determining that the result is positive when the Ct value is less than or equal to 35, namely the pleione population exists in the environment to be detected, and determining that the result is negative when the Ct value is more than 35, namely the pleione population does not exist in the environment.
In the present invention, an environmental eDNA sample is first collected from the environment to be tested. In the present invention, the environmental eDNA sample is preferably a sediment sample or a water sample. The method for collecting the environmental eDNA sample is not particularly limited, and the conventional method for collecting the sediment sample or the water sample in the field can be adopted. In the invention, because the solubility of water is higher, the eDNA content in the water is higher, and the water sample can be subjected to large-volume suction filtration, so that the eDNA at the detection point can be more accurately reflected, and the selection of the water sample is favorable for improving the detection accuracy and the result reliability.
In the present invention, the environmental eDNA sample is preferably pre-treated after collection. When the environmental eDNA sample is a water sample, the pre-treatment comprises: and (3) carrying out filter membrane suction filtration on the water sample, and soaking the filter membrane subjected to suction filtration in alcohol. In the invention, the suction filtration is preferably carried out by adopting a conventional suction filtration device in the field, and macromolecules such as cells in the water sample are intercepted on the filter membrane through suction filtration. After the suction filtration is finished, soaking the filter membrane in alcohol, wherein the soaking temperature is preferably-20 ℃, and the soaking time is preferably as follows: the sampling is finished until the extraction of the eDNA, and the soaking aims to protect the eDNA and delay the degradation of the eDNA. In the invention, the filter membrane can enrich the eDNA, the alcohol and the low temperature can play a certain protection role on the eDNA, and the alcohol provides an environmental condition with extremely low water content and can keep the integrity of the DNA in the soaking process. After the pretreatment is finished, the alcohol can be quickly volatilized, so that the subsequent DNA extraction, detection and the like are not influenced.
In the present invention, when the environmental eDNA sample is a sediment sample, the pretreatment is preferably to mix and grind the sediment sample with liquid nitrogen. In the present invention, the grinding is preferably repeated until the muddy bottom sample is powdery. In the present invention, the liquid nitrogen milling functions to release the DNA in the sample sufficiently. After the environmental eDNA sample is obtained, the DNA in the environmental eDNA sample is extracted to obtain a DNA sample solution. In the present invention, DNA extraction from the environmental eDNA sample is preferably performed by using a DNA extraction kit, and the specific operation steps are described in the kit specification. After the extraction is finished, the extracted DNA is dissolved by water to obtain DNA sample liquid.
After the DNA sample solution is obtained, the DNA sample solution is used as a template, the primer group is used for qPCR amplification, and the Ct value is determined. In the present invention, the qPCR amplification system is calculated at 20 μ L, and preferably comprises the following components: 10 mu L of PremixExTaq, 0.4 mu L of 10 mu M upstream primer, 0.4 mu L of 10 mu M downstream primer, 0.4 mu L of 10 mu M fluorescent probe, 1 mu L of 100 g/mu L DNA sample solution and 7.8 mu L of deionized water; the qPCR amplification procedure preferably comprises: pre-denaturation at 95 ℃ for 10 s; denaturation at 95 ℃ for 10s, annealing at 56 ℃ for 15s, and extension at 72 ℃ for 10s for 40 cycles; extending for 3min at 72 ℃, and storing at 4 ℃. In the present invention, the qPCR amplification is performed using a fluorescent quantitative PCR instrument. In the present invention, the Ct value is preferably determined by a standard curve method. Judging whether the plectrus peltatus population exists in the environment according to the Ct value amplified by the DNA sample liquid qPCR; and when the Ct value is less than or equal to 35, judging that the result is positive, namely the plecoglossus group exists in the environment to be detected, and when the Ct value is more than 35, judging that the result is negative, namely the plecoglossus group does not exist in the environment.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1
