CN111926025B - Rescue method of codon-replaced gene VII type newcastle disease virus - Google Patents

Abstract

The invention relates to the technical field of reverse genetic operation, and discloses a rescue method of a gene VII type newcastle disease virus subjected to codon replacement. Cloning NP, P and L genes of newcastle disease virus and DE3 gene expressing T7 RNA polymerase into pXJ vector to obtain plasmid pXJ-40-NP, pXJ40-P, pXJ-L and pXJ40-DE3; cloning the genome-wide cDNA of newcastle disease virus into pBR322 plasmid to obtain pBR322-DHN3; uniformly replacing partial codons of the NP gene coding region with codons with highest use frequency, and replacing the partial codons on the pBR322-DHN3 plasmid to form a new plasmid pBR322-mNPDH 3; BHK-21 cells were co-transfected with the 5 plasmids described above to obtain rescued virus rDHN3-mNP. The method is more beneficial to the rescue of viruses and the research of the pathogenic mechanism of the viruses.

Description

Rescue method of codon-replaced gene VII type newcastle disease virus

Technical Field

The invention relates to the technical field of reverse genetic operation, in particular to a rescue method of a gene VII type newcastle disease virus by codon replacement.

Background

Newcastle disease is a highly contagious, lethal disease, commonly known as fowl plague, caused by Newcastle Disease Virus (NDV) that affects primarily chickens, turkeys, wild birds and ornamental birds. Belongs to the high-contact, acute and virulent infectious diseases. The human is infected occasionally, and conjunctivitis is shown. The world health Organization (OIE) lists it as an infectious disease that must be reported, and the national department of agriculture also lists it as a type of animal epidemic that must be reported. Because of its fast speed of transmission and both morbidity and mortality reaching 100%, once the disease is spread, the poultry industry will be seriously jeopardized, causing immeasurable losses.

According to epidemiological investigation, the prevalent genotype of NDV varies with time and geographic environment. The last century was 20-50 with the main fluid type I-IV, and the first finding in 70 was that type V was mainly in south America and middle America so as to be in full European continents. Type VI appeared in the 80 s and was prevalent in the middle east, asia and europe. Type VII began to spread in 85 years and epidemic in multiple countries worldwide with type VIII and led to pandemics in asia, africa and the middle east in the 90 s. V-VIII type is virulent. Forms IX and X are still limited to local sporadic states. Due to the wide range of applications of vaccines against type IV, type IV NDV has been well controlled. But vaccines against other genotypes are lacking and thus all have a tendency to be popular. Therefore, the rapid development of high-efficiency, broad-spectrum, safe and even multivalent attenuated seedlings aiming at real-time epidemic strains by utilizing the reverse genetic cloning technology is imperative. In addition, epidemic detection is made more difficult by the widespread use of vaccines. Because it is not possible to distinguish whether the infected chicken carries a vaccine strain or a wild strain. An artificial tag can be introduced in a recombination mode, so that the wild virus can be effectively identified.

Newcastle Disease Virus (NDV) belongs to the order of single-stranded negative strand RNAs, genus paramyxoviridae. The virus has a double lipid layer envelope lined with a layer of M protein. The membrane is coated with glycoprotein (HN and F) with fiber to make the appearance of the membrane be flower spike. The capsule contains a long helical nucleocapsid consisting of a capsid protein and a negative strand RNA. Newcastle disease virus has 6 sets of genes for encoding 6 viral proteins, i.e. glycoprotein (HN) with hemagglutinin and neuraminidase activities, glycoprotein (F) with fusion functions, non-glycosylated endomembrane protein (M), nucleocapsid Protein (NP), phosphoprotein (P) and high molecular weight protein (L), respectively. The total length of the NDV gene is 15186nt to 15198nt.

Studies have shown that cloning of cDNA for NDV by artificial mutation, replacement, or insertion of foreign sequences therein does not prevent replication, assembly, and release of the virus. cDNA clones of NDV have been used for basic research and vaccine development. The cDNA clone of NDV can be used as carrier to express antigen protein of other pathogenic bacteria so as to obtain multivalent vaccine for resisting several pathogenic bacteria. The F gene cleavage site is subjected to base mutation to change the La Sota strain attenuated into virulent strain (ref 1) as in Peeteers et al 1999; new strains of different virulence (ref 2) were also obtained by the exchange of HN genes for the strength and attenuated strains in Huang et al 2004. In 2002, the Mebatson et al successfully obtained hybrid virus (ref 3) which is resistant to both NDV and hepatitis virus by substituting the dominant epitope of NP protein of NDV with the S2 glycoprotein epitope gene of hepatitis virus; in 2006, man et al succeeded in obtaining hybrid viruses (ref 4) resistant to both NDV and H7 avian influenza virus by inserting the HA gene of H7 avian influenza virus between the P-M genes of the NDV B1 strain. Recently Abzeid et al successfully assembled the currently prevailing IBV S protein in egypt into recombinant NDV, resulting in a hybrid virus that was immunoprotected against both the original NDV and the corresponding IBV (ref 5). Chinese scholars also use LaSota strain as carrier to obtain several heterozygous viruses with bivalent function. Such as against both NDV and IBDV5 hybrid viruses (ref 6); hybrid virus against both NDV and H5N1 (ref 7); hybrid virus against both NDV and mycoplasma gallisepticum TM1 virus (ref 8). Since NDV has only one serotype, its genetic properties are relatively stable. Although infectious cDNA clones of NDV have been established internationally, the country is essentially limited to Latasa strain and is essentially limited to basic and clinical research.

In many scientific researches, HN genes and F genes closely related to the pathogenicity of NDV are deeply researched. However, there have been many studies on the functional role of the NP gene of NDV. In NDV, the NP gene is the nucleocapsid protein of the virus, closely related to replication and expression of NDV virus. Since the NP gene is involved in the assembly of virus particles in the most abundant protein, the normal replication and expression of the NP gene is significant for replication and propagation of NDV virus, and once the replication and expression of the NP gene are fast or slow, it is a problem to be examined what effect is exerted on the whole virus of NDV.

In the existing virus rescue scheme of NDV, simple splicing of genome is mostly used, a spliced product is transcribed into RNA in vitro, and then RNA of the transcribed product is transfected into cells by means of electrotransformation or liposome and the like to rescue the virus. This approach may result in: (1) A large amount of plasmids are extracted for each time of virus rescue, then enzyme digestion and splicing are carried out to obtain a full-length genome of the virus, and the enzyme digestion and connection mode is time-consuming and labor-consuming, and can possibly generate certain base deletion, so that the virus cannot be obtained finally. (2) The full-length in vitro transcription of the spliced viral genome cannot completely simulate the environment into an intracellular environment in the in vitro transcription process, and even if the transcription product is transfected into cells again, the working efficiency of the secondary transcription product cannot be estimated. In addition, DNA is extremely unstable after being transcribed into RNA in vitro, is easy to degrade and mutate, and greatly reduces the rescue efficiency of viruses. In addition, most of the existing NDV rescue protocols are infected with fowlpox virus, thereby expressing T7RNA Polymerase, i.e., T7RNA Polymerase, in cells to aid in virus rescue. However, this method has a disadvantage in that the virus of the fowl pox virus exists in cells at the same time, and it takes a lot of time to purify the virus even if the virus is successfully rescued in the latter stage.

The NP gene is the first gene encoded by the 3' end of the NDV genome, and the translation rate of the NP gene directly affects the translation efficiency of the following genes. The invention counts the use frequency of codons in the coding region of the NP gene, unifies the codons coding the same amino acid into one codon, thereby reducing the use quantity of the codons to the minimum in the NP gene translation process and changing the translation speed of the NDV.

Disclosure of Invention

Aiming at the defects and shortcomings of the prior art, the invention aims to provide a reconstruction and rescue method of a gene VII type Newcastle disease virus subjected to codon substitution. The method of the invention integrates the genome of the virus into the pBR322 plasmid, and the plasmid integrated with the whole genome of the virus is proved to be capable of stably replicating and expressing. Thus, the complicated work of in vitro splicing is omitted and the possibility of base deletion is greatly reduced. And T7RNA polymerase can be expressed in cells by constructed plasmid pXJ-DE 3 to help rescue viruses. Thus, no infection with the fowlpox virus is required, and a considerable amount of time and experience in the removal of the fowlpox virus is also saved in the later stages. And the codon type of the NP gene used in the translation process is reduced to the minimum by counting the use frequency of each amino acid codon of the NP gene coding region in the NDV genome and uniformly replacing part of the codons of the NP gene coding region with the codons with the highest use frequency of the region. This approach has two advantages: 1. avoiding the virus rescue caused by too large variation of the components of the viral genome as much as possible. 2. Under the condition that the expression of the viral protein is unchanged, the use of certain codons is reduced, and the translation speed of the virus is changed.

In order to achieve the above purpose, the present invention provides the following technical solutions:

a rescue method of a codon-replaced gene VII type newcastle disease virus comprises the following steps:

(1) Cloning NP gene, P gene and L gene of newcastle disease virus into pXJ vector to obtain auxiliary plasmids pXJ-NP, pXJ40-P and pXJ-L;

(2) Cloning a DE3 gene capable of expressing T7RNA polymerase in cells into a pXJ vector to obtain plasmid pXJ-DE 3;

(3) Cloning the whole genome of newcastle disease virus into a plasmid pBR322-Base to obtain a whole genome expression vector pBR322-DHN3;

(4) Counting the use frequency of each codon in the NPs of the newcastle disease viruses, uniformly replacing partial region codons of the coding region of the NPs with codons with highest use frequency to obtain a replaced NPs gene sequence, and replacing the replaced NPs gene sequence on a pBR322-DHN3 plasmid to form a new plasmid pBR322-mNPDH 3;

(5) The three helper plasmids pXJ-NP, pXJ40-P and pXJ-L of step (1) are adopted, and the plasmid pXJ-DE 3 of step (2) and the plasmid pBR322-mNPDH 3 of step (4) are used for cotransfecting BHK-21 cells, so that the rescued virus rDHN3-mNP is obtained.

Further, the newcastle disease virus is a gene VII type newcastle disease virus, and the whole genome sequence of the newcastle disease virus is shown in a sequence table SEQ ID NO:1, a step of; NP gene is shown in SEQ ID NO: 1-1591nt; the P gene is shown in a sequence table SEQ ID NO:1 is 1925-3109nt; the L gene is shown in a sequence table SEQ ID NO: positions 8166-15192nt in 1.

The vector plasmid pXJ used in the present invention is a very widely used vector plasmid with abundant cleavage sites, and pXJ is employed in the construction of a large number of plasmids. The vector plasmid pXJ used in the present invention originates from the Proc. Huanan agricultural university, proc. Group microorganism center Liu Dingxiang, which is published in patent CN 110592108A as a schematic, sequence listing and corresponding source of preparation.

Further, the helper plasmid pXJ-NP, pXJ40-P was obtained by the following method:

(1) The pXJ plasmid was double digested with EcoRI and XhoI, and the excised fragments were used as plasmid fragments for construction of pXJ-NP and pXJ-P;

(2) The NP gene was amplified using primers pXJ40-NP-F and pXJ-NP-R, the P gene was amplified using primers pXJ40-P-F and pXJ40-P-R, and then the amplified product was double digested with EcoRI and XhoI;

(3) The plasmid fragment in the step (1) is respectively connected with the NP gene and the P gene after enzyme digestion in the step (2) to obtain auxiliary plasmids pXJ-NP and pXJ-P;

the two pairs of primer sequences were as follows:

pXJ40-NP-F：ACCGGAATTCGCCACCATGTCGTCTGTTTTTGACGAATACGAGC；

pXJ40-NP-R：ATATCTCGAGTCAGTACCCCCAGTCAGTGTCG；

pXJ40-P-F：ATATGAATTCGCCACCATGGCTACCTTTACAGATGCGGAG；

pXJ40-P-R：TATACTCGAGTCAACCATTCAGCGCAAGG。

further, the helper plasmid pXJ-L was obtained by the following method:

(1) The pXJ plasmid was double digested with BamHI and PstI, and the excised fragment was used as a plasmid fragment for construction pXJ-L;

(2) Designing four pairs of specific primers with homologous recombination sequences, and respectively amplifying gene fragments L1, L2, L3 and L4 covering the complete sequence of the L gene, wherein the 5 '-end of the fragment L1 is provided with a homology arm homologous to the pXJ BamHI end, and the 3' -end of the fragment L4 is provided with a homology arm homologous to the pXJ PstI end;

(3) Adding the L1, L2, L3 and L4 gene fragments in the step (2) and the vector pXJ plasmid fragments after double enzyme digestion in the step (1) together, and carrying out homologous recombination under the action of recombinase to obtain an auxiliary plasmid pXJ-L;

the L1 gene is shown in a sequence table SEQ ID NO:1 is 8166-10709nt; the L2 gene is shown in a sequence table SEQ ID NO:1 is 10174-12299nt; the L3 gene is shown in a sequence table SEQ ID NO: position 12238-14433nt; the L4 gene is shown in a sequence table SEQ ID NO:1 are positioned 14214-15192nt;

the four pairs of specific primer sequences with homologous recombination sequences are respectively as follows:

pXJ40-L1-F：5’-ACTCACTATAGGGCGAATTCGGATCCGGATGGTTGGGAGGACGACATTG-3’；

pXJ40-L1-R：5’-GGACAGTTGACTCATTGCTAACATA-3’；

pXJ40-L2-F：5’-TATGTTAGCAATGAGTCAACTGTCC-3’；

pXJ40-L2-R：5’-GTGAATGTAAGGCGACACTCTGTAG-3’；

pXJ40-L3-F：5’-CTACAGAGTGTCGCCTTACATTCAC-3’；

pXJ40-L3-R：5’-CGAATATCAGGTAACACTCCATATC-3’；

pXJ40-L4-F：5’-GATATGGAGTGTTACCTGATATTCG-3’；

pXJ40-l4-R：5’-TAAGATCTGGTACCGAGCTCCTGCAGGCGCACCAAACAGAGATTTGGT-3’。

further, the plasmid pXJ-DE 3 is obtained by the following method:

(1) The pXJ plasmid was double digested with BamHI and PstI, and the excised fragment was used as a plasmid fragment for construction pXJ-DE 3;

(2) Primers pXJ-DE 3-F and pXJ-DE 3-R were designed to amplify a gene sequence DE3 capable of expressing T7RNA polymerase from E.coli BL 21;

(3) Homologous recombination is carried out on the plasmid fragment cut out in the step (1) and the DE3 gene in the step (2) under the action of recombinase to obtain plasmid pXJ-DE 3;

the primer sequences are as follows:

pXJ40-DE3-F：ACTCACTATAGGGCGAATTCGGATCCGCCATGAACACGATTAACATCGC；

pXJ40-DE3-R：TAAGATCTGGTACCGAGCTCCTGCAGTTACGCGAACGCGAAGTCCGACTC；

the sequence of the DE3 gene is shown in a sequence table SEQ ID NO:32.

