CN108203735A - A kind of method for rapidly and efficiently detecting Sepiella maindroni population - Google Patents
A kind of method for rapidly and efficiently detecting Sepiella maindroni population Download PDFInfo
- Publication number
- CN108203735A CN108203735A CN201711321725.0A CN201711321725A CN108203735A CN 108203735 A CN108203735 A CN 108203735A CN 201711321725 A CN201711321725 A CN 201711321725A CN 108203735 A CN108203735 A CN 108203735A
- Authority
- CN
- China
- Prior art keywords
- sepiella maindroni
- rapidly
- dna
- population
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of methods for rapidly and efficiently detecting Sepiella maindroni population that environment DNA can be taken to be detected Sepiella maindroni population under the premise of not damaging conditions and species population, the eDNA samples sampling of acquisition is taken from soil, silt and water etc., environmental pressure will not be caused to test point, species viability environment will not be adversely affected；Accurately, quickly and efficiently Sepiella maindroni DNA can be detected using special primer and probe, the efficiency and accuracy of detection is improved, reduce testing cost；Utilized field investigation method is detected compared to transmission Sepiella maindroni Species structure, have the advantages that time saving and energy saving, at low cost, efficient and target species will not be hurt or destroy the points for investigation ecosystem.
Description
Technical field
It can be in not damaging conditions the present invention relates to a kind of method for detecting Sepiella maindroni population more particularly to one kind
With the rapidly and efficiently detection Mans needleless crow that environment DNA is taken to be detected Sepiella maindroni population under the premise of species population
The method of crafty population.
Background technology
Sepiella maindroni（Sepiella japonica）It is annual medium-sized cuttlefish.Cephalopoda, Sepiidae.Popular name
Inkfish is cried, growth is fast, and delicious meat is a kind of seafood food being received by the market.Sepiella maindroni mainly divides in China
The Huanghai Sea, Area of The East China Sea are distributed in, for closely migration species.In China coast, Sepiella maindroni is that resource is abundant, yield is fine
A kind of economic siphonopods.Sepiella maindroni whole body is all precious, eats and medical value is all quite high, seventy or eighty years in last century
Generation was once one of China's " four big marine products ".Its annual output up to tens of thousands of tons, wherein to the east of marine products amount be highest, be East Sea fishing
One of main fished species of the people.But overfishing leads to the species resource failure.
The Distribution Pattern and Population Size of Sepiella maindroni population are grasped in time, are species resource protection and two packing spaces
Property protection important content and research premise.Traditional Sepiella maindroni Species structure monitoring, mainly utilizes field investigation method,
Fishery harvesting acquisition is such as carried out with netting gear.With time and effort consuming, of high cost, capture rate is low, may hurt target species or broken
The shortcomings that ecosystem of bad points for investigation.Environment DNA（eDNA）Analysis is a kind of to be combined DNA analysis technology with conventional method
Biological study new tool.This method comes across the eighties in last century earliest.Between 20 years later, with sample,
The breakthrough of the key technologies such as DNA extractions, analysis and sequencing, eDNA analyses develop into complete species distribution detection technique hand
Section.Its application expands to high aquatic or semi-aquatic species identification, population or even biocenological diversity from microbiological analysis
Analysis.Quantitative fluorescent PCR（QuantitativePCR, qPCR）It is specific high, quantitative analysis can be carried out to DNA, in recent years by
Regular-PCR is gradually substituted, becomes the important means of eDNA analyses.The special qPCR amplimers of design inter-species and probe are to use
EDNA analyses carry out the key technology of Sepiella maindroni monitoring resource.
At present, the correlative study about Sepiella maindroni inter-species specificity amplification primer and probe has not been reported.It builds
The qPCR analyses of Sepiella maindroni are erected, realizing simple, quick, accurate, the objective Molecular Identification of Sepiella maindroni is
Carry out Sepiella maindroni eDNA monitoring resource urgent problems at present.
Patent Office of the People's Republic of China disclosed a kind of invention of fluorescent labeling method for inner shell of Sepiella maindroni on June 16th, 2010
Patent application, CN101731162A after application is announced, the invention, as coloring agent, utilize alizarin network using Alizarin complexone
The aqueous solution for closing indicator carries out soaking and dyeing to Sepiella maindroni, provides a kind of method that novel mark is banished, but
It is only capable of to the Sepiella maindroni captured into line flag, can not be to the Sepiella maindroni kind in the natural environment of field
Group is quickly and effectively detected.
Invention content
To solve traditional Sepiella maindroni Species structure monitoring, mainly using field investigation method, such as carried out with netting gear
Fishery harvesting acquires, and has the life that time and effort consuming, of high cost, capture rate is low, may hurt target species or destroy points for investigation
The shortcomings of state system, and quickly had to Sepiella maindroni population not under the premise of not damaging conditions in the prior art
The problems such as imitating the method for detection, the present invention provides one kind to take environment under the premise of not damaging conditions and species population
The method for rapidly and efficiently detecting Sepiella maindroni population that DNA is detected Sepiella maindroni population.
To achieve the above object, the present invention uses following technical scheme.
A kind of method for rapidly and efficiently detecting Sepiella maindroni population, it is described rapidly and efficiently to detect Sepiella maindroni kind
The method of group includes the following steps：
1）The eDNA samples of environment to be detected are extracted, pre-treatment is carried out to sample；
2）EDNA samples Jing Guo pre-treatment are subjected to DNA extractings by DNA extraction agents box, the DNA after extracting is dissolved in 100
DNA sample liquid is obtained in μ L water；
3）To DNA sample liquid, qPCR reactions are carried out using special primer and probe；
4）QPCR amplified productions are sequenced and are detected, measure Ct values, judge result；
The eDNA samples include soil, silt and water.Tradition is substituted using eDNA, field investigation is used to Sepiella maindroni
Method catches the detection of formula, can greatly reduce detection process first to natural environment and detected Sepiella maindroni object
The influence of kind realizes detection to natural environment and the undamaged purpose of species, in addition, field investigation method is acquired with netting gear, it is time-consuming
Arduously, a large amount of human cost is needed, and capture rate is low, testing result reliability is low, and eDNA detections can then avoid this
The problem of class, only need to from natural environment collecting sample in the soil of tested point, silt and water because soil, silt and
The substances such as structural constituent, the secretion of its species of surviving residual is necessarily had in water, can therefrom obtain DNA sample；Using
Special primer and probe can targetedly detect a species to be detected, can greatly improve detection efficiency and inspection
The accuracy of survey reduces follow-up sequencing cost and the required time is sequenced.
Preferably, step 3）Described in special primer be respectively sense primer SEQ ID NO.1：5’-
AGCAGGAACAGGATGAAC-3 ' and downstream primer SEQ ID NO.2：5’-GCCAAATCGACAGAAGGT-3’；The probe
Sequence is SEQ ID NO.3：5’-FAM-CTACCCTCCTTTATCAAGTAACCTCTCAC-TAMRA-3’.Described special draws
Object is a kind of amplimer of inter-species specificity, can realize the specific amplification to Sepiella maindroni, and not by remaining
The influence of nearly edge species, can greatly improve the accuracy of detection and the reliability of result, probe can be provided for subsequent detection
More convenient condition facilitates detection, and can also improve the accuracy of detection and the reliability of result.
Preferably, step 1）Described in eDNA samples be preferably water.Since the solubility of water is bigger, eDNA stablizes
Property it is higher, and can to water sample carry out large volume suction filtration；And soil and silt stability height, the especially soil and silt on surface layer,
Surface deposition has the remaining PCR inhibiting substances of institute, the soil and silt body that single sample can be handled in a large amount of environment in the recent period
Product is also relatively small.Can relatively accurately to reflect the eDNA of test point, water is selected to improving the accuracy detected and knot
The reliability of fruit is advantageous.
Preferably, step 1）Described in pre-treating method fully impregnated for eDNA sample filter membranes are placed in alcohol
It preserves or is placed in liquid nitrogen and be fully ground.Filter membrane can play the role of eDNA acquisition, and alcohol can play certain guarantor
Shield acts on, and alcohol provides the environmental condition of an extremely low water content, can keep DNA integralities in soaking process,
Alcohol can quickly volatilize and follow-up DNA extractings and detection etc. not impacted after the completion of pre-treatment.
Preferably, step 3）Described in probe be fluorescent PCR probe.Fluorescent PCR probe is more enough to carry out extremely conveniently
Detection.
Preferably, step 3）Described in qPCR amplification reaction system composition be：PremixExTaq 10μL、10μM
Sense primer SEQ ID NO.1 0.4 μ L, 10 μM of downstream primer SEQ ID NO.2 is taken to take 0.4 μ L, 10 μM of probe SEQ
ID NO.3 take the 1 μ L of DNA masterplates liquid of 0.4 μ L and 100g/ μ L, and 20 μ L are complemented to using deionized water；
The qPCR amplification conditions are：95 DEG C of pre-degeneration 10s, subsequent 95 DEG C of denaturation 5s, 60 DEG C of annealing 23s, 72 DEG C extend 60s,
Denaturation, annealing and extending carries out 40 cycles altogether, finally carries out 72 DEG C and extends 5min, is preserved under the conditions of 4 DEG C.
Preferably, the qPCR amplifications are reacted using fluorescence quantitative PCR instrument.
Preferably, the step 4）Middle measure Ct values, judge that result is the positive when Ct values are less than or equal to 35, work as Ct
Judgement result is feminine gender when value is more than 35.
The beneficial effects of the invention are as follows：
（1）The present invention provides a kind of methods that can rapidly and efficiently detect Sepiella maindroni population；
（2）It is described rapidly and efficiently detection Sepiella maindroni population method acquired eDNA samples sampling be taken from soil,
Silt and water etc. will not cause environmental pressure to test point, and species viability environment will not be adversely affected；
（3）Accurately, quickly and efficiently Sepiella maindroni DNA can be detected using special primer and probe, carried
The high efficiency and accuracy of detection, reduces testing cost；
（4）Utilized field investigation method is detected compared to transmission Sepiella maindroni Species structure, there is time saving and energy saving, cost
It is low, efficiently and will not hurt target species or destroy the points for investigation ecosystem the advantages of.
Specific embodiment
The invention will be further described with reference to embodiments, but the content of present invention is not limited in any form
System.Obvious described embodiment is only part of the embodiment rather than whole embodiments of the present invention.Based on the implementation in the present invention
Example, those of ordinary skill in the art's all other embodiments obtained without making creative work, belongs to
Protection scope of the present invention.
Embodiment 1
A kind of method for rapidly and efficiently detecting Sepiella maindroni population, the rapidly and efficiently detection Sepiella maindroni population
Method includes the following steps：
1）The eDNA samples of environment to be detected are extracted, institute's collecting sample is soil, pre-treatment is carried out to it, pre-treatment step is will
EDNA samples, which are placed in liquid nitrogen, to be fully ground；
2）EDNA samples Jing Guo pre-treatment are subjected to DNA extractings by DNA extraction agents box, the DNA after extracting is dissolved in 100
DNA sample liquid is obtained in μ L water；
3）To DNA sample liquid, qPCR reactions are carried out using special primer and probe, the special primer is respectively that upstream is drawn
Object SEQ ID NO.1：5 '-CACCAGACATAGCCTTCC-3 ' and downstream primer SEQ ID NO.2：5’-
GCCAGCATGAGATAGATTAC-3’；The probe sequence is SEQ ID NO.3：5’-HEX-
TGTTCATCCAGTTCCAGCACCT-TAMRA-3’；
The reaction system of the qPCR amplifications, which forms, is：10 μ L of PremixExTaq, 10 μM of sense primer SEQ ID NO.1
Take 0.4 μ L, 10 μM of downstream primer SEQ ID NO.2 that 0.4 μ L, 10 μM of probe SEQ ID NO.3 is taken to take 0.4 μ L and 100g/ μ
The 1 μ L of DNA masterplates liquid of L, 20 μ L are complemented to using deionized water；
The qPCR amplification conditions are：95 DEG C of pre-degeneration 10s, subsequent 95 DEG C of denaturation 5s, 60 DEG C of annealing 23s, 72 DEG C extend 60s,
Denaturation, annealing and extending carries out 40 cycles altogether, finally carries out 72 DEG C and extends 5min, is preserved under the conditions of 4 DEG C；
4）QPCR amplified productions are sequenced and are detected, sequencing result SEQ ID NO.4 are：5’-
CACCAGACATAGCCTTCCCTCGAATAAATAATATAAGTTTTTGGTTATTACCTCCATCTTTAACTCTTTTATTATCA
TCCTCAGCTGTAGAAAGAGGTGCTGGAACTGGATGAACAGTATATCCTCCCTTATCTAGTAATCTATCTCATGCTGG
C -3’；Ct values are measured, Ct values are 19, positive, and surviving in the environment has Sepiella maindroni population.
Embodiment 2
A kind of method for rapidly and efficiently detecting Sepiella maindroni population, the rapidly and efficiently detection Sepiella maindroni population
Method includes the following steps：
1）The eDNA samples of environment to be detected are extracted, institute's collecting sample is silt, pre-treatment is carried out to it, pre-treatment step is will
EDNA samples, which are placed in liquid nitrogen, to be fully ground；
2）EDNA samples Jing Guo pre-treatment are subjected to DNA extractings by DNA extraction agents box, the DNA after extracting is dissolved in 100
DNA sample liquid is obtained in μ L water；
3）To DNA sample liquid, qPCR reactions are carried out using special primer and probe, the special primer is respectively that upstream is drawn
Object SEQ ID NO.1：5 '-CACCAGACATAGCCTTCC-3 ' and downstream primer SEQ ID NO.2：5’-
GCCAGCATGAGATAGATTAC-3’；The probe sequence is SEQ ID NO.3：5’-HEX-
TGTTCATCCAGTTCCAGCACCT-TAMRA-3’；
The reaction system of the qPCR amplifications, which forms, is：10 μ L of PremixExTaq, 10 μM of sense primer SEQ ID NO.1
Take 0.4 μ L, 10 μM of downstream primer SEQ ID NO.2 that 0.4 μ L, 10 μM of probe SEQ ID NO.3 is taken to take 0.4 μ L and 100g/ μ
The 1 μ L of DNA masterplates liquid of L, 20 μ L are complemented to using deionized water；
The qPCR amplification conditions are：95 DEG C of pre-degeneration 10s, subsequent 95 DEG C of denaturation 5s, 60 DEG C of annealing 23s, 72 DEG C extend 60s,
Denaturation, annealing and extending carries out 40 cycles altogether, finally carries out 72 DEG C and extends 5min, is preserved under the conditions of 4 DEG C；
4）QPCR amplified productions are sequenced and are detected, sequencing result SEQ ID NO.4 are：5’-
CACCAGACATAGCCTTCCCTCGAATAAATAATATAAGTTTTTGGTTATTACCTCCATCTTTAACTCTTTTATTATCA
TCCTCAGCTGTAGAAAGAGGTGCTGGAACTGGATGAACAGTATATCCTCCCTTATCTAGTAATCTATCTCATGCTGG
C -3’；Ct values are measured, Ct values are 26, positive, and surviving in the environment has Sepiella maindroni population.
Embodiment 3
A kind of method for rapidly and efficiently detecting Sepiella maindroni population, the rapidly and efficiently detection Sepiella maindroni population
Method includes the following steps：
1）The eDNA samples of environment to be detected are extracted, institute's collecting sample is water, pre-treatment is carried out to it, pre-treatment step is will
EDNA sample filter membranes are placed in alcohol fully impregnate and preserve；
2）EDNA samples Jing Guo pre-treatment are subjected to DNA extractings by DNA extraction agents box, the DNA after extracting is dissolved in 100
DNA sample liquid is obtained in μ L water；
3）To DNA sample liquid, qPCR reactions are carried out using special primer and probe, the special primer is respectively that upstream is drawn
Object SEQ ID NO.1：5 '-CACCAGACATAGCCTTCC-3 ' and downstream primer SEQ ID NO.2：5’-
GCCAGCATGAGATAGATTAC-3’；The probe sequence is SEQ ID NO.3：5’-HEX-
TGTTCATCCAGTTCCAGCACCT-TAMRA-3’；
The reaction system of the qPCR amplifications, which forms, is：10 μ L of PremixExTaq, 10 μM of sense primer SEQ ID NO.1
Take 0.4 μ L, 10 μM of downstream primer SEQ ID NO.2 that 0.4 μ L, 10 μM of probe SEQ ID NO.3 is taken to take 0.4 μ L and 100g/ μ
The 1 μ L of DNA masterplates liquid of L, 20 μ L are complemented to using deionized water；
The qPCR amplification conditions are：95 DEG C of pre-degeneration 10s, subsequent 95 DEG C of denaturation 5s, 60 DEG C of annealing 23s, 72 DEG C extend 60s,
Denaturation, annealing and extending carries out 40 cycles altogether, finally carries out 72 DEG C and extends 5min, is preserved under the conditions of 4 DEG C；
4）QPCR amplified productions are sequenced and are detected, sequencing result SEQ ID NO.4 are：5’-
CACCAGACATAGCCTTCCCTCGAATAAATAATATAAGTTTTTGGTTATTACCTCCATCTTTAACTCTTTTATTATCA
TCCTCAGCTGTAGAAAGAGGTGCTGGAACTGGATGAACAGTATATCCTCCCTTATCTAGTAATCTATCTCATGCTGG
C -3’；Ct values are measured, Ct values are 13, positive, and surviving in the environment has Sepiella maindroni population.
Embodiment 4
A kind of method for rapidly and efficiently detecting Sepiella maindroni population, the rapidly and efficiently detection Sepiella maindroni population
Method includes the following steps：
1）The eDNA samples of environment to be detected are extracted, institute's collecting sample is water, pre-treatment is carried out to it, pre-treatment step is will
EDNA sample filter membranes are placed in alcohol fully impregnate and preserve；
2）EDNA samples Jing Guo pre-treatment are subjected to DNA extractings by DNA extraction agents box, the DNA after extracting is dissolved in 100
DNA sample liquid is obtained in μ L water；
3）To DNA sample liquid, qPCR reactions are carried out using special primer and probe, the special primer is respectively that upstream is drawn
Object SEQ ID NO.1：5 '-CACCAGACATAGCCTTCC-3 ' and downstream primer SEQ ID NO.2：5’-
GCCAGCATGAGATAGATTAC-3’；The probe sequence is SEQ ID NO.3：5’-HEX-
TGTTCATCCAGTTCCAGCACCT-TAMRA-3’；
The reaction system of the qPCR amplifications, which forms, is：10 μ L of PremixExTaq, 10 μM of sense primer SEQ ID NO.1
Take 0.4 μ L, 10 μM of downstream primer SEQ ID NO.2 that 0.4 μ L, 10 μM of probe SEQ ID NO.3 is taken to take 0.4 μ L and 100g/ μ
The 1 μ L of DNA masterplates liquid of L, 20 μ L are complemented to using deionized water；
The qPCR amplification conditions are：95 DEG C of pre-degeneration 10s, subsequent 95 DEG C of denaturation 5s, 60 DEG C of annealing 23s, 72 DEG C extend 60s,
Denaturation, annealing and extending carries out 40 cycles altogether, finally carries out 72 DEG C and extends 5min, is preserved under the conditions of 4 DEG C；
4）QPCR amplified productions are detected, measure Ct values, Ct values are 39, negative, and not surviving in the environment has Mans needleless
Cuttlefish population.
Wherein Examples 1 to 3 institute detection site is to confirm that existence has the nearly land-sea domain of Sepiella maindroni, eDNA soil-likes
This acquisition is from nearly land bottom of shallow sea, and eDNA silt samples pick up from the silt layer at coastal waters edge, and it is every that wet dilation falling influences silt layer
It can all be flooded a period of time by seawater, and eDNA water samples pick up from the seawater at nearly mono- meter of Lu Shuishen；
4 detection sites of embodiment are the nearly land-sea domain at a sightseeing tour seabeach, and determine that the nearly land-sea domain does not have Mans needleless
Cuttlefish survives, and eDNA water samples are acquired from the seawater at nearly mono- meter of Lu Shuishen.
Examples 1 to 4 detection carries out repeatedly, is averaged after finally detecting Ct values removal invalid value.
Testing result surface, accuracy in detection is high, is separation with Ct values 35, fast after being detected to eDNA samples
Speed judges whether test point survives and have Sepiella maindroni, with time saving and energy saving, at low cost, efficient and will not hurt object
Kind or destroy the points for investigation ecosystem the advantages of, and detect also have it is at low cost, efficient, accuracy is high and result reliability is high
The advantages of.
Sequence table
<110>Zhejiang Ocean university
<120>A kind of method for rapidly and efficiently detecting Sepiella maindroni population
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213>Sense primer (Forward Primer)
<400> 1
caccagacat agccttcc 18
<210> 2
<211> 20
<212> DNA
<213>Downstream primer (Reverse primer)
<400> 2
gccagcatga gatagattac 20
<210> 3
<211> 22
<212> DNA
<213>Probe (probe)
<400> 3
tgttcatcca gttccagcac ct 22
<210> 4
<211> 155
<212> DNA
<213>Sequencing result (Sequencing results)
<400> 4
caccagacat agccttccct cgaataaata atataagttt ttggttatta cctccatctt 60
taactctttt attatcatcc tcagctgtag aaagaggtgc tggaactgga tgaacagtat 120
atcctccctt atctagtaat ctatctcatg ctggc 155
Claims (8)
- A kind of 1. method for rapidly and efficiently detecting Sepiella maindroni population, which is characterized in that described rapidly and efficiently to detect Mans The method of sepiella maindroni de Rochebrune population includes the following steps：1）The eDNA samples of environment to be detected are extracted, pre-treatment is carried out to sample；2）EDNA samples Jing Guo pre-treatment are subjected to DNA extractings by DNA extraction agents box, the DNA after extracting is dissolved in 100 DNA sample liquid is obtained in μ L water；3）To DNA sample liquid, qPCR reactions are carried out using special primer and probe；4）QPCR amplified productions are sequenced and are detected, measure Ct values, judge result；The eDNA samples include soil, silt and water.
- A kind of 2. method for rapidly and efficiently detecting Sepiella maindroni population according to claim 1, which is characterized in that step Rapid 3）Described in special primer be respectively sense primer SEQ ID NO.1：5 '-CACCAGACATAGCCTTCC-3 ' and downstream Primer SEQ ID NO.2：5’-GCCAGCATGAGATAGATTAC-3’；The probe sequence is SEQ ID NO.3：5’-HEX- TGTTCATCCAGTTCCAGCACCT-TAMRA-3’。
- 3. a kind of method for rapidly and efficiently detecting Sepiella maindroni population according to claim 1 or 2, feature exist In step 1）Described in eDNA samples be preferably water.
- A kind of 4. method for rapidly and efficiently detecting Sepiella maindroni population according to claim 3, which is characterized in that step Rapid 1）Described in pre-treating method be by eDNA sample filter membranes be placed in alcohol carry out fully impregnate preserve or be placed in liquid nitrogen into Row is fully ground.
- 5. a kind of method for rapidly and efficiently detecting Sepiella maindroni population according to claim 1 or 2, feature exist In step 3）Described in probe be fluorescent PCR probe.
- 6. a kind of method for rapidly and efficiently detecting Sepiella maindroni population according to claim 1 or 2, feature exist In step 3）Described in qPCR amplification reaction system composition be：10 μ L of PremixExTaq, 10 μM of sense primer SEQ ID NO.1 take 0.4 μ L, 10 μM of downstream primer SEQ ID NO.2 that 0.4 μ L, 10 μM of probe SEQ ID NO.3 is taken to take 0.4 μ L With the 1 μ L of DNA masterplates liquid of 100g/ μ L, 20 μ L are complemented to using deionized water；The qPCR amplification conditions are：95 DEG C of pre-degeneration 10s, subsequent 95 DEG C of denaturation 5s, 60 DEG C of annealing 23s, 72 DEG C extend 60s, Denaturation, annealing and extending carries out 40 cycles altogether, finally carries out 72 DEG C and extends 5min, is preserved under the conditions of 4 DEG C.
- A kind of 7. method for rapidly and efficiently detecting Sepiella maindroni population according to claim 6, which is characterized in that institute The qPCR amplifications stated are reacted using fluorescence quantitative PCR instrument.
- 8. a kind of method for rapidly and efficiently detecting Sepiella maindroni population according to claim 1 or 2, feature exist In the step 4）Middle measure Ct values, judge that result is the positive when Ct values are less than or equal to 35, judge when Ct values are more than 35 As a result it is feminine gender.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711321725.0A CN108203735A (en) | 2017-12-12 | 2017-12-12 | A kind of method for rapidly and efficiently detecting Sepiella maindroni population |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711321725.0A CN108203735A (en) | 2017-12-12 | 2017-12-12 | A kind of method for rapidly and efficiently detecting Sepiella maindroni population |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108203735A true CN108203735A (en) | 2018-06-26 |
Family
ID=62604746
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711321725.0A Pending CN108203735A (en) | 2017-12-12 | 2017-12-12 | A kind of method for rapidly and efficiently detecting Sepiella maindroni population |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108203735A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111910010A (en) * | 2020-08-28 | 2020-11-10 | 海南热带海洋学院 | Primer group, kit and method for detecting ethephon oculata population |
| CN111926088A (en) * | 2020-08-28 | 2020-11-13 | 海南热带海洋学院 | Primer group, kit and method for detecting plecoglossus altivelis population |
| CN111944910A (en) * | 2020-08-28 | 2020-11-17 | 海南热带海洋学院 | Primer group, kit and method for detecting Pink paranieri population |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013059746A1 (en) * | 2011-10-19 | 2013-04-25 | Nugen Technologies, Inc. | Compositions and methods for directional nucleic acid amplification and sequencing |
| CN103114088A (en) * | 2013-03-06 | 2013-05-22 | 宁波大学 | Sepiella maindroni microsatellite sites and application thereof |
| CN104531879A (en) * | 2015-01-06 | 2015-04-22 | 上海海洋大学 | Environment DNA identification method for fish community structure researching |
| CN105154564A (en) * | 2015-09-30 | 2015-12-16 | 上海海洋大学 | Conjoint analysis method for estimating DNA abundance of fishes based on environment DNA technology |
| KR20170050898A (en) * | 2015-11-02 | 2017-05-11 | 롯데쇼핑주식회사 | Method and kit for identifying species of squids using real-time PCR |
-
2017
- 2017-12-12 CN CN201711321725.0A patent/CN108203735A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013059746A1 (en) * | 2011-10-19 | 2013-04-25 | Nugen Technologies, Inc. | Compositions and methods for directional nucleic acid amplification and sequencing |
| CN103114088A (en) * | 2013-03-06 | 2013-05-22 | 宁波大学 | Sepiella maindroni microsatellite sites and application thereof |
| CN104531879A (en) * | 2015-01-06 | 2015-04-22 | 上海海洋大学 | Environment DNA identification method for fish community structure researching |
| CN105154564A (en) * | 2015-09-30 | 2015-12-16 | 上海海洋大学 | Conjoint analysis method for estimating DNA abundance of fishes based on environment DNA technology |
| KR20170050898A (en) * | 2015-11-02 | 2017-05-11 | 롯데쇼핑주식회사 | Method and kit for identifying species of squids using real-time PCR |