A method for quickly and efficiently detecting the Pacific saury population comprises the following steps:
1) extracting an eDNA sample of an environment to be detected, wherein the collected sample is bottom sediment (enough, 25mL), and placing the eDNA sample (the bottom sediment sample) in liquid nitrogen for fully grinding: putting 1g of bottom mud sample into a mortar, adding 5-15 mL of liquid nitrogen each time, and grinding the mixture into powder by using a bar mortar;
2) extracting DNA from the pretreated eDNA sample by using a DNA extraction kit, and dissolving the extracted DNA in 100 mu L of water to obtain a DNA sample solution;
3) and (3) carrying out qPCR reaction on the DNA sample solution by adopting a primer group, wherein the primer group comprises an upstream primer SEQ ID NO. 1: 5'-TTGGACTACTTACTGCCTTAGAACT-3', downstream primer SEQ ID NO. 2: 5'-TCCTAGTATATTGGAGAAGTGGTGAAG-3' and the fluorescent probe sequence SEQ ID NO. 3: 5 '-FAM-CCTCCCTAACCGCTAAACAACTCAAACCCT-TAMRA-3';
the reaction system for qPCR amplification is as follows: PremixExTaq10 muL, 10 muM upstream primer SEQ ID NO.1 0.4 muL, 10 muM downstream primer SEQ ID NO.2 0.4 muL, 10 muM fluorescent probe SEQ ID NO.3 0.4 muL and 100 g/muL DNA template solution 1 muL, and deionized water is used to make up to 20 muL;
the qPCR amplification procedure was as follows: pre-denaturation at 95 ℃ for 10s, subsequent denaturation at 95 ℃ for 10s, annealing at 56 ℃ for 15s, extension at 72 ℃ for 10s, performing 40 cycles of denaturation, annealing and extension, finally performing extension at 72 ℃ for 3min, and storing at 4 ℃;
4) and (3) sequencing and detecting the qPCR amplification product, wherein the sequencing result SEQ ID NO.4 is as follows: 5'-TTGGACTACTTACTGCCTTAGAACTAGCCTCCCTAACCGCTAAACAA CTCAAACCCTCACCAAACCTTCCCCTTCACCACTTCTCCAATATACTAG G-3', respectively; and (3) determining the Ct value by adopting a standard curve method, wherein the Ct value is 24.3, the Ct value is positive, and the plecoglossus species survive in the environment.
Example 2
A method for quickly and efficiently detecting the Pacific saury population comprises the following steps:
1) extracting an eDNA sample of an environment to be detected, wherein the collected sample is a water sample (1L), carrying out suction filtration on the water sample, and placing a filter membrane (the diameter is 47mm, and the aperture is 0.45 mu m) obtained after suction filtration of the eDNA sample in alcohol for soaking and storing at-20 ℃ (until the eDNA is extracted);
2) extracting DNA from the pretreated eDNA sample by using a DNA extraction kit, and dissolving the extracted DNA in 100 mu L of water to obtain a DNA sample solution;
3) and (3) carrying out qPCR reaction on the DNA sample solution, wherein the primer group comprises an upstream primer SEQ ID NO. 1: 5'-TTGGACTACTTACTGCCTTAGAACT-3' and the downstream primer SEQ ID NO. 2: 5'-TCCTAGTATATTGGAGAAGTGGTGAAG-3', fluorescent probe SEQ ID NO. 3: 5 '-FAM-CCTCCCTAACCGCTAAACAACTCAAACCCT-TAMRA-3';
the reaction system for qPCR amplification consists of: PremixExTaq 10. mu.L, 10. mu.M upstream primer SEQ ID NO.1 0.4. mu.L, 10. mu.M downstream primer SEQ ID NO.2 0.4. mu.L, 10. mu.M fluorescent probe SEQ ID NO.3 0.4. mu.L and 100 g/. mu.L of DNA template solution 1. mu.L, and make up to 20. mu.L with deionized water.
The qPCR amplification procedure was as follows: pre-denaturation at 95 ℃ for 10s, subsequent denaturation at 95 ℃ for 10s, annealing at 56 ℃ for 15s, extension at 72 ℃ for 10s, performing 40 cycles of denaturation, annealing and extension, finally performing extension at 72 ℃ for 3min, and storing at 4 ℃;
4) and (3) sequencing and detecting the qPCR amplification product, wherein the sequencing result SEQ ID NO.4 is as follows: 5'-TTGGACTACTTACTGCCTTAGAACTAGCCTCCCTAACCGCTAAACAA CTCAAACCCTCACCAAACCTTCCCCTTCACCACTTCTCCAATATACTAG G-3', respectively; and (3) measuring the Ct value, wherein the Ct value is 19.3, and the environment is positive and the pleiones population exists.