further, the whole genome expression vector pBR322-DHN3 is obtained by the following method:

(1) Establishment of pBR322-Base vector: artificially synthesizing a gene fragment containing HC-1, a T7 promoter, HDV ribozyme, a T7 terminator and HC-2, and inserting the gene fragment into a pBR322 plasmid to obtain a basic plasmid pBR322-Base; the sequence HC-1 downstream of the T7 promoter corresponds to the sequence table SEQ ID NO:1 is 15159-15192nt, the sequence HC-2 upstream of the HDV ribozyme corresponds to the sequence table SEQ ID NO:1 is 1-141nt to provide two homology arms required for recombination;

(2) Constructing a transition carrier: the transition vector is plasmid pBR322-PNP, plasmid pBR322-PDP, plasmid pBR322-LPD3; the plasmid pBR322-PNP is composed of a segment NP, MINI, P; the plasmid pBR322-PDP is composed of fragments P, PD, PD2 and PD3; the plasmid pBR322-LPD3 is composed of fragments PD3, L1, L2, L3 and L4;

(3) Construction of viral whole genome DHN3-a: the plasmid pBR322-PNP, the plasmid pBR322-PDP and the plasmid pBR322-LPD3 are subjected to enzyme digestion to obtain fragments PNP, PDP and LPD3, and the fragments PNP, PDP and LPD3 are connected through T4 ligase to obtain virus whole genome DHN3-A;

(4) Construction of plasmid fragments with homology arms: amplifying by using the pBR322-Base vector in the step (1) as a template and using primers A2-F and A2-R containing homology arms to obtain plasmid fragments with homology arms;

the primer sequences are as follows:

A2-F:ATCGGTAGAAGGTTCCCTCAGGTTC；

A2-R:GGTCCTATAGTGAGTCGTATTAATG；

(5) Constructing a whole genome expression vector pBR322-DHN3; carrying out homologous recombination on the plasmid fragment in the step (4) and the viral whole genome DHN3-A in the step (3) to obtain a whole genome expression vector pBR322-DHN3;

the MINI gene is shown in a sequence table SEQ ID NO: the position in 1 is 1414-1949nt; PD1 gene is shown in a sequence table SEQ ID NO: positions 2935-4956nt in 1; PD2 gene is shown in a sequence table SEQ ID NO:1 at 4838-6454nt; PD3 gene is shown in a sequence table SEQ ID NO: the position in 1 is 6261-8283nt; the L1 gene is shown in a sequence table SEQ ID NO:1 is 8166-10709nt; the L2 gene is shown in a sequence table SEQ ID NO:1 is 10174-12299nt; the L3 gene is shown in a sequence table SEQ ID NO: position 12238-14433nt; the L4 gene is shown in a sequence table SEQ ID NO:1 are located 14214-15192nt.

Further, the partial substitution in the step (4) refers to substitution of amino acids 1-245 of the NP gene coding region, which is 735nt, corresponding to the sequence table SEQ ID NO: positions 1 are 122-856nt. To avoid that the virus cannot be effectively rescued due to too large a change in gene sequence.

Further, in the partial replacement process described in step (4), if a new start codon is generated in the sequence near the start coding region after replacement, the replacement is not performed to avoid encoding an unexpected polypeptide, thereby altering the virus characteristics.

Further, the step (4) of replacing the replaced NP gene sequence on the pBR322-DHN3 plasmid is as follows:

(1) The pBR322-DHN3 is digested with BsiWI and XbaI to recover the target fragment;

(2) Artificially synthesizing a fragment containing the sequence between the replaced NP gene sequence and the BsiWI and XbaI double cleavage sites;

(3) And (3) connecting the target fragment in the step (1) with the fragment synthesized in the step (2) to obtain the pBR322-mNPDHN3 plasmid.

Compared with the prior art, the invention has the beneficial effects that:

(1) The scheme of the invention integrates the genome of the virus into the pBR322 plasmid, and the plasmid integrated with the whole genome of the virus can be proved to be stably replicated and expressed. Thus, the complicated work of in vitro splicing is omitted and the possibility of base deletion is greatly reduced.

(2) The plasmid pXJ-DE 3 constructed in the invention can express T7 RNA polymerase in cells to help rescue viruses. Thus, no infection with the fowlpox virus is required, and a considerable amount of time and experience in the removal of the fowlpox virus is also saved in the later stages.

(3) The plasmid cotransfection method for rescuing viruses adopted by the invention only needs one transfection, has small damage to cells, quick disease change and high rescuing efficiency.

(4) The codon substitution mode applied by the invention is 'parent' virus itself rather than 'parent' certain cell, and the substitution mode is based on the characteristics of the virus itself, thereby being more beneficial to the rescue of the virus and the research of the virus function.

(5) The method of the invention counts the using frequency of codons of each amino acid in the NP gene coding region of the DHN3 genome, and then uniformly replaces partial regional codons of the NP gene coding region with codons with highest using frequency. This approach has two advantages: 1. avoiding the original amino acid sequence of the virus genome from being changed as much as possible so as to avoid the rescue of the virus. 2. In the case of unchanged viral protein composition, the codon sequence was changed and its effect on viral replication and host was observed.

Drawings

FIG. 1 is a graph showing the results of the extraction of RNA from a disease agent in the examples.

FIG. 2 is a graph showing the results of the experimental strain virus infection of BHK-21 cells after purification in the example.

FIG. 3 is a schematic diagram of the structure of the sequencing primer in the example to divide the DHN3 genome into 10 parts.

FIG. 4 is a graph showing the comparison of DHN3 with the published NDV sequence evolutionary tree at NCBI in the examples.

FIG. 5 is a schematic diagram of the structure of a double restriction pXJ plasmid using EcoRI and XhoI in the examples.

FIGS. 6 and 7 are schematic diagrams of plasmids pXJ-NP and pXJ-40-P, respectively, in examples.

FIGS. 8 and 9 show the PCR characterization of the pXJ-DE 3 plasmid of the example (Marker: 5000bp, target fragment 2743 bp) and the cleavage characterization (Marker: 5000bp, target fragment 4264bp,2671 bp).

FIG. 10 is a schematic representation of the plasmids of pXJ40-DE3 obtained in the examples.

FIG. 11 is a graph showing the results of PCR identification of pXJ-L obtained in the examples.

FIG. 12 is a graph showing the results of PstI cleavage assay of pXJ-L obtained in the examples.

FIG. 13 is a schematic diagram of a plasmid pXJ-L obtained in example.

FIG. 14 is a schematic diagram showing the structure of BtgZI dividing DHN3 into 3 parts in the embodiment.

FIG. 15 is a schematic representation of the double digested plasmid pBR322 using HindIII and NheI as examples.

FIGS. 16 to 18 are schematic diagrams of plasmids pBR322-PNP, pBR322-PDP and pBR322-LPD3, respectively, in examples.

FIG. 19 is a schematic diagram of the plasmid pBR322-Base in the examples.

FIG. 20 is a schematic diagram of the DHN3 genome design of an embodiment.

FIG. 21 is a diagram showing the result of PCR identification of pBR322-DHN3 plasmid-positive bacteria in the example (Marker: 2000bp; primer C-pBR322-R/C-NP-F; target fragment 1698 bp).

FIG. 22 is a diagram showing the results of SacI cleavage assay for the A1 plasmid of positive bacteria by pBR322-DHN3 PCR in the examples (Marker: 8000bp; target fragment: 8482bp,7065bp,3132bp, 328 bp,32 bp).

FIG. 23 is a schematic diagram of the plasmid pBR322-DHN3 in the examples.

FIG. 24 is a graph showing the results of infection of BHK-21 cells with the virus liquid rDHN3-mNP-P1 in examples.

FIG. 25 is a diagram showing the results of comparing the coding region 1-45nt of the NP gene with the sequences two and three 1-45nt after codon substitution in the examples.

FIG. 26 is a schematic representation of the position of the synthetic sequence to be replaced on pBR322-DHN3 in the examples.

FIG. 27 is a diagram showing the results of the XbaI/HindIII double cleavage assay (Marker: 4500bp, objective fragments 1440bp,2673 bp) after cloning the synthetic sequence into the plasmid pUC57 in the examples.

FIG. 28 is a schematic diagram of the plasmid Y0016495-1 in the examples.

FIG. 29 is a diagram showing the identification of plasmid pBR322-mNPDH 3 by SacI cleavage in the examples (Marker: 1kb; target fragment: 8482bp,7065bp,3132bp, 328 bp,32 bp).

FIG. 30 is a schematic diagram of a plasmid of pBR322-mNPDHN3 in the examples.

FIG. 31 is a graph showing cytopathic results obtained 2 days after rescue of the virus rDHN3-mNP on BHK-21 cells in the example.

FIG. 32 is a diagram showing the results of sequencing NP and F genes of tenth-generation rDHN3-mNP in examples.

FIG. 33 is a graph showing TCID50 of each strain of NDV (DHN 3, rDHN 3-mNP) obtained in the examples at different time points.

Detailed Description

The following describes the embodiments of the present invention in further detail with reference to examples and drawings, but the embodiments of the present invention are not limited thereto. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Examples

The main instruments and reagents used in this example are as follows:

THZ-100 type electrothermal constant temperature incubator is purchased from Shanghai-Heng science instruments Co., ltd; a17105653 clean bench from the air technologies company, antai, su; DK-8D three-hole electrothermal thermostatic water tank is purchased from Shanghai-Heng science instruments Co., ltd; THZ-100 constant temperature incubator was purchased from Shanghai-Heng science instruments Co., ltd; BCD-579WE sea refrigerator was purchased from hal; 5424R type centrifuge, eppendorf PCR instrument, thermo1300SERIES A2 biosafety cabinet, all purchased from Eppendorf.

DNA/RNA Co-extraction kit (AP-MN-BF-VNA-250G) was purchased from AXYGEN; TIAN prep Mini Plasmid Kit (DP 103-03) is available from Tiangen Biochemical technologies (Beijing); gel Extraction Kit (D2500-02) from OMEGA; M-MLVRT (2641A) is purchased from TAKARA; RRI (2313A) is purchased from TAKARA; random 6primer (3801) was purchased from TAKARA; agarose (E0301) is purchased from TSINGK;0.25% Trypsin-EDTA (25200-056), DMEM basic (C11995500 BT) available from Gibco; lipofectamine LTX and Plus Reagent (15338-100) from Invitrogen; FBS (10099-141C) was purchased from Gibco; premix-Taq (RR 902A) was purchased from TAKARA; pen Strep penicillin Streptomycin (15140-122) from Gibco; primer star GXL (R050) was purchased from TAKARA; btgZ1 (R0703S), T4DNA Ligase (M0202M) from NEB; other restriction endonucleases and ligases were all purchased from TAKARA; clonExpress Multis One Step Cloning Kit (C113) was purchased from Norwezan.

The method for rescuing the newcastle disease virus through codon optimization in the embodiment comprises the following steps:

1. selection, identification and purification of experimental strain virus

1.1 Selection and identification of experimental strain viruses

A chicken dying after a certain chicken farm in Guangdong is obtained, one example of sleepiness, listlessness and yellow green thin feces are removed, the viscera of the chicken are cut, the liver is milled and then is extracted to obtain disease RNA, a specific primer (JF-F: CCTTGCAGCTGCAGGAATTG, (SEQ ID NO: 2); JF-R: GCTCTATACAGTATGAGGTGTCAAG, (SEQ ID NO: 3); product length: 913 bp) is used for testing, and the result is initially identified as NDV (the identification result is shown in figure 1; M:2000bp marker;1: duck viral hepatitis; 2: infectious bronchitis; 3: infectious bursitis, 4: newcastle disease; 5: avian leukemia; 6: avian influenza).

1.2 Purification of test plants

Adding proper amount of physiological saline into the rest disease materials, grinding fully, filtering the mixed solution through a 0.4 mu m filter, adding 1% double antibody into the filtrate, inoculating into chick embryo chorioallantoic cavities, adding 100 mu l each piece, and collecting embryos after 48 hours. The allantoic fluid harvested for the first time is diluted 1000 times and is continued to be toxic. Double antibodies are not added in the continuous breeding process, (original toxin is not diluted for the first time) and allantoic fluid is harvested after the chick embryo dies. The allantoic fluid harvested from the second toxin propagation was diluted 1000-fold and inoculated at 100ul per embryo. Repeatedly blind transferring for three times according to the method, collecting allantoic fluid as poison seed, and preserving at-20deg.C.

The blinded virus was plaque purified on BHK-21 cells and the purified virus was designated DHN3. The specific operation is as follows:

preparing 3% agarose solution by double distilled water, and standing at 4deg.C for use. Before use, the agarose solution is melted by heating for 2-3 minutes with a microwave oven and prepared into agarose solution according to 3% agarose (2 ml) +2% FBS DMEM (24 ml), and the agarose solution is placed in a dry bath at 40 ℃ for later use. 2% FBS+DMEM+1% SP antibiotic broth was prepared for use. The DMEM culture solution for the third generation allantoic fluid virus obtained after repeated virus propagation is prepared according to the following ratio of 1:10 are diluted into 6 gradients to prepare the infection liquid 10 ^-1 ，10 ^-2 ，10 ^-3 ，10 ^-4 ，10 ^-5 ，10 ^-6 And (5) standby. BHK-21 cells were cultured in 6-well plates, washed three times with PBS after the cells had grown to 90%, and then 200. Mu.l of the above-mentioned infection solution was added, and 800. Mu.l of DMEM medium was additionally added to make the final volume of each well 1ml. The mixture was gently shaken and incubated at 37℃for 2h. The incubation was discarded, washed three times with PBS, the washing solution was discarded, and 2.5ml of agarose solution was added to each well. Plaques were observed after 4-6 days. One plaque of uniform size was selected to re-infect BHK-21 cells, and the results are shown in FIG. 2, the cells were repeatedly freeze-thawed three times after complete lesions of the cells, the virus was harvested, and the harvested virus was designated DHN3.

2. Whole genome sequencing of experimental strain virus

2.1 The experimental strain virus is unevenly divided into 10 fragments for amplification:

the RNA of the purified virus DHN3 was extracted and reverse transcribed with a non-specific primer (Random 6primer (3801)) to obtain a first cDNA. Then uses the cDNA as template and uses specific primer and Ex Taq enzyme as PCR amplification. These specific primers (downloading published NDV viral gene sequences from NCBI, selecting their homology region design primers to amplify DHN3 genomic sequences) were 10 pairs in total, and the DHN3 viral genome was divided into 10 parts unevenly (as shown in fig. 3), and the fragments amplified by these 10 pairs of primers were designated as: NP, MINI, P, PD1, PD2, PD3, L1, L2, L3, L4. The 10 pairs of amplified fragments were recovered by agarose gel electrophoresis, and the recovered fragments were ligated with pMD19 vector and sequenced. (the plasmid names and the corresponding primer sequences and amplified fragment sizes of the respective parts are shown in Table 1; the plasmid names and the amplification reaction conditions thereof and the positions of the amplified fragments in the DHN3 genome are shown in Table 2).

TABLE 1 DHN3 Whole-gene amplification primers

TABLE 2 reaction procedure for DHN3 Total Gene amplification of fragments

The sequencing result is compared with all published NDV sequences through NCBI Blast software (as shown in figure 4), the result shows that the full length 15192nt of the DHN3 whole genome is shown, and the corresponding sequence table is shown in SEQ ID NO:1, belonging to class II VII type NDV.

To ensure that the sequences were correct, the above experiments were repeated 3 times from viral infection to analysis of sequencing results. The sequencing results were identical, confirming that a purified strain of DHN3 virus was obtained from this plaque.

3. Construction of helper plasmid pXJ-NP, pXJ40-P, pXJ-40-L and plasmid pXJ-DE 3

Next, the reason for constructing helper plasmids pXJ-NP, pXJ40-P, pXJ-L, and plasmid pXJ-DE 3 expressing T7RNA Polymerase will be described.

Ndv is a negative-strand RNA virus whose genome is not capable of replication and proliferation under the action of host enzymes, unlike the genome of a positive-strand RNA virus. Negative-strand RNA viruses require the assistance of helper proteins to initiate transcription and translation after entering host cells, so that in reverse genetics rescue of the virus, a plasmid capable of expressing the proteins needs to be constructed in advance. For NDV, its accessory protein is NP protein, P protein, L protein.

Transcription of DNA into RNA, which is then translated into polypeptides. When reverse genetics virus rescue is carried out, circular plasmid DNA is transfected into cells, circular DNA plasmids are transcribed into RNA in the cells, and active virus particles capable of replicating and proliferating in a host system are formed with the help of auxiliary proteins. We have added to the plasmid pBR322-DHN3 containing the DHN3 genome a T7 promoter to initiate transcription (the specific composition of plasmid pBR322-DHN3 will be described in detail below), which T7 promoter requires the action of a T7RNA polymerase to initiate transcription. We have thus constructed a plasmid pXJ-DE 3 which is capable of expressing T7RNA polymerase.

Cloning NP, P, and L genes into pXJ vector to obtain helper plasmids pXJ-NP, pXJ40-P, and pXJ-L, respectively. The pXJ plasmid contains the CMV promoter and T7 promoter and the SV40 polyadenylation A fragment, so that the foreign gene can be efficiently transcribed by the cellular DNA polymerase II or T7RNA polymerase and then translated into the proteins NP, P, and L for assembly of the active virion.

3.1 Construction of pXJ-NP, pXJ40-P plasmid

3.1.1 The EcoRI and XhoI double digested pXJ plasmid (shown in FIG. 5) was used and the excised fragment (4288 bp) was used as a plasmid fragment for construction of pXJ-40-NP, pXJ 40-P.

3.1.2 NP fragments were amplified using pXJ-NP-F/pXJ-NP-R (R050, annealing temperature at 60 ℃,1min30s extension time). The P gene was amplified using pXJ-P-F/pXJ-P-R (R050, annealed 60 ℃, extension 1min15 s). The primer pXJ-NP-F and the primer pXJ-P-R in the two pairs of primers for amplifying the NP and P genes already contain EcoRI enzyme cutting sequences; primer pXJ-NP-R and primer pXJ-P-R already contain the XhoI sequence. Thus, the NP and P genes were amplified using these two pairs of primers, respectively, and the amplified products contained EcoRI and XhoI cleavage sites at both ends, respectively. The products amplified using these two pairs of primers were digested with EcoRI and XhoI, so that the digested products contained cohesive ends of EcoRI and XhoI. The corresponding plasmids, templates and primer correspondence table are shown in Table 3.

3.1.3 The plasmid fragment prepared in 3.1.1 is respectively connected with NP and P fragments after digestion of EcoRI and XhoI and is transformed into DH5 alpha, and the selection is verified. Thus, plasmids pXJ-NP and pXJ40-P (pXJ-NP and pXJ40-P were constructed as shown in FIGS. 6 and 7).

Table 4 shows the cleavage process of the plasmid pXJ and the cleavage process of the amplified products of the NP and P genes. Table 5 shows the ligation of the cleavage products of the NP and P genes and the cleavage product of the pXJ plasmid. It should be noted that the PCR products and cleavage products of NP and P genes and the cleavage products of the pXJ plasmid were recovered by agarose electrophoresis and then subjected to the next step.

TABLE 3 construction of primers for plasmids pXJ40-P, pXJ40-NP

TABLE 4 Table of parameters of cleavage process of amplified products of plasmid pXJ and NP and P genes

TABLE 5 plasmid pXJ-NP, pXJ40-P ligation System

3.2 Construction of plasmid pXJ-DE 3

3.2.1 Design of primers to amplify the DE3 fragment

As far as E.coli BL21 is known to express T7 RNA polymerase, the primers pXJ-DE 3-F and pXJ-DE 3-R were designed to amplify the sequences capable of expressing T7 RNA polymerase (pXJ-DE 3-F: ACTCACTATAGGGCGAATTCGGATCCGCCATGAACACGATTAACATCGC, (SEQ ID NO: 30); pXJ-DE 3-R: TAAGATCTGGTACCGAGCTCCTGCAGTTACGCGAACGCGAAGTCCGACTC, (SEQ ID NO: 31)). A gene sequence capable of expressing T7 RNA Polymerase (the gene is abbreviated as DE3 and the corresponding gene sequence is shown as SEQ ID NO: 32) is amplified from escherichia coli BL21 by using the primers, and the amplified fragment is inserted into a plasmid pXJ by using a homologous recombination method. The amplification of the DE3 fragment uses GXL enzyme (R050), the annealing temperature is 60 ℃, the extension time is 2min36s, and the fragment size is 2652bp.

3.2.2 Plasmid pXJ was digested with PstI and BamHI, and the corresponding digestion procedure is shown in Table 6. The excised target fragment (4270 bp) was subjected to homologous recombination with the DE3 fragment amplified from E.coli (it was known that the homologous region of plasmid pXJ had been added to the sequence of the primer when the DE3 fragment was amplified by designing the primer), and the homologous recombination system was constructed as shown in Table 7.

Table 6 plasmid pXJ cleavage procedure

TABLE 7 plasmid pXJ-DE 3 plasmid homologous recombination system

Fragments were transformed into DH 5. Alpha. After homologous recombination and screened in ampicillin-resistant plates. By the next day 8 positive colonies were picked from the plate and verified by PCR. Verifying primer pXJ-F: GCAACGTGCTGGTTATTGTG, (SEQ ID NO: 33); DE3-R GAAGTCCGACTCTAAGATGTCACG, (SEQ ID NO: 34); ex Taq enzyme (RR 902) was used, annealing temperature was 57℃and extension was carried out for 2min42s (target fragment size 2723 bp). The PCR and enzyme digestion identification results show that 3 positive bacteria are obtained (shown in fig. 8 and 9), plasmids are extracted after the positive bacteria are amplified and cultured, and plasmids pXJ-DE 3 with correct sequencing results and bacterial solutions thereof are preserved for use (pXJ-DE 3 plasmid maps are shown in fig. 10).

3.3 Construction of helper plasmid pXJ-L

The aforementioned sequencing plasmids pMD19-L1, pMD19-L2, pMD19-L3 and pMD19-L4 cover the complete L gene of DHN 3. By designing 4 pairs of specific primers with homologous recombination sequences (see Table 8), 4 fragments L1, L2, L3 and L4 were amplified which cloned the complete L sequence into the pXJ vector using pMD19-L1, pMD19-L2, pMD19-L3 and pMD19-L4 as templates, respectively. The 5 '-end of the fragment L1 carries a homology arm with the BamHI end of pXJ and the 3' -end of the fragment L4 carries a homology arm with the pXJ PstI end. The vector pXJ was digested with BamHI and PstI, and the desired fragment (4270 bp) was recovered by gel purification. The 4 fragments and the BamHI/PstI double digested fragment of vector pXJ were added together, and homologous recombination was performed by a recombinase (ClonExpress Multis One Step Cloning Kit (C113)) to obtain recombinant products pXJ-L (recombinant composition table is shown in Table 9).

The recombinant product was transformed into DH 5. Alpha. Cells and screened by single colony PCR. The correct PCR product was amplified to 2110bp using primers PXJ-F (pXJ-F: GCAACGTGCTGGTTATTGTG, (SEQ ID NO: 33))/pXJ 40-L1-R (pXJ 40-L1-R: GGACAGTTGACTCATTGCTAACATA, (SEQ ID NO: 35)), 8 colonies were detected, and 8 positive bacteria produced the correct molecular weight PCR product (FIG. 11); one of the strains is further cultured and amplified to extract plasmid DNA. Then PstI digestion is carried out, the correct digestion products are 6230bp and 5081bp (the digestion identification result is shown in figure 12), and the sequence of the plasmid is confirmed to be consistent with the target sequence after sequencing and verification again (pXJ-L plasmid map is shown in figure 13).

TABLE 8 PCR primers for the construction of pXJ40-L

TABLE 9 plasmid pXJ-L recombination System

The use of the two enzymes (R050/RR 902) mainly used in this example is shown in Table 10 below.

Table 10 shows the use of enzymes for two PCR reactions according to the invention

The preparation of the related PCR reaction system and the setting of the reaction program are carried out according to the following methods:

R050PCR reaction procedure

RR902PCR reaction procedure

The annealing temperature will be adjusted according to the specific primer during RR902 use, and the extension time will also be carried out according to the specific fragment size in a proportion of 1 kb/min; during the use of the R050 enzyme, the extension temperature in the present invention was 60℃as a whole (determined by the nature of the enzyme), and the extension time was 1kb/min as the case may be.

The enzymes used in the full-length sequencing of DHN3 in the invention are all RR902 (the enzyme used for amplifying the MINI fragment is R050), and the enzymes used in the plasmid construction process are all R050. The process of the PCR reaction will not be described in detail below.

4. Construction of three transitional plasmids pBR322-PNP, pBR322-PDP, pBR322-LPD3 and plasmid pBR322-DHN3 containing the viral DHN3 Whole genome

4.1 Construction of transitional plasmid pBR322-PNP, pBR322-PDP, pBR322-LPD3

The whole genome of DHN3 is 15192nt, for example, the full-length cDNA is obtained by RT-PCR once, which is difficult to synthesize DNA fragments of more than 10k (DNA polymerase is generally available on the market), and random mutation is easy to introduce in the PCR process. Thus, the DHN3 whole genome was divided into 3 fragments, which were cloned into pBR322 vector, respectively. The fragment size was determined based on the BtgZI cleavage site held by the DHN3 genome itself (BtgZI divides DHN3 into 3 parts with unequal structural schematic as shown in FIG. 14) to facilitate subsequent ligation of DNA fragments in vitro.

The specific construction method is as follows:

A. preparation of plasmid fragments: the pBR322 vector was digested with HindIII and NheI (as shown in FIG. 15), and then recovered by gel for use, and the target fragment size of the pBR322 plasmid recovered after double digestion was 4161bp.

B. Preparation of the gene fragment of interest: the DNA fragments with the homology arms are amplified by the primers with the homology arms and the corresponding templates (see table 11 below) under the action of high-fidelity R050, and are recovered for standby after verification by running DNA gel.

C. The obtained fragment was recombined with the plasmid fragment of pBR322 after cleavage with a recombinase (see Table 12 below). And (3) performing single colony PCR primary selection through competent cell DH5 alpha transformation, amplifying plasmid DNA, performing enzyme digestion on the plasmid DNA, then performing DNA gel check, and finally performing sequencing verification.

Genomic fragments involved in the construction of the pBR322-PNP plasmid included NP, MINI, and P.

Genomic fragments involved in the construction of the pBR322-PDP plasmid included P, PD1 and PD2, PD3.

Genomic fragments involved in the construction of the pBR322-LDP plasmid include L1, L2, L3, L4 and PD3.

The 3 intermediate plasmids are shown in FIGS. 16-18, respectively, wherein FIG. 16 is a schematic diagram of the pBR322-PNP plasmid; FIG. 17 is a schematic diagram of a pBR322-PDP plasmid; FIG. 18 is a schematic diagram of pBR322-LPD3 plasmid.

TABLE 11 templates and primer tables for fragments of interest

Table 12 recombination systems for plasmids

Remarks:

1. after the desired fragments required for constructing the pBR322-PNP plasmid, the pBR322-PDP plasmid, and the pBR322-LPD3 plasmid were amplified, respectively, they were mixed according to the recombination system of Table 12 above, and then the procedure was followed for homologous recombination to construct the corresponding plasmids.

2. As can be seen from the construction strategy of the pBR322-DHN3 plasmid, the viral genome contains two BtgZI cleavage sites, and the viral whole genome is divided into 3 large fragments according to the two cleavage sites, namely, three large fragments contained in three plasmids of pBR322-PNP, pBR322-PDP and pBR322-LPD3 are constructed. Meanwhile, when the basic sequencing is carried out on the viral genome, the viral whole genome is divided into 10 small fragments (NP, P, PD1, PD2, PD3, L1, L2, L3 and L4), and BtgZ I cleavage sites are just positioned in the overlapping region of the P fragment and the PD3 fragment, so that the P fragment and the PD3 are amplified when the pBR322-PNP, pBR322-PDP and pBR322-LPD3 plasmids are constructed and are denoted by P left, P right, PD3 left and PD3 right.

3. Since the L protein is a nucleocapsid protein of the NDV virus, the plasmids pMD19-L1, pMD19-L2, pMD19-L3, pMD19-L4 were first constructed to construct plasmid pXJ-L, which was used as a helper protein for rescuing the virus. One of the templates used in constructing the pBR322-LPD3 plasmid, which already contains the entire sequence of the L gene, was pXJ-L.

The L gene was split into 2-pieces for amplification during construction of pBR322-LPD3, designated L1-2, L3-4, (wherein L1-2 refers to the contiguous sequence of small fragments L1 and L2, which was amplified from primer C-L1-R, pXJ40-L2-R, template pXJ-L, L3-4 refers to the contiguous sequence of small fragments L3 and L4, primer pXJ40-L3-F, C-HindBt not-L4-F template pXJ-L). It is also noted that the primer C-HindBtNot-L4-F for amplifying L3-4 contains the homologous region required for constructing pBR322-DHN3 plasmid and a BtgZ I cleavage sequence, so that the viral genome sequence in pBR322-LPD3 can be completely excised by BtgZ I and the excised fragment can be directly used for construction of pBR322-DHN3 plasmid.

4. The enzymes used in the PCR amplification reactions involved in the construction of the pBR322-PNP plasmid, the pBR322-PDP plasmid, and the pBR322-LPD3 plasmid in Table 12 above were all Prime STAR GXL DNA Polymerase (R050, TAKARA), and the reaction system was as described above.

5. All homologous recombination methods involved in the present invention use a kit of Clon Express Multis One Step Cloning Kit (C113, norvezan) and will not be described in detail.

4.2 Construction of pBR322-Base vector

To obtain recombinant viruses, 1 Base plasmid (pBR 322-Base) was first constructed to obtain full genome single-stranded negative-strand RNA. In order to obtain higher transcription level and ensure that RNA transcribed by the method does not contain any exogenous ribonucleic acid, 1T 7 promoter, 1T 7 terminator and 1 HDV ribozyme are respectively introduced on a pBR322 plasmid, so that the full-length RNA of the DHN3 whole genome negative strand can be accurately synthesized finally under the action of exogenous T7RNA polymerase. When the pBR322-Base plasmid is designed and synthesized, a segment of viral genome sequence is synthesized at the downstream of the T7 promoter and the upstream of the HDV ribozyme respectively to serve as a homologous region of homologous recombination. Wherein the sequence added downstream of the T7 promoter is HC-1, and the corresponding positions in the viral genome are 15159-15192. The sequence added upstream of the HDV ribozyme is HC-2, and the corresponding position in the genome of the virus is 1-141 to provide the two homology arms required for recombination. The DNA fragment containing the T7 terminator and the HDV ribozyme, HC-2, HC1, T7 promoter was synthesized by hand and combined by homologous recombination on the pBR322 vector to obtain pBR322-T7Pro-HDV Ter (i.e., the Base plasmid pBR 322-Base), the schematic of which is shown in FIG. 19, and the DHN3 genome assembled in this manner is shown in FIG. 20.

4.3 Construction of genome-wide expression vector pBR322-DHN3

4.3.1 Preparation of fragment DHN3-A

Preparation of DHN3-A fragment: the cleavage of the pBR322-PNP plasmid, pBR322-PDP plasmid, pBR322-LPD3 plasmid to recover fragment PNP, fragment PDP, and fragment LPD3; and connecting the segment PNP, the segment PDP and the segment LPD3 to obtain the full-length DHN3-A for standby. Specifically, referring to Table 13 below, the pBR322-PNP plasmid was double digested with BtgZI and HindIII to recover fragment PNP; the method for recovering fragment PDP from pBR322-PDP plasmid is as follows: the pBR322-PDP plasmid is singly digested with BtgZI to recover fragment PDP; the method for recovering the fragment LDP3 from the pBR322-LPD3 plasmid comprises the following steps: the pBR322-LPD3 plasmid is singly digested with BtgZI to recover fragment LPD3;

TABLE 13 cleavage System for plasmid fragments

Remarks:

1. the preparation of the fragment PNP, the fragment PDP and the fragment LPD3 is operated according to the enzyme digestion system and time in the table; after the enzyme digestion is finished, a small amount of the enzyme digestion can be taken for gel electrophoresis to observe whether the enzyme digestion is complete or not, if not, a little enzyme is required to be added properly or the incubation time is prolonged, or both of the two are needed;

2. the preparation of fragment PNP requires cleavage by both HindIII and BtgZI enzymes. It should be noted that these two cleavage reactions are performed separately, not simultaneously. The method comprises the steps of firstly using HindIII for digestion, recovering the target product from agarose electrophoresis gel, and then using BtgZI for digestion. The PBR322-PNP' in the above table therefore refers to the HindIII cleaved product.

3. A0.6% agar (TsingKe, TSJ 001) gel containing 0.03% gold staining broth was prepared. Taking 0.6 microgram of agar, adding 100 milliliters of TAE buffer solution, heating in a microwave oven for 1-2 minutes until the agar is completely melted, cooling to about 50 ℃, adding full Jin Ranse liquid (diluted by 1:3000 times), and spreading glue. Note that the addition of the staining agent may inhibit the linking of DNA fragments. All the enzyme-digested products were separated by gel electrophoresis as described above. The gel was placed on a clean glass plate and the correct fragment of interest was cut off with a disposable stainless steel blade and recovered. Purification was performed using the GelExactionkit (D2500-02, OMEGA) as provided by the kit.

4. The fragment PNP, the fragment PDP and the fragment LDP3 are connected in vitro through high-concentration T4 ligase to obtain the full-length DHN3-A. The connection specific parameters refer to table 14. The ligation product was directly purified using a kit (Mini BEST DNA fragment purification kit version4.0, TAKARA, 9761) and the purified product was ready for use.

TABLE 14 DHN3-A connection System

4.3.2 Preparation of plasmid fragments with homology arms

Using the above pBR322-Base plasmid as a template, primers A2-F/A2-R (A2-F: ATCGGTAGAAGGTTCCCTCAGGTTC, (SEQ ID NO: 61); A2-R: GGTCCTATAGTGAGTCGTATTAATG, (SEQ ID NO: 62)) containing homology arms were amplified by PCR using high fidelity enzyme R050. The PCR amplified product of this step was purified by the method provided by the above-mentioned purification kit (Mini BESTDNA fragment purification kit version4.0, TAKARA, 9761) to obtain a plasmid fragment with a homology arm.

4.3.3 Recombinant plasmid pBR322-DHN3

And carrying out homologous recombination on the constructed plasmid fragment containing the homology arm and DHN3-A to obtain a whole genome expression vector pBR322-DHN3. Specific parameters may be referred to in table 15.

TABLE 15 formulation of homologous recombination of plasmid fragments with DHN3-A

Reagent(s)	Dosage of
		DHN3-A	200ng
pBR322-Base	91.02ng
		5×CE MultiS Buffer	4μl
Exnase MultiS	2μl
		ddH 2 0	up to 20μl

The recombinant product was transformed into DH 5. Alpha. Competent cells. Specific primers C-pBR322-R: GAAATTGCATCAACGCATATAGCGC, (SEQ ID NO: 63); C-NP-F: CATCTGGTTGCCCTTGCGGCTTGTTC (SEQ ID NO: 44) was subjected to single colony PCR to obtain 3 positive colonies A1-A3, the results of which are shown in FIG. 21. A1 was subjected to amplification culture and plasmid DNA was extracted. The A1 plasmid was initially identified by Sac1 cleavage, and the correct cleavage products were 1 8482bp, 1 7065bp, 1 3132bp, 1 908bp and 132bp fragments, and the results are shown in FIG. 22, which shows that the cleavage products are consistent with the results of sequence inference. The 32bp fragment was too small to be shown in an agar electrophoresis gel. The plasmid was designated pBR322-DHN3 (see FIG. 23 for plasmid map). The plasmid was sequenced again and amplified for use after verification.

5. Rescue of Virus rDHN3 on BHK-21 cells

BHK-21 cells were placed in 30mm dishes and were ready for transfection when the cells were about 80% long. Co-transfection with pBR322-DHN3, pXJ-NP, pXJ40-P and pXJ-L, pXJ40-DE3 (see Table 16 for the respective amounts). After 4 days the signs of cell fusion were unclear. After freeze thawing 2 times in a refrigerator at-20 ℃ on a petri dish, the cells and the culture solution were collected into a sterile centrifuge tube, centrifuged at 12000rpm for 10 minutes, and the supernatant was collected. Mu.l of the virus solution (rDHN 3-P1) was continued to infect BHK-21 cells, and cell fusion lesions were visible after 2-3 days (see FIG. 24). After further incubation for 1 day, the dishes were frozen and thawed 2 times in a-20 refrigerator and centrifuged at 12000rpm for 10 minutes. The supernatant was collected. 100 μl of the collected virus liquid was inoculated into 9-day-old SPF chick embryos, which died at about 48 hours. The chick embryo allantoic fluid was harvested, viral RNA was extracted, and JF-F was used: CCTTGCAGCTGCAGGAATTG, (SEQ ID NO: 2); JF-R: GCTCTATACAGTATGAGGTGTCAAG (SEQ ID NO: 3) the NDV virus F gene was amplified and the band of interest was detected.

TABLE 16 rescue of the use of the plasmids by DHN3 Virus

Plasmid(s)	Dosage of
		pXJ40-NP	2.5μg
pXJ40-P	1.25μg
		pXJ40-L	1.25μg
pXJ40-DE3	3μg
		pBR322-DHN3	4μg

6. Construction of plasmid pBR322-mNPDHN3

In this summary we replaced the codon of the NP gene on pBR322-DHN3 to form a new plasmid pBR322-mNPDHN3. If one wants to complete the construction of this plasmid we will 1. Count the frequency of each codon used in the NP gene in the DHN3 genome and replace the codon portion with the most frequently used codon for the corresponding amino acid. 2. And synthesizing the replaced gene sequence. 3. The synthesized sequence was replaced on pBR322-DHN3 plasmid to form a new plasmid pBR322-mNPDH 3. The following will describe in detail respectively:

6.1 All coding region codons of the NP gene in the DHN3 genome were counted as shown in table 17 below.

TABLE 17 statistics of the frequency of use of each codon in the coding region of the NP gene of the genome of DHN3 virus

As shown in Table 17, we have counted the codons in the NP coding region of DHN3, the numbers in brackets represent the number of times the previous codons appear in the NP gene (1. The counted codons in the coding region of the NP 3 genomic NP gene alone are 1. In the present invention, the number of codons in the coding region is 2 in the initiation region, the number of codons is 735nt, the positions 122-856nt on the genome of the corresponding DHN3 are the sequence number of SEQ ID NO: 64. But the number of codons in the coding region is 17-19nt,23-25nt is "ATG", the number of codons in the initiation region is 2 in the order to avoid the significant rescue of the virus, the number of polypeptides is 1 or 2 in the order of the polypeptides that are likely to be produced by the substitution of the codons, the corresponding DHN3 genomic positions are 122-856nt. The sequence number of nucleotides is the sequence number of SEQ ID NO: 64. But the sequence number of 17-19nt is the "ATG", the sequence number of nucleotides is 23-25nt is the "ATG", the sequence number of the number of codons is 2 in the initiation region is 2 in the order to avoid the effect of the polypeptide that the potential production of the rescue of the virus, and the number of nucleotides is the highest in the order to determine the highest in the amino acid sequence that the GAC is the sequence that is most frequently replaced by the GAC 6; the 8 th amino acid Tyr of the NP gene coding region corresponding to 23-25nt still uses "TAC" instead of the highest "TAT" appearing frequently in Table 17, except for the two, the rest bases are unified according to the replaced codons, and the unified sequence is named as sequence three (specific sequence is shown in SEQ ID NO: 65)

6.2 Synthesizing gene sequence with replaced codons to construct pBR322-mNPDHN3 plasmid

The gene sequence after codon replacement was sent to Guangzhou Optimu Technophora Co., ltd for synthesis, and the synthesized sequence was ligated into vector pUC57 by means of TA ligation (order number QNB 0020670-1). The ligation products were then transformed into TOP10 competent cells, and monoclonal positive colonies were selected and sequenced to verify correct. The positive colony is amplified and cultured, then the plasmid is extracted, and the synthesized fragment is recovered for standby after BsiWI/XbaI double enzyme digestion (the synthesized sequence is named as sequence IV, and the specific sequence is shown as SEQ ID NO: 66).

The method comprises the following specific steps:

6.2.1 BsiWI/XbaI on the pBR322-DHN3 plasmid was selected as the site for the access of the desired fragment (BsiWI located at positions 4416-4421 of pBR322-DHN3 and XbaI located at positions 5894-5899 of pBR322-DHN 3). pBR322-DHN3 was digested simultaneously with BsiWI/XbaI to collect 18141bp of the target fragment.

6.2.2 A synthesis sequence is prepared. The synthetic sequence comprises the sequence from the original sequence to the two cleavage sites (see FIG. 26), namely the 4416-4484 and 5220-5899 sites of the plasmid fragment of pBR322-DHN3, which adds 749bp together with the replacement sequence 735bp, and 1484bp (the final synthetic sequence is SEQ ID NO: 66) in total.

6.2.3 The synthesized sequence was cloned into plasmid pUC57 by TA ligation, and the ligation product was transformed into TOP10 competent cells. The positive bacteria were picked and verified by XbaI/HindIII digestion (see FIG. 27), and the sequence of interest was obtained by sequencing in pUC57 plasmid to form a new plasmid Y0016495-1 (see FIG. 28). Then, plasmid Y0016495-1 was digested with BsiWI/XbaI to obtain a synthetic fragment 1484bp, the recovered fragment was ligated with the fragment prepared in 6.2.1, the ligation product was transformed into TOP10 competent cells, positive colonies were selected and verified by SacI digestion (see FIG. 29), and then by sequencing to obtain plasmid pBR322-mNPDH 3 (see FIG. 30).

7. Rescue of Virus rDHN3-mNP on BHK-21 cells

BHK-21 cells were placed in 30mm dishes and grown to confluence within 24 hours. Co-transfection with PBR 322-mNPHN 3, pXJ-NP, pXJ40-P and pXJ-L, pXJ-DE 3 (amounts shown in Table 18). Cell fusion was evident after 2 days (see FIG. 31). After 4 days of incubation, the dishes were frozen and thawed 2 times in a refrigerator at-20℃and the cells and culture broth were collected into a sterile centrifuge tube, centrifuged at 12000rpm for 10 minutes, and the supernatant was collected. 100 μl of virus solution (rDHN 3-mNP-P1) was continuously infected with BHK-21 cells, and cell fusion lesions were seen for about 24 hours. After further culturing for 1 day, the dishes were frozen and thawed 2 times in a refrigerator at-20℃and centrifuged at 12000rpm for 10 minutes. The supernatant was collected. 100 μl of the collected virus liquid was inoculated into 9-day-old SPF chick embryos, which died at about 40 h. Harvesting chicken allantoic fluid, extracting viral RNA, using JF-F CCTTGCAGCTGCAGGAATTG, (SEQ ID NO: 2); JF-R GCTCTATACAGTATGAGGTGTCAAG, (SEQ ID NO: 3) the NDV virus F gene was amplified to give a positive band. Continuing to propagate rDHN3-mNP in the SPF chick embryo, and collecting allantoic fluid after the proliferation reaches 10 generations. F and NP gene fragments of rDHN3-mNP were amplified using JF-F/JF-R and NDV-ST-W/C-NP-F (NDV-ST-W: ACCAAACAGAGAATCCGTGAGGTA, (SEQ ID NO: 22); C-NP-F: CATCTGGTTGCCCTTGCGGCTTGTTC, (SEQ ID NO: 44)), respectively, and the sequencing results were checked for mutation. As a result, FIG. 32 shows that rDHN3-mNP was propagated in SPF chick embryos until the tenth F gene and NP gene were not mutated.

Table 18 rDHN3-mNP Virus rescue of the use of the plasmids

Plasmid(s)	Dosage of
		pXJ40-NP	2.5μg
pXJ40-P	1.25μg
		pXJ40-L	1.25μg
pXJ40-DE3	3μg
		pBR322-mNPDHN3	4μg

8. Determination of relevant virulence index of DHN3, rDHN3-mNP

According to the OIE standard, we will determine HA, TCID50, EID50, MDT (Mean Dead Time) and viral growth curves for three viruses, DHN3, rDHN3-mNP, encompassed by the present invention.