Non-Patent Citations (3)
| Title |
|---|
| TAKUMIYA,M.等: "AB192335.1", 《GENBANK》 * |
| ZHENG,X.D等: "Sepiella maindroni cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial gene for mitochondrial product", 《GENBANK: AF361361.1》 * |
| 姜维等: "以川陕哲罗鲑为目标物种的水样环境DNA 分析流程的优化", 《应用生态学报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111910010A (en) * | 2020-08-28 | 2020-11-10 | 海南热带海洋学院 | Primer group, kit and method for detecting ethephon oculata population |
| CN111926088A (en) * | 2020-08-28 | 2020-11-13 | 海南热带海洋学院 | Primer group, kit and method for detecting plecoglossus altivelis population |
| CN111944910A (en) * | 2020-08-28 | 2020-11-17 | 海南热带海洋学院 | Primer group, kit and method for detecting Pink paranieri population |
| CN111910010B (en) * | 2020-08-28 | 2023-01-03 | 海南热带海洋学院 | Primer group, kit and method for detecting ethephon oculata population |
| CN111926088B (en) * | 2020-08-28 | 2023-06-20 | 海南热带海洋学院 | Primer group, kit and method for detecting salmon population |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Jones | Fifty years of marine mycology | |
| CN108203735A (en) | A kind of method for rapidly and efficiently detecting Sepiella maindroni population | |
| Sano et al. | Visualizing water-conduction pathways of living trees: selection of dyes and tissue preparation methods | |
| Fontes et al. | Tetracapsuloides bryosalmonae abundance in river water | |
| CN111440882A (en) | PCR (polymerase chain reaction) amplification primer for identifying Coryngodon dauricus species in North Pacific ocean by environmental DNA (deoxyribonucleic acid) detection as well as detection method and application thereof | |
| CN105368985A (en) | Prawn TSV and IMNV fluorescent quantitative detection primer, probe and kit | |
| Gimba et al. | Haemoparasites of domestic poultry and wild birds in Selangor, Malaysia | |
| CN105002300B (en) | A kind of fish nervous necrosis virus field fast high-sensitive detection method and kit | |
| CN104232785B (en) | Oriental fruit moth fluorescent light PCR (Polymerase Chain Reaction) detection method and application | |
| CN111926088B (en) | Primer group, kit and method for detecting salmon population | |
| CN107988346A (en) | A kind of method for rapidly and efficiently detecting golden cuttlefish population | |
| CN101878756B (en) | Method for storing monochamus alternatus hope sample and method for quickly detecting bursaphelenchus xylophilus therein | |
| CN112410468A (en) | Special primer, kit and detection method for detecting strawberry mottle virus | |
| Bernhardt et al. | Early detection of salmonid alphavirus in seawater from marine farm sites of Atlantic salmon Salmo salar | |
| Frisch et al. | Herpothallon rubroechinatum (Arthoniaceae), a new species from tropical and subtropical America | |
| Børja et al. | Etiology and real-time polymerase chain reaction-based detection of Gremmeniella-and Phomopsis-associated disease in Norway spruce seedlings | |
| CN105918183A (en) | Living common mussel sex determination and growth restoration method for experiments | |
| CN105675375A (en) | Separating medium of inactivated nematode in dead masson pine wood and separation method and kit | |
| CN102031307B (en) | Kit for detecting virus infecting situation of Chinese giant salamander colony iridovirus by use of ecdysis | |
| CN103468803B (en) | Rapid detection method for aureococcus anophagefferens | |
| CN104818327A (en) | Method for detecting oyster ploidy by using lymphocyte in oyster coelomic fluid | |
| CN101153334B (en) | Rapid sampling method for pine wood nematode molecule detection | |
| Lendemer et al. | Studies in lichens and lichenicolous fungi–no. 17: Notes on lichens from the Coastal Plain of southeastern North America | |
| CN105648053A (en) | Fluorescent quantitative PCR detection method for detecting colonization amount of tobacco anthracnose | |
| Chubb et al. | Schistocephalus cotti n. sp.(Cestoda: Pseudophyllidea) plerocercoids from bullheads Cottus gobio L. in an Arctic river in Finland, with a key to the plerocercoids of the Palaearctic species of the genus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180626 |