Example 3
A method for quickly and efficiently detecting the Pacific saury population comprises the following steps:
1) extracting an eDNA sample of an environment to be detected, wherein the collected sample is a water sample, carrying out suction filtration on the water sample, and placing a filter membrane subjected to suction filtration on the eDNA sample in alcohol for soaking and storing at-20 ℃;
2) carrying out DNA extraction on the soaked eDNA sample by using a DNA extraction kit, and dissolving the extracted DNA in 100 mu L of water to obtain a DNA sample solution;
3) and (3) amplifying the DNA sample solution by using a primer group, wherein the primer group comprises an upstream primer SEQ ID NO. 1: 5'-TTGGACTACTTACTGCCTTAGAACT-3', downstream primer SEQ ID NO. 2: 5'-TCCTAGTATATTGGAGAAGTGGTGAAG-3' and the fluorescent probe sequence SEQ ID NO. 3: 5 '-FAM-CCTCCCTAACCGCTAAACAACTCAAACCCT-TAMRA-3';
the reaction system for qPCR amplification consists of: PremixExTaq10 muL, 10 muM upstream primer SEQ ID NO.1 0.4 muL, 10 muM downstream primer SEQ ID NO.2 0.4 muL, 10 muM fluorescent probe SEQ ID NO.3 0.4 muL and 100 g/muL DNA template solution 1 muL, and deionized water is used to make up to 20 muL;
the qPCR amplification conditions were: pre-denaturation at 95 ℃ for 10s, subsequent denaturation at 95 ℃ for 10s, annealing at 56 ℃ for 15s, extension at 72 ℃ for 10s, performing 40 cycles of denaturation, annealing and extension, finally performing extension at 72 ℃ for 3min, and storing at 4 ℃;
4) and (3) detecting the qPCR amplification product, and determining the Ct value, wherein the Ct value is 38.6, the environment is negative, and the plecoglossus species do not exist in the environment.
The detection sites of the embodiments 1-2 are half-ridge reservoirs in third City in Hainan province, where the plecoglossus altivelis lives, the eDNA sediment sample is collected from the bottom of the reservoir at a depth of 4m, and the eDNA water sample is collected from a water body at a position 1m away from the surface layer; example 3 the detected place is the wharf sea area of west island of san city, and it is determined that the wharf sea area has no existence or pollution of mary fish, and the eDNA water sample is seawater at a water depth of 1 m.
The detection of the embodiments 1 to 3 is carried out for a plurality of times, and finally, the Ct value is detected and the average value is taken after the invalid value is removed.
Therefore, the method disclosed by the invention has high detection accuracy, and can quickly judge whether the mary fish exists at the detection point after the eDNA sample is detected by taking the Ct value 35 as a demarcation point; the method has the advantages of time and labor saving, low cost, high efficiency, no damage to target species or damage to an ecological system of a survey point, high accuracy and high result reliability.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> oceanic college of tropics in Hainan province
<120> primer group, kit and method for detecting plecoglossus pelagi population
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213> Artificial Sequence
<400> 1
ttggactact tactgcctta gaact 25
<210> 2
<211> 27
<212> DNA
<213> Artificial Sequence
<400> 2
tcctagtata ttggagaagt ggtgaag 27
<210> 3
<211> 30
<212> DNA
<213> Artificial Sequence
<400> 3
cctccctaac cgctaaacaa ctcaaaccct 30
<210> 4
<211> 97
<212> DNA
<213> Artificial Sequence
<400> 4
ttggactact tactgcctta gaactagcct ccctaaccgc taaacaactc aaaccctcac 60
caaaccttcc ccttcaccac ttctccaata tactagg 97
Claims (8)
1. A primer group for detecting a population of mary fish (Astrontus ocellatus) is characterized by comprising an upstream primer, a downstream primer and a fluorescent probe; the nucleotide sequence of the upstream primer is shown as SEQ ID No.1, the nucleotide sequence of the downstream primer is shown as SEQ ID No.2, and the nucleotide sequence of the fluorescent probe is shown as SEQ ID No. 3.
2. A kit for detecting a population of Pacific fish, comprising the primer set of claim 1, a DNA extraction reagent, and a qPCR amplification reagent.