8.1 HA

1. The virus to be detected is diluted by normal saline to be diluted (10 ^-1 -10 ^-10 )；

2. 25 μl of physiological saline was added to each well of the 96-well plate;

3. different dilutions of virus solution were added to the corresponding wells, 25 μl of each well (one virus per row and no virus solution added for the last row as control);

4. mu.l of 1% chicken erythrocytes were added to each well;

after 5.15-20 minutes, the coagulation was observed.

8.2 TCID50

1. BHK-21 cells are paved in a 96-well plate one night in advance, and the next experiment is started when the cells grow to 80-90% (3 parallel experiments are carried out on each virus liquid, and the average value of CPE and non-CPE is calculated);

2. discarding the culture solution, and washing the cells twice with PBS;

3. the virus solution to be tested was diluted to different dilutions using DMEM (10 ^-1 -10 ^-1 1)；

4. The virus solutions with different dilutions are respectively added into the corresponding wells, 100 mu l of each well (one 96-well plate is used for measuring the tissue half-number infection of one virus, each column is one dilution, each row represents different dilutions, and the last column is left as blank control);

Lesions were observed after 5.4-6 days and the results were calculated using the Reed-Muench method.

8.3 EID50

1. Selecting fresh healthy 9-11-day-old SPF chick embryos for experiments;

2. using physiological saline to make gradient dilution of virus liquid to be detected 10 ^-1 -10 ^-10 ；

3. Selecting 10 ^-5 -10 ^-10 Dilutions were used for experiments, 5 SPF chick embryos per dilution, one after the other100 μl of diluted virus solution;

4. discarding dead embryos within 24 hours;

5. freezing and storing dead embryos in time for three times every day;

6. the half-number infection of chick embryos was calculated using the Reed-Muench method (half-number lethal ELD50 of chick embryos and average lethal time MDT of chick embryos can be calculated at the same time of the experiment) by observing for 6-7 days.

8.4 MDT(Mean Dead Time)

1. Selecting fresh healthy 9-11-day-old SPF chick embryos for experiments;

2. using physiological saline to make gradient dilution of virus liquid to be detected 10 ^-1 -10 ^-11 ；

3. Selecting 10 ^-5 -10 ^-10 Dilutions were used for the experiments, 5 SPF chick embryos per dilution, each inoculated with 100 μl of diluted virus solution;

4. discarding dead embryos within 24 hours;

5. freezing and storing dead embryos in time for three times every day;

6. the average lethal time of chick embryos was calculated using the Reed-Muench method after 6-7 days of observation.

8.5 Determination of the growth characteristics of viruses

1. Infecting BHK-21 cells with the virus at 1 MOI;

2. incubating for 2h, discarding virus liquid, and washing with PBS for three times;

3. then 4h,8h,16h,24h,36h,48h and 60h after infection are selected to harvest the infectious virus liquid, and the final virus liquid is harvested after repeated freeze thawing;

4. Respectively preparing TCID50 of the harvested virus liquid;

5. the virus TCID50 was measured at different times of infection and growth curves were plotted.

The above-mentioned related test results are shown in tables 19 and 20 below.

TABLE 19 associated virulence index for each strain of NDV

Table 20 determination of the TCID50 at various time points of the growth curves for the NDV strains

Remarks: the 1,2,3 of each strain in the table above represent three replicates in the experiment. The growth curve of TCID50 at various time points plotted according to table 20 is shown in fig. 33.

From the above results, it follows that:

1. the invention successfully saves the virus rDHN3.

2. The invention changes the codon composition of NP gene under the condition of not changing the amino acid sequence of NP gene and saves the codon substitution strain NDV rDHN3-mNP.

3. The experimental result shows that rDHN3-mNP has shorter MDT and similar TCID50 than the original strain DHN3 and the rescued strain rDHN3, and the EID50 is obviously increased, and the growth curve of the virus shows that the rescued virus rDHN3-mNP still accords with the replication curve of the NDV after codon replacement. Taken together, these data may demonstrate that codon substitutions did improve some performance. This resulted in a faster death of the virus when it infects chick embryos (MDT, 46.2 h) and higher titers (EID 50, 10) ^8.48 /ml). These changes are in place of a portion of the NP gene nucleotide sequence, but do not alter the NP gene amino acid sequence. The invention can provide another research means for researching the NDV.

Sequence listing

<110> agricultural university of south China

<120> method for rescuing codon-substituted gene VII type Newcastle disease virus

<130> 2020.4.27

<160> 66

<170> SIPOSequenceListing 1.0

<210> 1

<211> 15192

<212> DNA

<213> Artificial sequence ()

<400> 1

accaaacaga gaatccgtga ggtacgataa aaggcgaaga agcaatcgag atcgtacggg 60

tagaaggtgt gaaccccgaa cgcgagatcg aagcttgaac ctgagggaac cttctaccga 120

tatgtcgtct gtttttgacg aatacgagca gctccttgct gcccagaccc gccctaacgg 180

agcccatgga gggggagaga aagggagcac cttaaaagtt gaggtcccag tatttaccct 240

aaacagtgat gatccagagg atagatggaa ctttgcggta ttctgtcttc ggattgccgt 300

tagtgaggat gccaacaaac cactcaggca aggtgctctt atatccctct tatgctccca 360

ttctcaggtg atgagaaacc atgttgccct tgcaggaaaa cagaacgagg ccacactagc 420

tgttcttgag atcgatggtt ttgctaataa tgtgccccag ttcaacaata ggagtggagt 480

gtccgaggag agagcacaga gattcatggt aattgcaggg tctctccctc gggcatgcag 540

caacggtact ccgtttgtca cggctggggt tgaagatgat gcaccagaag atatcactga 600

cactctggaa aggatcctat ctgtccaagt ccaagtatgg gtcacggtag caaaggccat 660

gactgcatat gagacagcag atgagtcaga aacaagaaga ataaataagt atatgcagca 720

gggtagagtc cagaagaagt acatccttca tcctgtatgc aggagtgcaa ttcaactcat 780

aatcagacat tctctggcag tccgtatttt cctggttagt gagctcaaga ggggccgtaa 840

tacagcaggt gggagctcta catattacaa tttggtcggg gatgtagact catacatcag 900

aaataccggg cttactgcgt ttttcctaac actcaaatat ggaatcaata ccaagacgtc 960

agctctcgca ctcagcagcc tcacaggtga tatccaaaaa atgaaacagc tcatgcgttt 1020

atatcggatg aaaggtgaaa atgcaccata catgacattg ttaggtgaca gtgaccagat 1080

gagctttgcg ccagccgaat atgcacaact ttattctttt gccatgggca tggcatcagt 1140

cttagataag ggaactggca agtaccaatt tgccagggac tttatgagca catcattctg 1200

gcgacttgga gtagagtatg ctcaggctca gggaagtagt atcaatgaag acatggctgc 1260

tgagttaaaa ctaaccccag cagcaaggag aggcctggca gctgctgccc aacgagtatc 1320

tgaagaaatc ggcagcatgg acattcctac tcaacaagca ggagtcctca ccgggctcag 1380

tgacgaaggc ccccgaactc cacagggtgg atcgaacaag ccgcaagggc aaccagatgc 1440

tggggatggg gagacccaat tcctggattt tatgagaaca gtggcgaaca gcatgcggga 1500

atcgcctaat cctgcacaga gcaccactca tctagagcct cccccgaccc ctggggcatc 1560

ccaagacaac gacactgact gggggtactg atcgactact cccagcctgc ctccatagga 1620

ccacaccaaa cccctccccc aaaacccccc cacacccccc gacccacaac cccgcacgac 1680

ccccccaaca aaagctcccc cccaccctct cccccacccc cagccacacg accccatcca 1740

cccgggacaa cacaggcaca gctcggccag tcaacaatcc tcccagagtc caaggtatta 1800

gaaaaaaata cgggtagaag agagacatcc agagaccagg acgggtcacc aagctctctg 1860

ttctcccttc tacccggtga gttagggtga agatggctac ctttacagat gcggagatag 1920

atgacatact tgagaccagt gggactgtca ttgatagcat aattacggcc cagggcaaat 1980

cagccgagac cgtcggaaga agtgcgatcc cgcagggcaa gaccaaagct ccaagcacag 2040

cacgggagaa gcacgggagt gcccagccac acgccagtca ggacgtcccc gaccaacaag 2100

acagaacaga aaaacagcca tccacacctg agcaggcaac cccacacaac aacccaccga 2160

ccacacccac cgaaccgccc tccacccagg ccgcaagcga gaccagcgac acacagctca 2220

aaaccggagc aagcaactcc cttctgtcca tgctcgacaa attaagcaat aaatcgtcta 2280

atgctaaaaa gggcccatgg tcgggtcccc aagaagggca tcaccaatct ccggcccaac 2340

aacacgggaa ccagtcgagc catggaagca accagggaag accacagcac caggtcaagg 2400

ccgtctctgg aaaccggggc atagacgaga acacagcata tcatggacaa cggaaggagt 2460

cacaaccatc agctggtgca acccctcatg cgccccagtc agggcagagc caagacaata 2520

ttcctgtacc tgtggatcgt gtccagctac ctgccgactt tgcgcaggcg atgatgtcta 2580

tgatggaggc attatctcag aaggtaagta aagttgatca tcagctggat ctggtcttga 2640

aacagacatc ctctattcct atgatacgat ctgaaatcca acagctcaag acatctgttg 2700

cgatcatgga agctaactta ggtatgatga aaattctgga ccctggttgt gccaacattt 2760

catctttaag tgatctccgg gcagtagccc gatcccaccc agtcctagtt tcgggccccg 2820

gagacccatc tccttacgtg acacaagagg gtgaaatgac gctcaataaa ctctcacaac 2880

cagtgcagca cccttctgaa ttgattaagt ctgccaccgc aagcgggcct gacatgggag 2940

tggagaagga cactgtccgc gcattaatca cctcacgccc gatgcatcca agctcctcgg 3000

ctaagctcct gagcaagcta gatgcagcca agtcaattga agagatcagg aagatcaagc 3060

gccttgcgct gaatggttga tggccgtcac aactcatagc aggctcctgt cgcttcagca 3120

tcacacggaa tcccccggga gccccccctt gcgaatccat gcttcaacac cccagacaac 3180

agccctctct caccatcccc aatccctcgc atgatcgcac aactgcaacc aatctagcag 3240

cattagagat taagaaaaaa cacgggtaga atcaaagtgc ctcgattgaa ccaaaatgga 3300

ctcatccagg acaatcgggc tgtactttga ttctgccctt ccttccagta gcctattagc 3360

atttccgatt atcttacaag atacaggaga cgggaagaaa caaatcactc cacaatacag 3420

gatccagcat cttgattcgt ggacagacag taaggaagac tcggtattta tcaccaccta 3480

cgggttcatc tttcaagttg ggaatgaagg agccactgtc ggtgtgatca atgacaatcc 3540

caggcatgag ctactctctt ccgcaatgct ctgcttaggg agtgtcccga acaacggaga 3600

tcttgttgag ctggcgagag cctgcctcac tatggtggta acctgcaaga agagtgcaac 3660

taacactgag agaatagtct tctcagtagt gcaggcacct cgagtgctgc aaaattgtat 3720

ggttgtgtca aatcggtact catcagtgaa tgcagtgaag catgtgaagg cgcccgaaaa 3780

gatccctggg agcggaaccc tagagtataa agtgaatttt gtctccttga ctgtggtgcc 3840

gagaagggat gtctacagga tcccaactac agtattgaaa gtgtctggct cgagcctgta 3900

caatcttgcg ctcaatgtca ctattgatgt ggacgtggat ccgaagagcc cgttagtcaa 3960

atccctttct aagtccgata gcgggtacta tgcgaatctt tttctgcata tcggacttat 4020

gtccactgta gataagagag gaaagaaagt gacatttgac aagatagagg aaaagataag 4080

gagactcaat ctatctgttg ggctcagtga tgtgctcgga ccctctgtgc ttgtgaaggc 4140

gagaggtgca cggactaagc tacttgctcc tttcttctct agcagtggga cagcctgcta 4200

tcctatagca aatgcctctc cccaggttgc caagatactc tggagccaga ccgcgcacct 4260

gcggagcgtg aaagtcatca ttcaagccgg cactcagcgt gctgttgcag tgaccgccga 4320

tcatgaggta acctccacta agatagagaa gaagcatgcc attgctaaat acaatccttt 4380

cagaaaatag gttacatccc taagactgca gttcacctgc tttcccgaat catcatgaca 4440

ccagataatg atccatctcg actgcttgta gttagttcac ctgtccagca aattagaaaa 4500

aacacgggta gaagagtctg gaccccgacc ggcacactca ggacacagca tgggctccaa 4560

accttctacc aggatcccag cacctctaat gctaatcact cgaattatgc tgatattgaa 4620

ctgcatccgt ctgacaagtt ctcttgacgg caggcccctt gcagctgcag gaattgtaat 4680

aacaggagat aaggcagtca atgtatatac ctcgtctcag acagggtcaa tcatagtcaa 4740

gttgctcccg aatatgccca gagataagga ggcatgtgca agagccccat tggaggcata 4800

taacagaaca ctgactactc tgctcactcc tcttggcgac tccattcgca agatccaagg 4860

gtctgtatcc acgtccggag gaaggagaca aaaacgcttt ataggtgctg ttattggcag 4920

tgtagctctc ggggttgcaa cagcggcaca gataacagca gctgcggccc taatacaagc 4980

caaacagaat gctgccaaca tcctccggct taaggagagc attgctgcga ccaatgaagc 5040

tgtgcatgaa gtcaccgacg gattatcaca attatcagtg gcagttggga agatgcaaca 5100

gtttgtcaat gaccagttta ataacacggc gcgagaatta gactgcataa aaatcacaca 5160

acaggtcggt gtagaactca acctatacct aactgagcta actacagtat tcgggccaca 5220

gatcacctcc cctgcattaa ctcagctaac catccaggcg ctctataatt tagctggtgg 5280

caatatggac tacttattaa ctaagttagg tataggaaac aatcaactca gctcattaat 5340

tggtagcggc ctgatcactg gttaccctat actgtatgac tcacatactc aactcttggg 5400

catacaagtt aatctgccct cagtcgggaa cttaaataat atgcgtgcca cctatctgga 5460

gaccttatct gtaagtacaa ccaaaggata tgcctcagca ctggtcccga aagtagtgac 5520

acaagtcggt tctgtgatag aagagcttga cacctcatac tgtatagagt ccgatctgga 5580

tttatattgt actagaatag tgacattccc catgtctcca ggtatttatt cctgtttaag 5640

tggcaacaca tcagcctgca tgtattcaaa gactgaaggc gcactcacta cgccgtatat 5700

ggcccttagg ggctcagtta ttgctaattg taagataaca acatgcagat gtacagaccc 5760

tcctggcatc atatcgcaaa attatggaga agctgtatcc ctgatagata gacactcgtg 5820

caatgtctta tcattagacg gcataactct gaggctcagt ggggaatttg atgcaactta 5880

tcaaaagaac atctcaatat tagattctca ggtcatcgtg acaggcaatc ttgatatatc 5940

aactgaactt ggaaacgtca ataattcgat cagcaatgcc ttggacaagt tggcagaaag 6000

caacagcaaa ctagaaaaag tcaacgtcag actaactagc acatccgctc tcattaccta 6060

tattgttcta actgtcattt ccctaatttt cggtgcactt agtctggttt tagcgtgtta 6120

cctgatgtac aagcagaagg cacaacaaaa gaccctgtta tggcttggga acaataccct 6180

cgatcagatg agagccacca tgagagcatg aatgcaaata ggaagtggac ggacacccaa 6240

cggcagcccg tgtgtcaatt ccgataacct gtcaagtagg agacttaaga aaaaattact 6300

gggaacaagc aaccaaagag caatacacgg gtagaacggt cagaggagcc acccttcaat 6360

tgaaaattag gcttcacaac atccgttcta ccacaccacc aacaacaaga gtcaatcatg 6420

gaccgcgtgg ttaacagagt catgctggag aatgaagaaa gagaagcaaa gaacacatgg 6480

cgcttagttt tccggatcgc agtcttattt ttaatggtaa tgattctagc tatctctgcg 6540

gctgccctgg catacagcat ggaggccagt acgccacacg acctcgcagg catatcgact 6600

gtgatctcca agacagaaga taaggttacg tctttactca gttcaagcca agatgtgata 6660

gataagatat acaagcaggt agctcttgaa tccccgctgg cactattaaa caccgaatct 6720

gtaattatga atgcaataac ctctctttct tatcaaatta acggggctga gaacagtagc 6780

ggatgcggtg cgcccgttca tgacccagat tatatcgggg ggataggcaa agaactcata 6840

gtggacgaca ttagtaatgt cgcatcattt tatccttctg catatcaaga acacttgaat 6900

ttcatcccgg cacctactac aggatctggt tgcactcgga taccctcatt tgacatgggc 6960

accacccatt attgttatac tcacaatgtg atactatctg gttgcagaga tcactcacac 7020

tcacatcaat acctagcact tggtgtgctt cggacatctg caacagggag ggtattcttt 7080

tctactctgc gctccatcaa tttagatgac actcaaaatc ggaagtcttg cagtgtgagt 7140

gcaacccctt taggttgtga tatgctgtgc tctaaggtca cagggactga agaggaggat 7200

tacaagtcag ttgcccccac atcaatggtg cacggaaggc taggatttga cggtcaatac 7260

catgagaaag acttagacac cacggtctta tttaaggatt gggtggcaaa ttacccgggg 7320

gtgggaggag ggtcttttat tgacggccgt gtatggttcc cagtttacgg agggctcaaa 7380

cctaattcac ccagtgacat cgcacaagaa gggaaatatg taatatacaa gcgccataat 7440

aacacatgcc ccgataaaca agattaccaa attcggatgg ctaagtcctc atataaacct 7500

gggcgatttg gtggaaagcg cgtacagcaa gctatcctat ctatcaaagt gtcaacatcc 7560

ctgggtaagg acccggtgct gactattcca cctaatacaa tcacactcat gggagccgaa 7620

ggcagaatcc tcacagtagg gacatctcac ttcttgtatc aacgagggtc ttcatatttc 7680

tcccctgcct tattgtatcc catgacagta agtaacaaaa cggctacact ccatagtcct 7740

tacatgttta atgctttcac tcggccaggt agtgtccctt gccaggcatc agcaaggtgc 7800

cccaactcat gcatcactgg ggtctatacc gatccatatc ccttaatctt ctataggaat 7860

catactctac gaggggtctt cgggacgatg cttgatgatg aacaagcgag gcttaacccc 7920

gtatctgcag tatttgacaa catatctcgc agtcgtgtca cccgggtgag ttcaagcaac 7980

accaaggcag catacacgac atcgacatgt tttaaagttg tcaagactaa taaagtttat 8040

tgtcttagta tcgcagaaat atccaatacc ctattcgggg aatttaggat cgttcccttg 8100

ctagttgaga tcctcaaaga tgatagagtt taagaagcta gacttggccg attgagccaa 8160

tcataggatg gttgggagga cgacattgcg ccaatcatct cccataatgc ttagagtcaa 8220

gctgaacatt agcataaatc aggatcccgt gttgttgggc aaccgcaatc cgacaatgct 8280

gacatgattg ttctgagtct cgctcactgt cactttatta agaaaaaaca caagaagcat 8340

tgacatataa gggaaaataa ccaacaagag agaacacggg taggacatgg cgggctccgg 8400

tcctgagagg gcagagcacc agatcatcct accagagtca catttatcct ctccattggt 8460

caagcacaaa ttgttatact actggaaatt aaccgggcta ccgcttcctg atgaatgcga 8520

ctttgatcat ctcattatca gcaggcaatg gaagagaata ctggagtcag ccactcctga 8580

cacagagaga atgataaaac ttgggcgggc ggtgcaccag actctcaacc acaattccaa 8640

gatgactgga gtgctccatc ccaggtgttt agaagaactg gctagtattg aggtccctga 8700

ttcaactaac aaattccgga agattgaaaa gaagatccag attcacaaca caagatatgg 8760

agacctgttc acaaagctgt gcgtgcaagt tgagaagaaa ttgctagggt catctctgtc 8820

taataatgtc ccacgatcag aggaattcaa cagcatccgt acagatccgg cattctggtt 8880

tcactcaaaa tggtccagag ccaagttcgc gtggctccat ataaaacaag tccaaaggca 8940

tctgattgta gcagcaagga caaggtctgc agtcaacaag ttagtaacat taaatcataa 9000

gataggccat gtctttatta ctcctgagct tgtcattgtg acacacacag acgagaacaa 9060

gttcacatgt ctcacccagg aacttgtatt gatgtatgcg gatatgatgg aaggcaggga 9120

catggtcaat ataatatctt ctacagcagc acatctcagg aacctatccg agaaaattga 9180

tgatattctg cggttagtag atgctctggc aaaggactta ggtaatcaag tctatgatgt 9240

tgtagcatta atggagggat ttgcatacgg tgccgttcag ctgcttgagc catcaggtac 9300

atttgcagga gatttctttg catttaacct acaggagctc aaaaacacgt taatcgaact 9360

tctccccaat aatatagcgg aagcagtaac tcacgctatt gccactgtat tctctggatt 9420

agaacagaac caagcagctg agatgttgtg cttgctgcgt ttgtggggtc atccattgct 9480

tgagtctcgt agtgcagcaa gagcagtcag gagccagatg tgcgcaccaa agatggtaga 9540

ctttgatatg atcctccagg tattatcttt ctttaaagga acaatcatca atggatacag 9600

aaaaaagaac tcaggtgtgt ggccacgcgt caaagtagat acaatatatg gaaatatcat 9660

tgggcagcta catgctgatt cagcagagat ctcacatgat gtcatgttga gggagtacaa 9720

gagtttatcc gctcttgaat ttgagccatg tatagattat gaccctgtta ccaatctaag 9780

catgttccta aaagacaagg caatcgcaca tcctagtgat aactggctcg cctcatttag 9840

gcggaaccta ctctctgagg accagaagaa acagataaag gaggcaactt caactaaccg 9900

cctcctgata gagttcttag aatcaaatga ttttgatcca tataaagaaa tggaatacct 9960

gacaaccctc gagtacctaa gagatgacag tgtggcagta tcgtactcac tcaaagagaa 10020

agaggtgaaa gtgaatggac ggatttttgc taaattaaca aagaaactaa ggaattgcca 10080

ggtaatggca gaaggaattc tagctgacca gattgcacct ttcttccagg gaaatggggt 10140

cattcaagat agcatatcct tgacaaagag tatgttagca atgagtcaac tgtcctttaa 10200

cagcaataag aaacgtatcg ctgactgcaa agagagggtt tcctcaaacc gcaatcatga 10260

tcccaagagc aagaatcgta gaagagttgc cacctttatc acgactgacc tacaaaagta 10320

ttgtcttaac tggagatatc agacagtcaa actattcgcc catgccatca atcagctgat 10380

gggcctacct catttctttg agtggattca tcttaggctg atggacacta caatgtttgt 10440

aggggatcct ttcaatcctc caagtgaccc gaccgactgt gatctatcaa gagtcccaaa 10500

tgatgatata tatattgtca gtgctagagg gggcattgag ggactctgtc agaagctatg 10560

gacgatgatc tcaattgctg caatccaact tgccgcagca agatctcatt gtcgagttgc 10620

ctgcatggta caaggtgaca atcaagtaat agctgtaacg agagaggtga gatcagatga 10680

ttccccggat atggtattga cgcagttgca tcaggctagt gataatttct tcaaggaatt 10740

gattcatgtc aatcatctga ttggccataa cctgaaggat cgtgaaacca ttagatcaga 10800

cacattcttc atatacagca aacgaatatt caaagatgga gcaatactca gtcaggtcct 10860

caaaaattca tctaaattgg tgctaatatc aggtgacctt agcgaaaaca ctgtaatgtc 10920

ctgtgccaac attgcatcca ctgtagcacg actatgtgag aatgggcttc ctaaggactt 10980

ctgttactat ttgaactacc taatgagttg cgtgcagaca tattttgatt cagagttttc 11040

tattactcac agctcacagt cagattccaa ccagtcctgg attgaggata tctctttcgt 11100

acactcatac gtgttaaccc ctgcccaact ggggggactg agtaaccttc aatactcaag 11160

gctctacaca aggaatattg gcgacccagg gaccactgcc tttgcagagg tcaagcgact 11220

agaagcagtg gggttgttga gtcccagcat catgactaac atcttaacca ggccacctgg 11280

caatggagat tgggccagcc tatgcaacga cccatactct tttaattttg agactgttgc 11340

aagcccaaat attgtcctca agaaacatac acagaaagtc ctatttgaga catgttcaaa 11400

ccctttatta tccggggtac atacagagga caatgaggca gaagagaaag cattggctga 11460

attcttactc aatcaagaag tgattcaccc acgtgtcgca catgctatca tggaagcaag 11520

ctctgtgggt aggagaaagc aaattcaagg gcttgttgac acaacgaaca ctgtgattaa 11580

gattgcactg actaggaggc ccctcggtat caaaagactg atgcggataa tcaattactc 11640

aagcatgcat gcaatgttgt tcagggatga tattttctta tccactagat ccaaccaccc 11700

attagtttct tctaatatgt gctcgctgac gctagcagat tatgctcgga acagaagctg 11760

gtcacccctg acagggggca ggaaaatact gggtgtatcc aaccccgata ccatagaact 11820

tgtggaggga gagattctca gcgtcagtgg agggtgcaca aaatgtgaca gcggagatga 11880

gcagtttact tggttccatc ttccaagcaa tatagagttg actgatgaca ccagcaaaaa 11940

tcccccgatg agagtgccat atctcgggtc gaagactcaa gagagaagag ccgcctcact 12000

tgcgaaaata gcccatatgt caccacatgt gaaagcagca ctaagggcat catccgtgtt 12060

aatctgggct tatggggaca atgaagtgaa ctggactgct gctcttaata ttgcaaggtc 12120

tcgatgcaac ataagctcag agtatcttcg gctattgtca cccctgccca cagctgggaa 12180

tctccaacat agattggatg atggcataac ccagatgaca tttacccctg catctctcta 12240

cagagtgtcg ccttacattc acatatccaa tgattctcaa aggctgttca ccgaagaagg 12300

ggtcaaagag ggaaacgtgg tttaccagca aattatgctc ttgggtttat ctctaattga 12360

gtcactcttc ccaatgacaa caaccagaac atacgatgag atcacattac acctccacag 12420

taaatttagc tgctgtatcc gagaagcgcc tgtcgcagtt cctttcgagc tcctcggact 12480

ggtaccggaa ttaaggatgg taacctcaaa taagttcatg tatgatccta gccctatatc 12540

agagagggat tttgcgagac ttgacttagc tatattcaag agttatgagc ttaacttgga 12600

atcatatccc acgctggagc taatgaacat tctttcgata tctagcggga aattgattgg 12660

ccaatctgtg gtttcttatg atgaagatac ttctataaag aatgatgcta taatagtgta 12720

tgacaacaca cggaattgga ttagtgaggc acagaactca gatgtggtcc gcctgtttga 12780

gtatgcagca ctcgaagtgc tcctcgactg tgcttatcaa ctctactatc tgagggtaag 12840

gggtctaaac aacatcgtcc tatacatgaa tgacttatat aagaacatgc cagggatcct 12900

actctccaat attgcagcca cgatatccca ccccctcatt cactcaaggt tgaatgcagt 12960

aggtctaatt aatcatgacg ggtcacacca gcttgcagat atagactttg tcgaggtgtc 13020

tgcgaaattg ttagtctcct gcactcgacg cgtggtctca ggtttatatg cagggagtaa 13080

gtatgatctg ctgtttccat ctgtcttaga tgataacctg aatgagaaga tgcttcaact 13140

aatttcccgg ttatgctgct tgtacacagt gctctttgct acaacaagag aaatcccaaa 13200

aataaggggc ctatcagcag aagagaaatg ctcaatactc actgagtatc tattgtcgga 13260

tgctgtaaaa ccgttgctta ggtccgaaca attgagttct atcatgtctc ccaacataat 13320

cacgttccca gccaatctat actacatgtc taggaagagc cttaatttga tcagagaacg 13380

agaggacaga gatactatct tgtcgttgtt gttccctcag gagtcactgc ttgagcttcg 13440

cccagtacgg gacattggtg ctcgagtgaa agacccgttt acccgacaac ccgcatcttt 13500

catacaagag ctggatctga gtgccccagc aaggtacgac gcgtttacac tgagtaagat 13560

ttgcttcgag cacacactac cgaacccaag ggaagattac ctagtacgat acttgttcag 13620

aggagtaggg actgcttcat cttcttggta taaggcgtct catcttctat ccatatctga 13680

ggttaggtgt gcaagacatg ggaactcttt atacttagcg gaaggaagcg gagccatcat 13740

gagtcttctt gaattgcata taccacatga gaccatctat tacaatacac ttttctcgaa 13800

tgagatgaac cctccacagc ggcatttcgg acctacacca acacagtttc taaactcggt 13860

cgtttatagg aatctacaag cggaagtgcc atgtaaagat ggatatgtcc aggagttcta 13920

tccattatgg agagagaatg cagaagaaag tgatctgacc tcagataagg cagttggata 13980

tatcacatct gtagtaccct acaggtctgt atcattacta cattgtgaca ttgagattcc 14040

tccagggtcc agtcaaagct tattagatca actggctact aatttatccc tgattgccat 14100

gcattctgtg agagagggcg gggtagtgat catcaaggta ctgtatgcaa tggggtacta 14160

cttccactta ctcatgaatt tattcactcc atgttccacg aaaggataca tactttccaa 14220

tggctacgcc tgtagagggg atatggagtg ttacctgata ttcgttatgg gctgcttagg 14280

cgggcccact ttcgtgcacg aagtggtaag gatggcaaaa gctctaatac aacgacacgg 14340

tacacttcta tctaaatcag atgaaatcac attgactaag ctatttacct cacagcagcg 14400

tcgtgtaaca gatctcctat ccagcccttt accgaagcta atgaggctct taagtgaaaa 14460

cattgatgct gcactaattg aagccggggg acagcccgtc cgtccatttt gtgcagaaag 14520

tttggtgagc acactaacaa atacgaccca gacaactctg atcattgcca gccacattga 14580

cacagtcatc cggtccgtga tttacatgga ggctgagggt gacctcgccg acacagtgtt 14640

cttattaact ccttacaatc tatccacaga cggtaaaaag agaacatcac ttaagcagtg 14700

caccaaacag atcttggaag tcacaatatt gggtctcaga gccaaagaca tcaataaaat 14760

aggtgatgta atcagcttag tactcagagg tgcgatttcc ctagaggacc tcatcccatt 14820

aaggacatac ctgaagcaca gtacctgtcc taaatacctg aaagcggtcc taggtattac 14880

taagctcaaa gaaatgttca caggtacttc gttattgtac ttgactcgcg ctcaacaaaa 14940

attctacatg aaaactatag gtaatgctgc caagggatat tacagtaata atgactctta 15000

aaggcaatcg tacaccaatc agttatcttc ttaactgatg actccctcat tgacttgatt 15060

ataccagatt agaaaaaagt taaattctga ctctttggaa ctcgtattcg gattcagtta 15120

gttaacttta agcaaaaatg cgcaaagtcg tctctaatca cagctatgtc attcaccaaa 15180

tctctgtttg gt 15192

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 2

ccttgcagct gcaggaattg 20

<210> 3

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 3

gctctataca gtatgaggtg tcaag 25

<210> 4

<211> 19

<212> DNA

<213> Artificial sequence ()

<400> 4

ggatggttgg gaggacgac 19

<210> 5

<211> 19

<212> DNA

<213> Artificial sequence ()

<400> 5

gcaactgcgt caacaccat 19

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence ()

<400> 6

gttagcaatg agtcaactgt cc 22

<210> 7

<211> 22

<212> DNA

<213> Artificial sequence ()

<400> 7

cttcttcggt gaacagcctt tg 22

<210> 8

<211> 19

<212> DNA

<213> Artificial sequence ()

<400> 8

ctacagagtg tcgccttac 19

<210> 9

<211> 21

<212> DNA

<213> Artificial sequence ()

<400> 9

ggtaaagggc tggataggag a 21

<210> 10

<211> 21

<212> DNA

<213> Artificial sequence ()

<400> 10

tctccaatgg ctatgcctgt a 21

<210> 11

<211> 29

<212> DNA

<213> Artificial sequence ()

<400> 11

gcgcaccaaa cagagatttg gtgaatgac 29

<210> 12

<211> 17

<212> DNA

<213> Artificial sequence ()

<400> 12

tgggagtgga gaaggac 17

<210> 13

<211> 17

<212> DNA

<213> Artificial sequence ()

<400> 13

gttatctgtg ccgctgt 17

<210> 14

<211> 16

<212> DNA

<213> Artificial sequence ()

<400> 14

gactccattc gcaaga 16

<210> 15

<211> 16

<212> DNA

<213> Artificial sequence ()

<400> 15

cattctccag cacgac 16

<210> 16

<211> 19

<212> DNA

<213> Artificial sequence ()

<400> 16

ccgataacct gtcaagtag 19

<210> 17

<211> 17

<212> DNA

<213> Artificial sequence ()

<400> 17

gtcagcattg tcggatt 17

<210> 18

<211> 16

<212> DNA

<213> Artificial sequence ()

<400> 18

gaacaagccg caaggg 16

<210> 19

<211> 32

<212> DNA

<213> Artificial sequence ()

<400> 19

catctgcaga cagtcccact ggtctcaagt at 32

<210> 20

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 20

catacttgag accagtggga ctgtc 25

<210> 21

<211> 18

<212> DNA

<213> Artificial sequence ()

<400> 21

caggagcctg ctatgagt 18

<210> 22

<211> 24

<212> DNA

<213> Artificial sequence ()

<400> 22

accaaacaga gaatccgtga ggta 24

<210> 23

<211> 17

<212> DNA

<213> Artificial sequence ()

<400> 23

tcagtacccc cagtcag 17

<210> 24

<211> 17

<212> DNA

<213> Artificial sequence ()

<400> 24

gtaaaacgac ggccagt 17

<210> 25

<211> 17

<212> DNA

<213> Artificial sequence ()

<400> 25

caggaaacag ctatgac 17

<210> 26

<211> 40

<212> DNA

<213> Artificial sequence ()

<400> 26

atatgaattc gccaccatgg ctacctttac agatgcggag 40

<210> 27

<211> 29

<212> DNA

<213> Artificial sequence ()

<400> 27

tatactcgag tcaaccattc agcgcaagg 29

<210> 28

<211> 44

<212> DNA

<213> Artificial sequence ()

<400> 28

accggaattc gccaccatgt cgtctgtttt tgacgaatac gagc 44

<210> 29

<211> 32

<212> DNA

<213> Artificial sequence ()

<400> 29

atatctcgag tcagtacccc cagtcagtgt cg 32

<210> 30

<211> 49

<212> DNA

<213> Artificial sequence ()

<400> 30

actcactata gggcgaattc ggatccgcca tgaacacgat taacatcgc 49

<210> 31

<211> 50

<212> DNA

<213> Artificial sequence ()

<400> 31

taagatctgg taccgagctc ctgcagttac gcgaacgcga agtccgactc 50

<210> 32

<211> 2652

<212> DNA

<213> Artificial sequence ()

<400> 32

atgaacacga ttaacatcgc taagaacgac ttctctgaca tcgaactggc tgctatcccg 60

ttcaacactc tggctgacca ttacggtgag cgtttagctc gcgaacagtt ggcccttgag 120

catgagtctt acgagatggg tgaagcacgc ttccgcaaga tgtttgagcg tcaacttaaa 180

gctggtgagg ttgcggataa cgctgccgcc aagcctctca tcactaccct actccctaag 240

atgattgcac gcatcaacga ctggtttgag gaagtgaaag ctaagcgcgg caagcgcccg 300

acagccttcc agttcctgca agaaatcaag ccggaagccg tagcgtacat caccattaag 360

accactctgg cttgcctaac cagtgctgac aatacaaccg ttcaggctgt agcaagcgca 420

atcggtcggg ccattgagga cgaggctcgc ttcggtcgta tccgtgacct tgaagctaag 480

cacttcaaga aaaacgttga ggaacaactc aacaagcgcg tagggcacgt ctacaagaaa 540

gcatttatgc aagttgtcga ggctgacatg ctctctaagg gtctactcgg tggcgaggcg 600

tggtcttcgt ggcataagga agactctatt catgtaggag tacgctgcat cgagatgctc 660

attgagtcaa ccggaatggt tagcttacac cgccaaaatg ctggcgtagt aggtcaagac 720

tctgagacta tcgaactcgc acctgaatac gctgaggcta tcgcaacccg tgcaggtgcg 780

ctggctggca tctctccgat gttccaacct tgcgtagttc ctcctaagcc gtggactggc 840

attactggtg gtggctattg ggctaacggt cgtcgtcctc tggcgctggt gcgtactcac 900

agtaagaaag cactgatgcg ctacgaagac gtttacatgc ctgaggtgta caaagcgatt 960

aacattgcgc aaaacaccgc atggaaaatc aacaagaaag tcctagcggt cgccaacgta 1020

atcaccaagt ggaagcattg tccggtcgag gacatccctg cgattgagcg tgaagaactc 1080

ccgatgaaac cggaagacat cgacatgaat cctgaggctc tcaccgcgtg gaaacgtgct 1140

gccgctgctg tgtaccgcaa ggacaaggct cgcaagtctc gccgtatcag ccttgagttc 1200

atgcttgagc aagccaataa gtttgctaac cataaggcca tctggttccc ttacaacatg 1260

gactggcgcg gtcgtgttta cgctgtgtca atgttcaacc cgcaaggtaa cgatatgacc 1320

aaaggactgc ttacgctggc gaaaggtaaa ccaatcggta aggaaggtta ctactggctg 1380

aaaatccacg gtgcaaactg tgcgggtgtc gataaggttc cgttccctga gcgcatcaag 1440

ttcattgagg aaaaccacga gaacatcatg gcttgcgcta agtctccact ggagaacact 1500

tggtgggctg agcaagattc tccgttctgc ttccttgcgt tctgctttga gtacgctggg 1560

gtacagcacc acggcctgag ctataactgc tcccttccgc tggcgtttga cgggtcttgc 1620

tctggcatcc agcacttctc cgcgatgctc cgagatgagg taggtggtcg cgcggttaac 1680

ttgcttccta gtgaaaccgt tcaggacatc tacgggattg ttgctaagaa agtcaacgag 1740

attctacaag cagacgcaat caatgggacc gataacgaag tagttaccgt gaccgatgag 1800

aacactggtg aaatctctga gaaagtcaag ctgggcacta aggcactggc tggtcaatgg 1860

ctggcttacg gtgttactcg cagtgtgact aagcgttcag tcatgacgct ggcttacggg 1920

tccaaagagt tcggcttccg tcaacaagtg ctggaagata ccattcagcc agctattgat 1980

tccggcaagg gtctgatgtt cactcagccg aatcaggctg ctggatacat ggctaagctg 2040

atttgggaat ctgtgagcgt gacggtggta gctgcggttg aagcaatgaa ctggcttaag 2100

tctgctgcta agctgctggc tgctgaggtc aaagataaga agactggaga gattcttcgc 2160

aagcgttgcg ctgtgcattg ggtaactcct gatggtttcc ctgtgtggca ggaatacaag 2220

aagcctattc agacgcgctt gaacctgatg ttcctcggtc agttccgctt acagcctacc 2280

attaacacca acaaagatag cgagattgat gcacacaaac aggagtctgg tatcgctcct 2340

aactttgtac acagccaaga cggtagccac cttcgtaaga ctgtagtgtg ggcacacgag 2400

aagtacggaa tcgaatcttt tgcactgatt cacgactcct tcggtaccat tccggctgac 2460

gctgcgaacc tgttcaaagc agtgcgcgaa actatggttg acacatatga gtcttgtgat 2520

gtactggctg atttctacga ccagttcgct gaccagttgc acgagtctca attggacaaa 2580

atgccagcac ttccggctaa aggtaacttg aacctccgtg acatcttaga gtcggacttc 2640

gcgttcgcgt aa 2652

<210> 33

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 33

gcaacgtgct ggttattgtg 20

<210> 34

<211> 24

<212> DNA

<213> Artificial sequence ()

<400> 34

gaagtccgac tctaagatgt cacg 24

<210> 35

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 35

ggacagttga ctcattgcta acata 25

<210> 36

<211> 49

<212> DNA

<213> Artificial sequence ()

<400> 36

actcactata gggcgaattc ggatccggat ggttgggagg acgacattg 49

<210> 37

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 37

tatgttagca atgagtcaac tgtcc 25

<210> 38

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 38

gtgaatgtaa ggcgacactc tgtag 25

<210> 39

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 39

ctacagagtg tcgccttaca ttcac 25

<210> 40

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 40

cgaatatcag gtaacactcc atatc 25

<210> 41

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 41

gatatggagt gttacctgat attcg 25

<210> 42

<211> 48

<212> DNA

<213> Artificial sequence ()

<400> 42

taagatctgg taccgagctc ctgcaggcgc accaaacaga gatttggt 48

<210> 43

<211> 71

<212> DNA

<213> Artificial sequence ()

<400> 43

attgcatcaa cgcatatagc gctagcgcga tgtaccgcgg atcgttacca aacagagaat 60

ccgtgaggta c 71

<210> 44

<211> 26

<212> DNA

<213> Artificial sequence ()

<400> 44

catctggttg cccttgcggc ttgttc 26

<210> 45

<211> 26

<212> DNA

<213> Artificial sequence ()

<400> 45

gaacaagccg caagggcaac cagatg 26

<210> 46

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 46

gacagtccca ctggtctcaa gtatg 25

<210> 47

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 47

catacttgag accagtggga ctgtc 25

<210> 48

<211> 52

<212> DNA

<213> Artificial sequence ()

<400> 48

tgtttgacag cttatcatcg ataagcttcc tccatcatag acatcatcgc ct 52

<210> 49

<211> 50

<212> DNA

<213> Artificial sequence ()

<400> 49

attgcatcaa cgcatatagc gctagcaggc gatgatgtct atgatggagg 50

<210> 50

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 50

gacagtgtcc ttctccactc ccatg 25

<210> 51

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 51

catgggagtg gagaaggaca ctgtc 25

<210> 52

<211> 26

<212> DNA

<213> Artificial sequence ()

<400> 52

gacccttgga tcttgcgaat ggagtc 26

<210> 53

<211> 26

<212> DNA

<213> Artificial sequence ()

<400> 53

gactccattc gcaagatcca agggtc 26

<210> 54

<211> 24

<212> DNA

<213> Artificial sequence ()

<400> 54

gtctcctact tgacaggtta tcgg 24

<210> 55

<211> 24

<212> DNA

<213> Artificial sequence ()

<400> 55

ccgataacct gtcaagtagg agac 24

<210> 56

<211> 53

<212> DNA

<213> Artificial sequence ()

<400> 56

tgtttgacag cttatcatcg ataagcttgt gcgatgtcac tgggtgaatt agg 53

<210> 57

<211> 51

<212> DNA

<213> Artificial sequence ()

<400> 57

attgcatcaa cgcatatagc gctagcccta attcacccag tgacatcgca c 51

<210> 58

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 58

cgcaatgtcg tcctcccaac catcc 25

<210> 59

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 59

ggatggttgg gaggacgaca ttgcg 25

<210> 60

<211> 89

<212> DNA

<213> Artificial sequence ()

<400> 60

ttgacagctt atcatcgata agcttgcgat gagcggccgc tccattaata cgactcacta 60

taggaccaaa cagagatttg gtgaatgac 89

<210> 61

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 61

atcggtagaa ggttccctca ggttc 25

<210> 62

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 62

ggtcctatag tgagtcgtat taatg 25

<210> 63

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 63

gaaattgcat caacgcatat agcgc 25

<210> 64

<211> 735

<212> DNA

<213> Artificial sequence ()

<400> 64

atgagcagcg tctttgatga gtatgagcag ctcctcgcag cacagaccag accaaatggg 60

gcacatgggg ggggggagaa ggggagcacc ctcaaggtcg aggtcccagt ctttaccctc 120

aatagcgatg atccagagga tagatggaat tttgcagtct tttgcctcag aatcgcagtc 180

agcgaggatg caaataagcc actcagacag ggggcactca tcagcctcct ctgcagccat 240

agccaggtca tgagaaatca tgtcgcactc gcagggaagc agaatgaggc aaccctcgca 300

gtcctcgaga tcgatgggtt tgcaaataat gtcccacagt ttaataatag aagcggggtc 360

agcgaggaga gagcacagag atttatggtc atcgcaggga gcctcccaag agcatgcagc 420

aatgggaccc catttgtcac cgcaggggtc gaggatgatg caccagagga tatcaccgat 480

accctcgaga gaatcctcag cgtccaggtc caggtctggg tcaccgtcgc aaaggcaatg 540

accgcatatg agaccgcaga tgagagcgag accagaagaa tcaataagta tatgcagcag 600

gggagagtcc agaagaagta tatcctccat ccagtctgca gaagcgcaat ccagctcatc 660

atcagacata gcctcgcagt cagaatcttt ctcgtcagcg agctcaagag agggagaaat 720

accgcagggg ggagc 735

<210> 65

<211> 735

<212> DNA

<213> Artificial sequence ()

<400> 65

atgagcagcg tctttgacga gtacgagcag ctcctcgcag cacagaccag accaaatggg 60

gcacatgggg ggggggagaa ggggagcacc ctcaaggtcg aggtcccagt ctttaccctc 120

aatagcgatg atccagagga tagatggaat tttgcagtct tttgcctcag aatcgcagtc 180

agcgaggatg caaataagcc actcagacag ggggcactca tcagcctcct ctgcagccat 240

agccaggtca tgagaaatca tgtcgcactc gcagggaagc agaatgaggc aaccctcgca 300

gtcctcgaga tcgatgggtt tgcaaataat gtcccacagt ttaataatag aagcggggtc 360

agcgaggaga gagcacagag atttatggtc atcgcaggga gcctcccaag agcatgcagc 420

aatgggaccc catttgtcac cgcaggggtc gaggatgatg caccagagga tatcaccgat 480

accctcgaga gaatcctcag cgtccaggtc caggtctggg tcaccgtcgc aaaggcaatg 540

accgcatatg agaccgcaga tgagagcgag accagaagaa tcaataagta tatgcagcag 600

gggagagtcc agaagaagta tatcctccat ccagtctgca gaagcgcaat ccagctcatc 660

atcagacata gcctcgcagt cagaatcttt ctcgtcagcg agctcaagag agggagaaat 720

accgcagggg ggagc 735

<210> 66

<211> 1484

<212> DNA

<213> Artificial sequence ()

<400> 66

cgtacgggta gaaggtgtga accccgaacg cgagatcgaa gcttgaacct gagggaacct 60

tctaccgata tgagcagcgt ctttgacgag tacgagcagc tcctcgcagc acagaccaga 120

ccaaatgggg cacatggggg gggggagaag gggagcaccc tcaaggtcga ggtcccagtc 180

tttaccctca atagcgatga tccagaggat agatggaatt ttgcagtctt ttgcctcaga 240

atcgcagtca gcgaggatgc aaataagcca ctcagacagg gggcactcat cagcctcctc 300

tgcagccata gccaggtcat gagaaatcat gtcgcactcg cagggaagca gaatgaggca 360

accctcgcag tcctcgagat cgatgggttt gcaaataatg tcccacagtt taataataga 420

agcggggtca gcgaggagag agcacagaga tttatggtca tcgcagggag cctcccaaga 480

gcatgcagca atgggacccc atttgtcacc gcaggggtcg aggatgatgc accagaggat 540

atcaccgata ccctcgagag aatcctcagc gtccaggtcc aggtctgggt caccgtcgca 600

aaggcaatga ccgcatatga gaccgcagat gagagcgaga ccagaagaat caataagtat 660

atgcagcagg ggagagtcca gaagaagtat atcctccatc cagtctgcag aagcgcaatc 720

cagctcatca tcagacatag cctcgcagtc agaatctttc tcgtcagcga gctcaagaga 780

gggagaaata ccgcaggggg gagctctaca tattacaatt tggtcgggga tgtagactca 840

tacatcagaa ataccgggct tactgcgttt ttcctaacac tcaaatatgg aatcaatacc 900

aagacgtcag ctctcgcact cagcagcctc acaggtgata tccaaaaaat gaaacagctc 960

atgcgtttat atcggatgaa aggtgaaaat gcaccataca tgacattgtt aggtgacagt 1020

gaccagatga gctttgcgcc agccgaatat gcacaacttt attcttttgc catgggcatg 1080

gcatcagtct tagataaggg aactggcaag taccaatttg ccagggactt tatgagcaca 1140

tcattctggc gacttggagt agagtatgct caggctcagg gaagtagtat caatgaagac 1200

atggctgctg agttaaaact aaccccagca gcaaggagag gcctggcagc tgctgcccaa 1260

cgagtatctg aagaaatcgg cagcatggac attcctactc aacaagcagg agtcctcacc 1320

gggctcagtg acgaaggccc ccgaactcca cagggtggat cgaacaagcc gcaagggcaa 1380

ccagatgctg gggatgggga gacccaattc ctggatttta tgagaacagt ggcgaacagc 1440

atgcgggaat cgcctaatcc tgcacagagc accactcatc taga 1484

Claims (4)

1. A rescue method of a codon-replaced gene VII type newcastle disease virus is characterized by comprising the following steps:

(1) Cloning NP gene, P gene and L gene of newcastle disease virus into pXJ vector to obtain auxiliary plasmids pXJ-NP, pXJ40-P and pXJ-L;

(2) Cloning a gene capable of expressing T7 RNA polymerase DE3 in cells into a pXJ vector to obtain a plasmid pXJ-DE 3; the sequence of the DE3 gene is shown as SEQ ID NO: shown at 32;

(3) Cloning the whole genome cDNA of the newcastle disease virus into a plasmid pBR322 to obtain a whole genome expression vector pBR322-DHN3;

the whole genome expression vector pBR322-DHN3 is obtained by the following method:

(1) Establishment of pBR322-Base vector: artificially synthesizing gene fragments sequentially containing HC-1, T7 promoter, HDV ribozyme, T7 terminator and HC-2, and inserting the gene fragments into a pBR322 vector to obtain a basic plasmid pBR322-Base; the sequence HC-1 downstream of the T7 promoter corresponds to the sequence table SEQ ID NO:1 is 15159-15192nt, the sequence HC-2 upstream of the HDV ribozyme corresponds to the sequence table SEQ ID NO:1 is 1-141nt to provide two homology arms required for recombination;

(2) Constructing a transition carrier: the transition vector is plasmid pBR322-PNP, plasmid pBR322-PDP, plasmid pBR322-LPD3; the plasmid pBR322-PNP is composed of a segment NP, MINI, P; the plasmid pBR322-PDP is composed of fragments P, PD, PD2 and PD3; the plasmid pBR322-LPD3 is composed of fragments PD3, L1, L2, L3 and L4;

(3) Construction of viral whole genome DHN3-a: the plasmid pBR322-PNP, the plasmid pBR322-PDP and the plasmid pBR322-LPD3 are subjected to enzyme digestion to obtain fragments PNP, PDP and LPD3, and the fragments PNP, PDP and LPD3 are connected through T4 ligase to obtain virus whole genome DHN3-A;

(4) Construction of plasmid fragments with homology arms: amplifying by using the pBR322-Base vector in the step (1) as a template and using primers A2-F and A2-R containing homology arms to obtain plasmid fragments with homology arms;

the primer sequences are as follows:

A2-F:ATCGGTAGAAGGTTCCCTCAGGTTC；

A2-R:GGTCCTATAGTGAGTCGTATTAATG；

(5) Constructing a DHN3 whole genome expression vector pBR322-DHN3; carrying out homologous recombination on the plasmid fragment in the step (4) and the viral whole genome DHN3-A in the step (3) to obtain a whole genome expression vector pBR322-DHN3;

the fragment MINI is shown in a sequence table SEQ ID NO: the position in 1 is 1414-1949nt; fragment PD1 is set forth in the sequence listing SEQ ID NO: 1. the middle position is 2935-4956nt; fragment PD2 is set forth in the sequence listing SEQ ID NO:1 at 4838-6454nt; fragment PD3 is set forth in the sequence listing SEQ ID NO: the position in 1 is 6261-8283nt; fragment L1 is set forth in the sequence listing SEQ ID NO:1 is 8166-10709nt; fragment L2 is shown in sequence listing SEQ ID NO:1 is 10174-12299nt; fragment L3 is set forth in the sequence listing SEQ ID NO: position 12238-14433nt; fragment L4 is set forth in the sequence listing SEQ ID NO:1 are positioned 14214-15192nt;

(4) Counting the use frequency of codons for encoding each amino acid in the NP gene of the newcastle disease virus, then replacing a codon part for encoding the corresponding amino acid with a codon with highest use frequency to obtain an NP gene sequence after the codon replacement, and replacing the NP gene sequence after the replacement on a pBR322-DHN3 plasmid to form a new plasmid pBR322-mNPDH 3;

The step (4) specifically comprises the following steps:

(1) Use of the genome-wide expression vector pBR322-DHN3BsiWIAndXbaIdouble enzyme cutting to recover target segment of 18141bp length;BsiWIlocated at positions 4416-4421 of pBR322-DHN3,XbaIlocated at positions 5894-5899 of pBR322-DHN 3;

(2) Artificial synthesis of the sequence containing the substituted NP GeneBsiWIAndXbaIthe sequence of the artificially synthesized fragment obtained by the double enzyme cutting sites is shown as SEQ ID NO: indicated at 66;

(3) Connecting the target fragment in the step (1) with the fragment synthesized in the step (2) to obtain pBR322-mNPDHN3 plasmid;

(5) Adopting three helper plasmids pXJ-NP, pXJ40-P and pXJ-L of the step (1), and co-transfecting BHK-21 cells with the plasmid pXJ-DE 3 of the step (2) and the plasmid pBR322-mNPDH 3 of the step (4) to obtain the rescue virus rDHN3-mNP;

the newcastle disease virus is a gene VII type newcastle disease virus, and the whole genome cDNA sequence of the newcastle disease virus is shown in a sequence table SEQ ID NO:1, a step of; NP gene is shown in SEQ ID NO: 1-1591nt; the P gene is shown in a sequence table SEQ ID NO:1 is 1925-3109nt; the L gene is shown in a sequence table SEQ ID NO: positions 8166-15192nt in 1.

2. The method for rescuing the codon-substituted gene VII type newcastle disease virus according to claim 1, wherein the helper plasmid pXJ-NP and pXJ40-P is obtained by the following method:

(1) UsingEcoRⅠAndXhoⅠdouble digestion of pXJ plasmid, using the excised fragments as plasmid fragments for construction of pXJ40-NP and pXJ-P;

(2) NP gene was amplified using primers pXJ40-NP-F and pXJ40-NP-R, P gene was amplified using primers pXJ40-P-F and pXJ-P-R, and the amplified product was then usedEcoRⅠAndXhoⅠperforming double enzyme digestion;

(3) The plasmid fragment in the step (1) is respectively connected with the NP gene sequence and the P gene sequence after enzyme digestion in the step (2) to obtain auxiliary plasmids pXJ-NP and pXJ-P;

the two pairs of primer sequences were as follows:

pXJ40-NP-F：ACCGGAATTCGCCACCATGTCGTCTGTTTTTGACGAATACGAGC；

pXJ40-NP-R：ATATCTCGAGTCAGTACCCCCAGTCAGTGTCG；

pXJ40-P-F：ATATGAATTCGCCACCATGGCTACCTTTACAGATGCGGAG；

pXJ40-P-R：TATACTCGAGTCAACCATTCAGCGCAAGG。

3. the method for rescuing the gene VII type newcastle disease virus by codon substitution according to claim 1, wherein the helper plasmid pXJ-L is obtained by:

(1) UsingBamHIAndPstIdouble-restriction enzyme cutting of pXJ plasmid, taking the cut fragments as plasmid fragments for constructing pXJ-40-L;

(2) Designing four pairs of specific primers with homologous recombination sequences, and respectively amplifying gene fragments L1, L2, L3 and L4 covering the complete sequence of the L gene, wherein the 5' -end of the fragment L1 is provided with a primer sequence corresponding to pXJ40 BamHIThe 3' -end of fragment L4 carries a homology arm to pXJ40PstIHomology arms of terminal homology;

(3) Adding the L1, L2, L3 and L4 gene fragments in the step (2) and the vector pXJ plasmid fragments after double enzyme digestion in the step (1) together, and carrying out homologous recombination under the action of recombinase to obtain an auxiliary plasmid pXJ-L;

The gene fragment L1 is shown in a sequence table SEQ ID NO:1 is 8166-10709nt; the gene fragment L2 is shown in a sequence table SEQ ID NO:1 is 10174-12299nt; the gene fragment L3 is shown in a sequence table SEQ ID NO: position 12238-14433nt; the gene fragment L4 is shown in a sequence table SEQ ID NO:1 are positioned 14214-15192nt;

the four pairs of specific primer sequences with homologous recombination sequences are respectively as follows:

pXJ40-L1-F：5’-ACTCACTATAGGGCGAATTCGGATCCGGATGGTTGGGAGGACGACATTG-3’；

pXJ40-L1-R：5’-GGACAGTTGACTCATTGCTAACATA-3’；

pXJ40-L2-F：5’-TATGTTAGCAATGAGTCAACTGTCC-3’；

pXJ40-L2-R：5’-GTGAATGTAAGGCGACACTCTGTAG-3’；

pXJ40-L3-F：5’-CTACAGAGTGTCGCCTTACATTCAC-3’；

pXJ40-L3-R：5’-CGAATATCAGGTAACACTCCATATC-3’；

pXJ40-L4-F：5’-GATATGGAGTGTTACCTGATATTCG-3’；

pXJ40-L4-R：5’-TAAGATCTGGTACCGAGCTCCTGCAGGCGCACCAAACAGAGATTTGGT-3’。

4. the method for rescuing the codon-substituted gene VII type newcastle disease virus according to claim 1, wherein the plasmid pXJ-DE 3 is obtained by the following method:

(1) UsingBamHIAndPstIdouble digestion of pXJ plasmid, taking the cut fragments as plasmid fragments for construction of pXJ40-DE3;

(2) Primers pXJ-DE 3-F and pXJ-DE 3-R were designed to amplify a gene sequence DE3 capable of expressing T7 RNA polymerase from E.coli BL 21;

(3) Homologous recombination is carried out on the plasmid fragment cut out in the step (1) and the DE3 gene in the step (2) under the action of recombinase to obtain plasmid pXJ-DE 3;

the primer sequences are as follows:

pXJ40-DE3-F：ACTCACTATAGGGCGAATTCGGATCCGCCATGAACACGATTAACATCGC；

pXJ40-DE3-R：TAAGATCTGGTACCGAGCTCCTGCAGTTACGCGAACGCGAAGTCCGACTC。

Images