3. A method of detecting a population of mary fish, comprising the steps of:
1) collecting an environmental eDNA sample from an environment to be detected,
2) extracting DNA in the environment eDNA sample to obtain a DNA sample solution;
3) and (2) carrying out qPCR amplification by using the DNA sample solution as a template and the primer group according to claim 1, determining the Ct value, determining that the result is positive when the Ct value is less than or equal to 35, namely the plecoglossus altivelis population exists in the environment to be detected, and determining that the result is negative when the Ct value is greater than 35, namely the plecoglossus altivelis population does not exist in the environment.
4. The method of claim 3, wherein the environmental eDNA sample is a water sample or a sediment sample.
5. The method as claimed in claim 4, wherein when the sample of the environmental eDNA is a water sample, the water sample is filtered by a filter membrane, and the filtered filter membrane is soaked in alcohol to extract DNA.
6. The method of claim 4, wherein when the environmental eDNA sample is a sediment sample, DNA is extracted after mixing and grinding the sediment sample with liquid nitrogen.
7. The method according to claim 3, wherein the qPCR amplification system comprises the following components in 20 μ L: PremixExTaq 10. mu.L, 10. mu.M upstream primer 0.4. mu.L, 10. mu.M downstream primer 0.4. mu.L, 10. mu.M fluorescent probe 0.4. mu.L, 100 g/. mu.L DNA sample solution 1. mu.L and deionized water 7.8. mu.L.
8. The method of claim 7, wherein the qPCR amplification procedure comprises: pre-denaturation at 95 ℃ for 10 s; denaturation at 95 ℃ for 10s, annealing at 56 ℃ for 15s, and extension at 72 ℃ for 10s for 40 cycles; extending for 3min at 72 ℃, and storing at 4 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010881847.0A CN111926088B (en) | 2020-08-28 | 2020-08-28 | Primer group, kit and method for detecting salmon population |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010881847.0A CN111926088B (en) | 2020-08-28 | 2020-08-28 | Primer group, kit and method for detecting salmon population |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111926088A true CN111926088A (en) | 2020-11-13 |
| CN111926088B CN111926088B (en) | 2023-06-20 |
Family
ID=73308832
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010881847.0A Active CN111926088B (en) | 2020-08-28 | 2020-08-28 | Primer group, kit and method for detecting salmon population |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111926088B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113832238A (en) * | 2021-10-13 | 2021-12-24 | 中国科学院水生生物研究所 | Primer and probe for detecting environmental DNA of Lasa naked nojirimus fish and application of primer and probe |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104531879A (en) * | 2015-01-06 | 2015-04-22 | 上海海洋大学 | Environment DNA identification method for fish community structure researching |
| US20180100184A1 (en) * | 2016-10-11 | 2018-04-12 | Uvic Industry Partnerships Inc. | Quantitative pcr-based environmental dna assays |
| CN108203735A (en) * | 2017-12-12 | 2018-06-26 | 浙江海洋大学 | A kind of method for rapidly and efficiently detecting Sepiella maindroni population |
| CN109825563A (en) * | 2019-03-21 | 2019-05-31 | 浙江省淡水水产研究所 | A method of Fish Species Diversity is detected based on environment DNA technology |
| JP2020089363A (en) * | 2018-12-07 | 2020-06-11 | 北京▲師▼范大学Ｂｅｉｊｉｎｇ Ｎｏｒｍａｌ Ｕｎｉｖｅｒｓｉｔｙ | Apparatus and method for studying effect of land change on fish diversity based on edna |
| CN111440882A (en) * | 2020-06-02 | 2020-07-24 | 上海海洋大学 | PCR (polymerase chain reaction) amplification primer for identifying Coryngodon dauricus species in North Pacific ocean by environmental DNA (deoxyribonucleic acid) detection as well as detection method and application thereof |
-
2020
- 2020-08-28 CN CN202010881847.0A patent/CN111926088B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104531879A (en) * | 2015-01-06 | 2015-04-22 | 上海海洋大学 | Environment DNA identification method for fish community structure researching |
| US20180100184A1 (en) * | 2016-10-11 | 2018-04-12 | Uvic Industry Partnerships Inc. | Quantitative pcr-based environmental dna assays |
| CN108203735A (en) * | 2017-12-12 | 2018-06-26 | 浙江海洋大学 | A kind of method for rapidly and efficiently detecting Sepiella maindroni population |
| JP2020089363A (en) * | 2018-12-07 | 2020-06-11 | 北京▲師▼范大学Ｂｅｉｊｉｎｇ Ｎｏｒｍａｌ Ｕｎｉｖｅｒｓｉｔｙ | Apparatus and method for studying effect of land change on fish diversity based on edna |
| CN109825563A (en) * | 2019-03-21 | 2019-05-31 | 浙江省淡水水产研究所 | A method of Fish Species Diversity is detected based on environment DNA technology |
| CN111440882A (en) * | 2020-06-02 | 2020-07-24 | 上海海洋大学 | PCR (polymerase chain reaction) amplification primer for identifying Coryngodon dauricus species in North Pacific ocean by environmental DNA (deoxyribonucleic acid) detection as well as detection method and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| MABUCHI,K.等: "Accession NO: NC_009058.1 Astronotus ocellatus mitochondrion, complete genome", GENBANK DATABASE * |
| NAIARA GUIMARÃES SALES等: "Space-time dynamics in monitoring neotropical fish communities using eDNA metabarcoding", BIORXIV, pages 1 - 38 * |
| 魏楠等: "环境DNA在监测表层沉积物中的运用及其与环境变量的关系", 环境工程学报, vol. 14, no. 08, pages 2262 - 2269 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113832238A (en) * | 2021-10-13 | 2021-12-24 | 中国科学院水生生物研究所 | Primer and probe for detecting environmental DNA of Lasa naked nojirimus fish and application of primer and probe |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111926088B (en) | 2023-06-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104531879B (en) | Environment DNA identification method for fish community structure researching | |
| KR101151747B1 (en) | Identifying Method of Marine Species, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same | |
| CN100396794C (en) | Determination primer and method for yellow croaker in different population | |
| CN112176074A (en) | Real-time fluorescent PCR primer probe and method for detecting patinopecten yessoensis | |
| Sana et al. | Phylogenetic and environmental DNA insights into emerging aquatic parasites: implications for risk management | |
| Hou et al. | Formalin-fixed fish larvae could be effectively identified by DNA barcodes: A case study on thousands of specimens in South China Sea | |
| CN111926088A (en) | Primer group, kit and method for detecting plecoglossus altivelis population | |
| Lim et al. | Environmental DNA approach complements social media reports to detect an endangered freshwater stingray species in the wild | |
| CN108456734B (en) | SNP marker related to high alkalinity resistance of litopenaeus vannamei, detection primer and application of SNP marker | |
| Winarni et al. | DNA barcoding of crustacean larvae with two new records of Caridina gracilipes and Ptychognathus altimanus in the western region of Segara Anakan lagoon in Indonesia | |
| CN107365872B (en) | Method for identifying different migration populations of three fishes in seiunhe | |
| CN103911444B (en) | Primer for discriminating anguilla marmorata and anguilla bicolor pacifica fry and method thereof | |
| CN103468806A (en) | Quick detection method for scallop pathogenic vibrio splendidus | |
| CN101886128B (en) | Real-time fluorescence PCR assay kit for Chinese sturgeon and detection method thereof | |
| CN106119377A (en) | A kind of differentiate the primer of snapper, black porgy and filial generation thereof, test kit and discrimination method | |
| CN103555847A (en) | Method for paternity identification of tilapia mossambica | |
| CN108203735A (en) | A kind of method for rapidly and efficiently detecting Sepiella maindroni population | |
| CN104962660B (en) | A kind of mottle clam species real-time fluorescence PCR specific detection system and application | |
| Dixon et al. | Four years of monitoring for viral haemorrhagic septicaemia virus in marine waters around the United Kingdom | |
| Gast et al. | Environmental distribution and persistence of Quahog Parasite Unknown (QPX) | |
| CN111910010B (en) | Primer group, kit and method for detecting ethephon oculata population | |
| Carrasco et al. | Delta de l’Ebre is a natural bay model for Marteilia spp.(Paramyxea) dynamics and life-cycle studies | |
| CN111944910A (en) | Primer group, kit and method for detecting Pink paranieri population | |
| CN107841565A (en) | Differentiate the molecular specificity labeled primers and method of Eriocheir sinensis | |
| CN114752689A (en) | Method for detecting environmental DNA (deoxyribonucleic acid) existing in species under Neolipocarp genus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |