CN111926025A - Rescue method of gene VII type Newcastle disease virus through codon replacement - Google Patents

Abstract

The invention relates to the technical field of reverse genetic operation, and discloses a rescue method of a gene VII type Newcastle disease virus through codon replacement. Respectively cloning NP, P and L genes of the Newcastle disease virus and DE3 gene expressing T7RNA polymerase into a pXJ40 vector to obtain plasmids pXJ40-NP, pXJ40-P, pXJ40-L and pXJ40-DE 3; cloning the whole genome cDNA of the Newcastle disease virus into a pBR322 plasmid to obtain pBR322-DHN 3; uniformly replacing partial codons of the NP gene coding region with codons with the highest use frequency, and replacing the codons with pBR322-DHN3 plasmids to form a new plasmid pBR 322-mNPDN 3; the 5 plasmids are adopted to transfect BHK-21 cells together to obtain the rescued virus rDNN 3-mNP. The method is more beneficial to the rescue of the virus and the research of the pathogenic mechanism of the virus.

Description

Rescue method of gene VII type Newcastle disease virus through codon replacement

Technical Field

The invention relates to the technical field of reverse genetic operation, in particular to a rescue method of a gene VII type Newcastle disease virus through codon replacement.

Background

Newcastle disease is a highly contagious and lethal disease caused by Newcastle Disease Virus (NDV), commonly known as fowl plague, that mainly attacks chickens, turkeys, wild birds, and ornamental birds. Belongs to highly contact, acute and severe infectious diseases. Humans occasionally become infected, manifesting as conjunctivitis. The world health Organization (OIE) lists the infectious diseases as the infectious diseases which need to be reported, and the Ministry of agriculture of China also lists the infectious diseases as a type of animal epidemic diseases which need to be reported. Because the propagation speed is high and the morbidity and the fatality rate can reach 100 percent, once the spread seriously harms the poultry industry, immeasurable loss is caused.

According to epidemiological investigations, the epidemic genotype of NDV varies with time and geographical environment. In the last 20-50 years, the fluid I-IV type was predominant, and in the 70 th year, the V type was first found to be predominant in south America and middle America so as to be in Europe. Type VI appeared in the 80 s and prevailed in the middle east, asia and europe. Type VII began to spread in 85 years and with type VIII spread in many countries of the world and led to a pandemic in asia, africa and the middle east in the 90 year generation. The V-VIII types are all strong toxins. Types IX and X have been limited to local sporadic states. Because vaccines against type IV are widely used, type IV NDV has been well controlled. However, there is a tendency that vaccines against other genotypes are still lacking and are prevalent. Therefore, the reverse genetic cloning technology is imperative to rapidly develop high-efficiency, broad-spectrum, safe and even multivalent attenuated vaccine aiming at the real-time epidemic strains. In addition, quarantine is made more difficult by the widespread use of vaccines. Because it is impossible to discriminate whether the infected chicken carries a vaccine strain or a wild strain. An artificial label can be introduced in a recombination mode, so that the artificial label can be effectively identified with wild viruses.

Newcastle Disease Virus (NDV) belongs to the order Mononegales, Paramyxoviridae. The virus has a double lipid layer envelope lined with a layer of M protein. The membrane is coated with fibrillar glycoproteins (HN and F) to form a spike shape. The capsule contains a long helical nucleocapsid composed of a capsid protein and a minus-strand RNA. Newcastle disease virus has 6 groups of genes for encoding 6 viral proteins, i.e., glycoprotein (HN) having hemagglutinin and neuraminidase activities, glycoprotein (F) having a fusion function, non-glycosylated inner membrane protein (M), Nucleocapsid Protein (NP), phosphoprotein (P) and high molecular weight protein (L), respectively. The total length of the NDV gene is 15186nt to 15198 nt.

It has been shown that artificial mutation, replacement, or insertion of foreign sequences into the cDNA clone of NDV does not prevent the replication, assembly and release of the virus. cDNA clones of NDV have been used for basic research and vaccine development. The cDNA clone of the NDV can be used as a vector to express antigen proteins of other pathogenic bacteria so as to obtain the multivalent vaccine for resisting various pathogenic bacteria. The F gene cleavage point is subjected to base mutation to change the La Sota strain attenuated into the virulent strain (ref1) by Peeters and the like in 1999; in 2004 Huang et al exchanged the HN genes of the virulent and attenuated strains to obtain a new strain with different virulence (ref 2). In 2002, Mebastson et al successfully obtained a hybrid virus (ref3) which resists both NDV and hepatitis virus by replacing the NP protein dominant epitope of NDV with the S2 glycoprotein epitope gene of hepatitis virus; in 2006, Man et al inserted the HA gene of H7 avian influenza virus between the P-M genes of NDV B1 strain and succeeded in obtaining a hybrid virus (ref4) that is resistant to both NDV and H7 avian influenza viruses. Recently, Abzeid et al, in turn, successfully assembled the currently circulating IBV S protein of Egyptian into recombinant NDV, resulting in a hybrid virus that is immunoprotected both against the original NDV and against the corresponding IBV (ref 5). Chinese scholars also use LaSota strain as carrier to obtain multiple heterozygotic viruses with bivalent function. Such as the hybrid virus resistant to both NDV and IBDV5 (ref 6); hybrid virus resistant to both NDV and H5N1 (ref 7); hybrid virus resistant to both NDV and Mycoplasma gallisepticum TM1 virus (ref 8). Because NDV has only one serotype, its genetic properties are relatively stable. Although infectious cDNA clones of NDV have been established internationally, they are limited to the Latasa strain and are limited to basic and clinical research levels.

Among many scientific researches, research on HN gene and F gene, which are closely related to the pathogenicity of NDV, is more intensive. However, the function of the NP gene of NDV has been limited in many studies. In NDV, the NP gene is the nucleocapsid protein of the virus and is closely related to the replication and expression of NDV virus. The NP gene is a protein which is involved in the assembly of virus particles in the largest quantity, so that the normal replication and expression of the NP gene are of no significance to the replication and propagation of NDV virus, and once the replication and expression of the NP gene become fast or slow, the NP gene has influence on the whole NDV virus, which is a problem to be discussed.

In the existing virus rescue scheme about NDV, simple splicing of genome is mostly used, a spliced product is transcribed into RNA in vitro, and then the RNA of the transcribed product is transfected into cells in modes of electrotransfer or liposome and the like to rescue the virus. This approach may result in: (1) a large amount of plasmids need to be extracted for rescuing the virus every time, then the full-length genome of the virus is obtained by enzyme cutting and splicing, and the mode of enzyme cutting and connection wastes time and labor and can possibly generate certain base deletion, so that the virus cannot be obtained finally. (2) The spliced viral genome is transcribed in vitro in full length, the environment cannot be completely simulated into an intracellular environment in the in vitro transcription process, and the working efficiency of secondary transcription products cannot be estimated even if the transcription products are transfected into cells again. In addition, DNA is extremely unstable after being transcribed into RNA in vitro, and is easy to degrade and mutate, so that the virus rescue efficiency is greatly reduced. In addition, most of the existing NDV rescue protocols first infect fowlpox virus, thereby expressing T7RNA Polymerase, in cells to help virus rescue. However, this method has a disadvantage that the virus of the fowlpox virus is present in the cells at the same time, and it takes much time and effort to purify the virus at a later stage even if the virus is successfully rescued.

The NP gene is the first gene encoded by the 3' end of the NDV genome, and the translation speed of the NP gene directly influences the translation efficiency of the subsequent genes. The invention counts the usage frequency of the codons of the coding region of the NP gene, unifies the codons for coding the same amino acid into one codon, thereby reducing the usage number of the codons in the translation process of the NP gene to the minimum and changing the translation speed of NDV.

Disclosure of Invention

Aiming at the defects and shortcomings of the prior art, the invention aims to provide a method for reconstructing and saving a gene VII type Newcastle disease virus through codon replacement. The method integrates the viral genome into a pBR322 plasmid, and the plasmid integrated with the viral whole genome can be stably replicated and expressed. Thus, the tedious work of in vitro splicing is saved and the possibility of base deletion is greatly reduced. And the constructed plasmid pXJ40-DE3 can express T7RNA polymerase in cells to help virus rescue. This eliminates the need for fowlpox infection, and also eliminates much time and effort in removing fowlpox virus in the later stages. And the codon type used by the NP gene in the translation process is reduced to the minimum by counting the use frequency of each amino acid codon of the NP gene coding region in the NDV genome, and then uniformly replacing the codons of the NP gene partial coding region with the codons with the highest use frequency in the region. This method has two advantages: 1. the virus can not be rescued due to the large change of the virus gene composition. 2. Under the condition of unchanged expression of virus protein, the use of some codons is reduced, and the translation speed of the virus is changed.

In order to achieve the purpose, the invention provides the following technical scheme:

the rescue method of the gene VII type Newcastle disease virus subjected to codon replacement comprises the following steps:

(1) cloning NP gene, P gene and L gene of Newcastle disease virus into pXJ40 vector respectively to obtain auxiliary plasmids pXJ40-NP, pXJ40-P and pXJ 40-L;

(2) cloning DE3 gene capable of expressing T7RNA polymerase in cells into pXJ40 vector to obtain plasmid pXJ40-DE 3;

(3) cloning the whole genome of the Newcastle disease virus into a plasmid pBR322-Base to obtain a whole genome expression vector pBR322-DHN 3;

(4) counting the use frequency of each codon in the NP gene of the Newcastle disease virus, uniformly replacing partial codons in the NP gene coding region with codons with the highest use frequency to obtain a replaced NP gene sequence, and replacing the replaced NP gene sequence onto a pBR322-DHN3 plasmid to form a new plasmid pBR322-mNPDHN 3;

(5) BHK-21 cells were cotransfected with the three helper plasmids pXJ40-NP, pXJ40-P and pXJ40-L from step (1), plasmid pXJ40-DE3 from step (2) and plasmid pBR322-mNPDHN3 from step (4) to obtain rescued virus rDNN 3-mNP.

Furthermore, the Newcastle disease virus refers to gene VII type Newcastle disease virus, and the whole genome sequence of the Newcastle disease virus is shown in a sequence table SEQ ID NO: 1; the NP gene is shown in a sequence table SEQ ID NO: the 1 middle position is 1-1591 nt; the P gene is shown in a sequence table SEQ ID NO: the position in the 1 is 1925 and 3109 nt; the L gene is shown in a sequence table SEQ ID NO: the 1 position is 8166 + 15192 nt.

The vector plasmid pXJ40 used in the invention is a vector plasmid with wide application, has rich enzyme cutting sites, and adopts pXJ40 in the process of constructing a large amount of plasmids. The vector plasmid pXJ40 used in the invention is derived from Liudingxiang professor Liudingxiang laboratories of group microorganism centers in agriculture and university in south China, and a plasmid schematic diagram, a sequence table and a corresponding preparation source of the vector plasmid are disclosed in a patent CN 110592108A.

Further, the helper plasmids pXJ40-NP and pXJ40-P were obtained by the following methods:

(1) carrying out double digestion on pXJ40 plasmids by using EcoRI and XhoI, and taking the cut fragments as plasmid fragments for constructing pXJ40-NP and pXJ 40-P;

(2) amplifying NP gene by using primers pXJ40-NP-F and pXJ40-NP-R, amplifying P gene by using primers pXJ40-P-F and pXJ40-P-R, and performing double enzyme digestion on the amplified product by using EcoR I and Xho I;

(3) respectively connecting the plasmid fragment obtained in the step (1) with the NP gene and the P gene subjected to enzyme digestion in the step (2) to obtain helper plasmids pXJ40-NP and pXJ 40-P;

the sequences of the two pairs of primers are respectively as follows:

pXJ40-NP-F：ACCGGAATTCGCCACCATGTCGTCTGTTTTTGACGAATACGAGC；

pXJ40-NP-R：ATATCTCGAGTCAGTACCCCCAGTCAGTGTCG；

pXJ40-P-F：ATATGAATTCGCCACCATGGCTACCTTTACAGATGCGGAG；

pXJ40-P-R：TATACTCGAGTCAACCATTCAGCGCAAGG。

further, the helper plasmid pXJ40-L was obtained by the following method:

(1) carrying out double digestion on pXJ40 plasmid by using BamHI and PstI, and taking the cut fragment as a plasmid fragment for constructing pXJ 40-L;

(2) designing four pairs of specific primers of homologous recombination sequences, and amplifying gene fragments L1, L2, L3 and L4 covering the complete sequence of the L gene respectively, wherein the 5 'end of the fragment L1 is provided with a homologous arm which is homologous with a pXJ40 BamHI end, and the 3' end of the fragment L4 is provided with a homologous arm which is homologous with a pXJ40PstI end;

(3) adding the L1, L2, L3 and L4 gene segments obtained in the step (2) and the vector pXJ40 plasmid segment subjected to double enzyme digestion in the step (1) together, and performing homologous recombination under the action of a recombinase to obtain an auxiliary plasmid pXJ 40-L;

the L1 gene is shown in a sequence table SEQ ID NO: the position in the 1 position is 8166 + 10709 nt; the L2 gene is shown in a sequence table SEQ ID NO: the 1-position is 10174 and 12299 nt; the L3 gene is shown in a sequence table SEQ ID NO: the 1-position is 12238-; the L4 gene is shown in a sequence table SEQ ID NO: position 14214 + 15192nt in 1;

the specific primer sequences of the four pairs of homologous recombination sequences are respectively as follows:

pXJ40-L1-F：5’-ACTCACTATAGGGCGAATTCGGATCCGGATGGTTGGGAGGACGACATTG-3’；

pXJ40-L1-R：5’-GGACAGTTGACTCATTGCTAACATA-3’；

pXJ40-L2-F：5’-TATGTTAGCAATGAGTCAACTGTCC-3’；

pXJ40-L2-R：5’-GTGAATGTAAGGCGACACTCTGTAG-3’；

pXJ40-L3-F：5’-CTACAGAGTGTCGCCTTACATTCAC-3’；

pXJ40-L3-R：5’-CGAATATCAGGTAACACTCCATATC-3’；

pXJ40-L4-F：5’-GATATGGAGTGTTACCTGATATTCG-3’；

pXJ40-l4-R：5’-TAAGATCTGGTACCGAGCTCCTGCAGGCGCACCAAACAGAGATTTGGT-3’。

further, the plasmid pXJ40-DE3 was obtained by the following method:

(1) carrying out double digestion on pXJ40 plasmid by using BamHI and PstI, and taking the cut fragment as a plasmid fragment for constructing pXJ40-DE 3;

(2) designing primers pXJ40-DE3-F and pXJ40-DE3-R to amplify a gene sequence DE3 capable of expressing T7RNA polymerase from escherichia coli BL 21;

(3) carrying out homologous recombination on the plasmid fragment cut out in the step (1) and the DE3 gene in the step (2) under the action of recombinase to obtain a plasmid pXJ40-DE 3;

the primer sequences are as follows:

pXJ40-DE3-F：ACTCACTATAGGGCGAATTCGGATCCGCCATGAACACGATTAACAT CGC；

pXJ40-DE3-R：TAAGATCTGGTACCGAGCTCCTGCAGTTACGCGAACGCGAAGTCCG ACTC；

the sequence of the DE3 gene is shown in a sequence table SEQ ID NO: 32.

further, the whole genome expression vector pBR322-DHN3 is obtained by the following method:

(1) establishing a pBR322-Base vector: artificially synthesizing a gene fragment containing HC-1, a T7 promoter, an HDV ribozyme, a T7 terminator and HC-2, and inserting the gene fragment into a pBR322 plasmid to obtain a basic plasmid pBR 322-Base; the sequence HC-1 downstream of the T7 promoter corresponds to the sequence Listing SEQ ID NO: 1 at positions 15159-15192nt, and the sequence HC-2 upstream of the HDV ribozyme corresponds to the sequence set forth in SEQ ID NO: 1 at positions 1-141nt to provide the two homology arms required for recombination;

(2) constructing a transition vector: the transition vector is plasmid pBR322-PNP, plasmid pBR322-PDP and plasmid pBR322-LPD 3; the plasmid pBR322-PNP consists of segments NP, MINI and P; the plasmid pBR322-PDP consists of a segment P, PD1, PD2 and PD 3; the plasmid pBR322-LPD3 consists of fragments PD3, L1, L2, L3 and L4;

(3) constructing virus whole genome DHN 3-A: carrying out enzyme digestion on the plasmid pBR322-PNP, the plasmid pBR322-PDP and the plasmid pBR322-LPD3 to obtain fragments PNP, PDP and LPD3, and connecting the fragments PNP, PDP and LPD3 through T4 ligase to obtain virus whole genome DHN 3-A;

(4) constructing a plasmid fragment with a homology arm: taking the pBR322-Base vector in the step (1) as a template, and carrying out amplification by using primers A2-F and A2-R containing homologous arms to obtain a plasmid fragment with the homologous arms;

the primer sequences are as follows:

A2-F:ATCGGTAGAAGGTTCCCTCAGGTTC；

A2-R:GGTCCTATAGTGAGTCGTATTAATG；

(5) constructing a whole genome expression vector pBR322-DHN 3; carrying out homologous recombination on the plasmid fragment in the step (4) and the virus whole genome DHN3-A in the step (3) to obtain a whole genome expression vector pBR322-DHN 3;

the MINI gene is shown in a sequence table SEQ ID NO: the 1 position is 1414-; the PD1 gene is shown in a sequence table SEQ ID NO: the 1-position is 2935-; the PD2 gene is shown in a sequence table SEQ ID NO: the 1 middle position is 4838 and 6454 nt; the PD3 gene is shown in a sequence table SEQ ID NO: the 1 position is 6261 and 8283 nt; the L1 gene is shown in a sequence table SEQ ID NO: position 8166-; the L2 gene is shown in a sequence table SEQ ID NO: the 1-position is 10174 and 12299 nt; the L3 gene is shown in a sequence table SEQ ID NO: the 1-position is 12238-; the L4 gene is shown in a sequence table SEQ ID NO: position 14214 + 15192nt in 1.

Further, the partial substitution described in the step (4) means the substitution of amino acids 1 to 245 of the coding region of NP gene, 735nt in total, corresponding to the amino acids shown in SEQ ID NO: the position on 1 is 122-. To avoid that the gene sequence changes too much to cause the virus to be effectively rescued.

Further, during the partial replacement described in step (4), if a new start codon is generated in the sequence near the start coding region after the replacement, the replacement is not performed, so as to avoid encoding unexpected polypeptides, thereby changing the characteristics of the virus.

Further, the step of replacing the replaced NP gene sequence onto the pBR322-DHN3 plasmid in the step (4) comprises the following steps:

(1) carrying out double digestion on pBR322-DHN3 by using BsiWI and XbaI, and recovering a target fragment;

(2) artificially synthesizing a fragment containing the replaced NP gene sequence and a sequence between BsiWI and XbaI double enzyme cutting sites;

(3) and (3) connecting the target fragment in the step (1) with the artificially synthesized fragment in the step (2) to obtain a pBR322-mNPDHN3 plasmid.

Compared with the prior art, the invention has the beneficial effects that:

(1) the scheme of the invention integrates the genome of the virus into a pBR322 plasmid, and the plasmid integrated with the whole genome of the virus is proved to be capable of stably replicating and expressing. Thus, the tedious work of in vitro splicing is saved and the possibility of base deletion is greatly reduced.

(2) The plasmid pXJ40-DE3 constructed in the invention can express T7RNA polymerase in cells and help virus rescue. This eliminates the need for fowlpox infection and eliminates much time and effort in removing fowlpox virus at a later stage.

(3) The plasmid cotransfection virus-rescuing method adopted by the invention only needs one-time transfection, has small damage to cells, fast lesion and high rescuing efficiency.

(4) The codon replacement mode applied by the invention is parent virus rather than parent cell, and the replacement mode is based on the characteristics of the virus, thereby being more beneficial to the rescue of the virus and the research of the virus function.

(5) The method of the invention counts the usage frequency of each amino acid codon of the NP gene coding region of DHN3 genome, and then uniformly replaces the codons of partial region of the NP gene coding region with the codons with the highest usage frequency. This method has two advantages: 1. the original amino acid sequence of the virus genome is prevented from being changed to the greatest extent, so that the virus can not be rescued. 2. The codon sequence was altered without changing the viral protein content, and its effect on viral replication and host was observed.

Drawings

FIG. 1 is a graph showing the results of identification of the pathogenic RNA extracted in the examples.

FIG. 2 is a graph showing the results of infection of BHK-21 cells with the purified test strain viruses in the examples.

FIG. 3 is a schematic structural diagram of the DHN3 genome unequally divided into 10 parts by the sequencing primer in the example.

FIG. 4 is a graph showing the results of comparison of DHN3 with the evolutionary tree of NDV sequences published at NCBI in the examples.

FIG. 5 is a schematic diagram showing the structure of pXJ40 plasmid digested simultaneously with EcoRI and XhoI in the examples.

FIGS. 6 and 7 are schematic diagrams of plasmids of pXJ40-NP and pXJ40-P, respectively, in example.

FIGS. 8 and 9 are a PCR identification result (Marker:5000bp, target fragment 2743bp) and an enzyme digestion identification result (Marker:5000bp, target fragment 4264bp,2671bp) of the pXJ40-DE3 plasmid in example, respectively.

FIG. 10 is a schematic representation of the plasmid pXJ40-DE3 obtained in the examples.

FIG. 11 is a diagram showing the results of PCR identification of pXJ40-L obtained in example.

FIG. 12 is a diagram showing the results of PstI cleavage and identification of pXJ40-L obtained in example.

FIG. 13 is a schematic diagram of the plasmid pXJ40-L obtained in the example.

Fig. 14 is a schematic structural diagram of the embodiment in which BtgZI divides DHN3 into 3 parts unequally.

FIG. 15 is a diagram of plasmid pBR322 digested simultaneously with Hind III and NheI in the examples.

FIGS. 16 to 18 are schematic views of plasmids pBR322-PNP, pBR322-PDP and pBR322-LPD3, respectively, in examples.

FIG. 19 is a schematic plasmid of pBR322-Base in example.

FIG. 20 shows the genome design of DHN3 in example.

FIG. 21 is a diagram showing the PCR identification results of plasmid-positive bacteria pBR322-DHN3 in example (Marker:2000 bp; primer C-pBR 322-R/C-NP-F; target fragment 1698 bp).

FIG. 22 is a SacI enzyme digestion identification result diagram of plasmid A1 for identifying positive bacteria by pBR322-DHN3 PCR in example (Marker:8000 bp; target fragment: 8482bp,7065bp,3132bp,908bp,32 bp).

FIG. 23 is a plasmid schematic of pBR322-DHN3 in example.

FIG. 24 is a graph showing the results of BHK-21 cell infection with the virus fluid rDNN 3-mNP-P1 in the examples.

FIG. 25 is a diagram showing the comparison results between 1 to 45nt of the coding region of NP gene in example and the second and third sequences 1 to 45nt after codon replacement.

FIG. 26 is a schematic diagram showing the position of the synthetic sequence to be replaced in example on pBR322-DHN 3.

FIG. 27 shows the results of XbaI/HindIII double restriction enzyme digestion verification after cloning the synthetic sequence into the plasmid pUC57 in the example (Marker:4500bp, target 1440bp,2673 bp).

FIG. 28 is a schematic diagram of the plasmid of Y0016495-1 in example.

FIG. 29 shows the SacI-digested plasmid pBR322-mNPDHN3 (Marker:1 kb; target fragment: 8482bp,7065bp,3132bp,908bp,32 bp).

FIG. 30 is a plasmid schematic of pBR322-mNPDHN3 in example.

FIG. 31 is a graph showing the cytopathic effect of the example after 2 days of rescue of virus rDNN 3-mNP on BHK-21 cells.

FIG. 32 is a graph showing the results of sequencing the NP gene and F gene of rDNN 3-mNP at the tenth generation in the examples.

FIG. 33 is a graph of TCID50 of the NDV strains (DHN3, rDNN 3, rDNN 3-mNP) obtained in the examples at different time points.

Detailed Description

The following describes the embodiments of the present invention in further detail with reference to examples and drawings, but the embodiments of the present invention are not limited thereto. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Examples

The main instruments and reagents used in this example were as follows:

the THZ-100 type electric heating constant temperature incubator is purchased from Shanghai-Hengchun scientific instruments Co., Ltd; model a17105653 clean bench was purchased from santai air technologies, suzhou; the DK-8D type three-hole electric heating constant-temperature water tank is purchased from Shanghai-Hengscientific instruments Limited department; the THZ-100 type constant temperature incubator is purchased from Shanghai-Hengchang scientific instruments, Inc.; a Haier refrigerator model BCD-579WE from Haier; model 5424R centrifuge, Eppendorf PCR instrument, Thermo1300SERIES A2 biosafety cabinet, all purchased from Eppendorf.

DNA/RNA Co-extraction kit (AP-MN-BF-VNA-250G) purchased from AXYGEN; TIAN prep Mini plasma Kit (DP103-03) was purchased from Tiangen Biochemical technology (Beijing) Ltd; gel Extraction Kit (D2500-02) was purchased from OMEGA; M-MLVRT (2641A) was purchased from TAKARA; RRIs (2313A) were purchased from TAKARA; random6primer (3801) was purchased from TAKARA; agarose (E0301) was purchased from TSINGK; 0.25% Trypsin-EDTA (25200-056), DMEM basic (C11995500BT) from Gibco; lipofectamine LTX and Plus Reagent (15338-100) from Invitrogen; FBS (10099-141C) was purchased from Gibco; Premix-Taq (RR902A) was purchased from TAKARA; pen streppellicin Streptomyces (15140-122) was purchased from Gibco; primer star GXL (R050) was purchased from TAKARA; BtgZ1(R0703S), T4DNA Ligase (M0202M) from NEB; other restriction enzymes, ligases were purchased from TAKARA; clon express Multi One Step Cloning Kit (C113) was purchased from Novomedium.

The rescue method of the codon-optimized Newcastle disease virus comprises the following steps:

1. selection, identification and purification of experimental strain virus

1.1 selection and identification of the Experimental strains

A sleeping chicken with depressed spirit and yellow-green thin feces dying is obtained from a certain chicken farm in Guangdong, the viscera of the chicken are dissected, the liver is milled and the disease material RNA is extracted, and the disease material RNA is preliminarily identified as NDV after being tested by using specific primers (JF-F: CCTTGCAGCTGCAGGAATT G (SEQ ID NO: 2); JF R: GCTCTATACAGTATGAGGTGTCAAG (SEQ ID NO: 3); the product length: 913bp) (the identification result is shown in figure 1; M: 2000bp marke R; 1: duck viral hepatitis; 2: infectious bronchitis; 3: infectious bursal disease; 4: newcastle disease; 5: avian leukemia; 6: avian influenza).

1.2 purification of the test strains

Adding appropriate amount of normal saline into the rest materials, grinding thoroughly, filtering the mixed solution with 0.4 μm filter, adding 1% double antibody into the filtrate, inoculating into allantoic cavity of chick embryo chorionic membrane, adding 100 μ l of each product, and collecting embryo after 48 hr. The allantoic fluid harvested for the first time is diluted 1000 times and continuously sterilized. And (4) no double antibodies are added in the continuous virus propagation process, (original virus is subjected to first virus propagation without dilution treatment) and allantoic fluid is harvested after chick embryos die. The allantoic fluid harvested for the second time of virus propagation was diluted 1000-fold and inoculated at 100ul per embryo. After the blind transmission is repeated for three generations, allantoic fluid is collected as a virus seed and stored at-20 ℃ for later use.

The blind virus was plaque purified on BHK-21 cells and the purified virus was named DHN 3. The specific operation is as follows:

double distilled water is used to prepare 3% agarose solution, and the solution is placed at 4 ℃ for standby after high pressure. Before use, the mixture is heated for 2-3 minutes by a microwave oven to melt, and agar sugar solution is prepared by 3 percent agarose (2ml) and 2 percent FBS DMEM (24ml), and the agar sugar solution is put into a dry bath at 40 ℃ for standby. 2% FBS + DMEM + 1% SP antibiotic culture solution is prepared for standby. Repeatedly propagating the virus to obtain third generation allantoic fluid virus, and culturing the virus in DMEM culture solution according to the ratio of 1: diluting 10 to 6 gradients to obtain infection liquid 10^-1，10^-2，10^-3，10^-4，10^-5，10^-6And (5) standby. BHK-21 cells were cultured in 6-well plates, washed three times with PBS after the cells reached 90%, and then 200. mu.l of the above-mentioned infection solution was added thereto, and 800. mu.l of DMEM culture solution was supplemented thereto, so that the final volume of each well was 1 ml. After gentle shaking, the mixture was incubated at 37 ℃ for 2 hours. The incubation solution was discarded, washed with PBS three times, the washing solution was discarded, and 2.5ml of agarose solution was added to each well. Plaques were observed after 4-6 days. Selecting one plaque with uniform size to infect the BHK-21 cells again, and as a result, repeatedly freezing and thawing the cells three times after the cells are completely diseased, harvesting the virus, and naming the harvested virus as DHN3, as shown in figure 2.

2. Whole genome sequencing of laboratory strain viruses

2.1 the experimental strain virus was not equally divided into 10 fragments for amplification:

RNA of purified virus DHN3 was extracted and reverse-transcribed with a non-specific primer (Random6primer (3801)) to obtain a first cDNA. Then using the cDNA as template and using specific primer and Ex Taq enzyme to make PCR amplification. The specific primers (the published NDV virus gene sequence is downloaded from NCBI, the homologous regions of the NDV virus gene sequence are selected to design primers for amplifying DHN3 genome sequence) are 10 pairs, the DHN3 virus genome is divided into 10 parts (as shown in figure 3), and the fragments amplified by the 10 pairs of primers are named as follows: NP, MINI, P, PD1, PD2, PD3, L1, L2, L3, L4. The fragments amplified by the 10 pairs of primers are recovered by agarose gel electrophoresis, and then the recovered fragments are connected with a pMD19 vector for sequencing. (the names of plasmids corresponding to each part, the corresponding primer sequences and the sizes of amplified fragments are shown in Table 1; the names of plasmids, the amplification reaction conditions and the positions of the amplified fragments in the DHN3 genome are shown in Table 2).

TABLE 1 DHN3 Total Gene amplification primers

TABLE 2 DHN3 Total Gene amplification reaction procedure for each fragment

The sequencing results were aligned with all published NDV sequences by NCBI Blast software (as shown in fig. 4), which showed that DHN3 was full length 15192nt genome full length, and the corresponding sequence listing is shown in SEQ ID NO: 1, belonging to type II, type VII NDV.

To ensure the sequence is accurate, the above experiment was repeated 3 times from virus infection to sequencing results analysis. The sequencing results were identical, confirming that a purified strain of DHN3 was obtained from this plaque.

3. Construction of helper plasmids pXJ40-NP, pXJ40-P, pXJ40-L and plasmid pXJ40-DE3

The reasons for constructing the helper plasmids pXJ40-NP, pXJ40-P, pXJ40-L and plasmid pXJ40-DE3 expressing T7RNA Polymerase will be described first.

Ndv is a negative-strand RNA virus whose genome is capable of replicating and propagating under the action of host enzymes, unlike the genome of a positive-strand RNA virus. Negative strand RNA viruses need the assistance of helper proteins to initiate transcription and translation after entering host cells, so that a plasmid capable of expressing proteins needs to be constructed in advance when reverse genetic rescue viruses are made. For NDV, the accessory proteins are NP, P, and L proteins.

Transcription of DNA into RNA and translation of RNA into polypeptide. In the rescue of reverse genetic virus, circular plasmid DNA is transfected into cells, the circular DNA plasmid is transcribed into RNA in the cells, and active virus particles which can be replicated and propagated in a host system are formed under the help of helper proteins. We added the T7 promoter to plasmid pBR322-DHN3 containing the DHN3 genome to initiate transcription (the specific composition of plasmid pBR322-DHN3 is described in detail below), and this T7 promoter needs the action of T7RNA polymerase to initiate transcription. Therefore, we constructed plasmid pXJ40-DE3 capable of expressing T7RNA polymerase.

Cloning the NP, P, and L genes into pXJ40 vectors to obtain helper plasmids pXJ40-NP, pXJ40-P, and pXJ40-L, respectively. The pXJ40 plasmid contains CMV promoter and T7 promoter as well as SV40 poly-adenine A fragment, so that foreign genes can be efficiently transcribed by cellular DNA polymerase II or T7RNA polymerase and then translated into NP, P, and L proteins, which are proteins for assembling active virions.

3.1 construction of 3.1 pXJ40-NP and pXJ40-P plasmids

3.1.1 the pXJ40 plasmid was digested simultaneously with EcoRI and XhoI (as shown in FIG. 5), and the excised fragment (4288bp) was used as a plasmid fragment for the construction of pXJ40-NP, pXJ 40-P.

3.1.2 amplification of NP fragments using pXJ40-NP-F/pXJ40-NP-R (R050, 60 ℃ annealing temperature, 1min30s extension time). The P gene was amplified using pXJ40-P-F/pXJ40-P-R (R050, annealed at 60 ℃ C., extended 1min15 s). The primers pXJ40-NP-F and pXJ40-P-R in the two pairs of primers for amplifying the NP and P genes already contain the enzyme digestion sequence of EcoRI; primer pXJ40-NP-R and primer pXJ40-P-R contain XhoI sequences. Thus, using these two pairs of primers to amplify the NP and P genes, respectively, the amplified products contain EcoRI and XhoI cleavage sites at both ends, respectively. The product amplified by using the two pairs of primers is subjected to double digestion by EcoRI and Xho I, so that the digested product contains cohesive ends of EcoRI and Xho I. The corresponding plasmid, template and primer mapping tables are shown in Table 3.

3.1.3 the plasmid fragment prepared in 3.1.1 is respectively connected with NP and P fragments after enzyme digestion by EcoRI and Xho I and transformed into DH5 alpha, and bacteria selection and verification are carried out. Thus, plasmids pXJ40-NP and pXJ40-P (pXJ40-NP and pXJ40-P plasmid maps are shown in FIGS. 6 and 7) were constructed.

Table 4 shows the digestion of plasmid pXJ40 and the digestion of the amplified products of the NP and P genes. Table 5 shows the ligation of the cleavage products of NP and P genes to the cleavage product of pXJ40 plasmid. It should be noted that the PCR products and the restriction enzyme products of NP and P genes and the restriction enzyme product of pXJ40 plasmid are all subjected to the next step after recovery of agarose gel electrophoresis.

TABLE 3 construction of primers for plasmid pXJ40-P, pXJ40-NP

TABLE 4 Table of parameters of digestion process of plasmid pXJ40 and NP and P gene amplification products

TABLE 5 plasmid pXJ40-NP, pXJ40-P ligation System

3.2 construction of plasmid pXJ40-DE3

3.2.1 primer design amplification of DE3 fragment

Coli BL21 is known to express T7RNA polymerase, and we designed primers pXJ40-DE3-F and pXJ40-D E3-R to amplify sequences capable of expressing T7RNA polymerase (pXJ40-DE 3-F: ACTCACTATAGGGCGA ATTCGGATCCGCCATGAACACGATTAACATCGC, (SEQ ID NO: 30); pXJ40-DE3-R: T AAGATCTGGTACCGAGCTCCTGCAGTTACGCGAACGCGAAGTCCGACTC, (SEQ ID NO: 31)). The gene sequence capable of expressing T7RNA Polymerase (the gene is abbreviated as DE3, and the corresponding gene sequence is shown in SEQ ID NO: 32) is amplified from Escherichia coli BL21 by using the primers, and the amplified fragment is inserted into a plasmid pXJ40 by using a homologous recombination method. The DE3 fragment was amplified using GXL enzyme (R050), annealing temperature 60 ℃, extension time 2min36s, and fragment size 2652 bp.

3.2.2 plasmid pXJ40 was digested with PstI, BamHI and the corresponding digestion procedure is shown in Table 6. The excised target fragment (4270bp) was subjected to homologous recombination with the DE3 fragment amplified from E.coli (it is known that the homologous region of plasmid pXJ40 had been added to the sequence of the primer when the primer was designed to amplify the DE3 fragment), and the constructed homologous recombination system was as shown in Table 7.

TABLE 6 plasmid pXJ40 cleavage procedure

TABLE 7 homologous recombination System for plasmid pXJ40-DE3

The fragments were transformed into DH 5. alpha. after homologous recombination and screened in plates with ampicillin resistance. 8 positive colonies were picked from the plate by the second day and verified using PCR. The verification primer is pXJ40-F: GCAACGTGCTGGTTATTG TG, (SEQ ID NO: 33); DE3-R: GAAGTCCGACTCTAAGATGTCACG, (SEQ ID NO: 34); ex Taq enzyme (RR902) was used, annealing temperature 57 ℃ and extension 2min42s (target fragment size 2723 bp). The PCR and enzyme digestion identification result shows that 3 positive bacteria are obtained (as shown in figure 8 and figure 9), plasmids are extracted after the amplification culture, and the plasmid pXJ40-DE3 and the bacterial liquid with correct sequencing result are preserved (pXJ40-DE3 plasmid map is shown in figure 10).

3.3 construction of helper plasmid pXJ40-L

The foregoing sequencing plasmids pMD19-L1, pMD19-L2, pMD19-L3 and pMD19-L4 covered the entire L gene of DHN 3. 4 specific primers (shown in Table 8) for band homologous recombination sequences are designed, and pMD19-L1, pMD19-L2, pMD19-L3 and pMD19-L4 are respectively used as templates, so that 4 fragments L1, L2, L3 and L4 capable of cloning L complete sequences into pXJ40 vectors are amplified. The 5 'end of fragment L1 also carries a homology arm with the BamHI terminus of pXJ40, and the 3' end of fragment L4 carries a homology arm with the pXJ40PstI terminus. The vector pXJ40 was digested simultaneously with BamHI and PstI, and the desired fragment (4270bp) was recovered by gel purification. The 4 fragments were added together with the BamHI/PstI double-digested vector pXJ40 fragment and subjected to homologous recombination by the action of a recombinase (Clon express Multi One Step Cloning Kit (C113)) to obtain a recombinant product pXJ40-L (recombination composition Table is shown in Table 9).

The recombinant product was transformed into DH5 alpha cells and screened by single colony PCR. The correct PCR product was 2110bp amplified with primer PXJ40-F (pXJ40-F: GCAA CGTGCTGGTTATTGTG, (SEQ ID NO: 33))/pXJ40-L1-R (pXJ40-L1-R: GGACAGTTG ACTCATTGCTAACATA, (SEQ ID NO: 35)), 8 colonies were tested, and 8 positive bacteria all produced PCR products of the correct molecular weight (as shown in FIG. 11); further culturing and amplifying one of the strains, and extracting plasmid DNA. After the digestion by PstI, the correct digestion products should be 6230bp and 5081bp (the digestion identification result is shown in figure 12), and the sequence of the plasmid is verified to be consistent with the target sequence after the sequencing is carried out again (the map of the pXJ40-L plasmid is shown in figure 13).

TABLE 8 PCR primers used to create pXJ40-L

TABLE 9 plasmid pXJ40-L recombination System

The instructions for the use of the two enzymes (R050/RR902) used primarily in this example are shown in Table 10 below.

TABLE 10 Instructions on the use of enzymes for two PCR reactions of the present invention

The preparation of the PCR reaction system and the setting of the reaction program were carried out as follows:

r050PCR reaction procedure

RR902PCR reaction procedure

The annealing temperature is adjusted according to specific primers in the use process of RR902, and the extension time is implemented according to the specific fragment size according to the proportion of 1 kb/min; in the use of the R050 enzyme, the extension temperature is 60 ℃ in the present invention (determined by the nature of the enzyme), and the extension time is 1 kb/min.

The enzymes used in the full-length sequencing of DHN3 in the present invention were all RR902 (except the enzyme used for MINI fragment amplification, R050), and the enzymes used in the plasmid construction process were all R050. The process of the PCR reaction will not be described in detail below.

4. Constructs three transient plasmids pBR322-PNP, pBR322-PDP, pBR322-LPD3 and plasmid pBR322-DHN3 containing virus DHN3 whole genome

4.1 construction of the transient plasmids pBR322-PNP, pBR322-PDP, pBR322-LPD3

The total genome of DHN3 is 15192nt, and if the full-length cDNA is obtained by RT-PCR at one time, the full-length cDNA is difficult to obtain (generally, the commercially available DNA polymerase is difficult to synthesize DNA fragments larger than 10 k), and random mutation is easy to introduce in the PCR process. The DHN3 whole genome was therefore divided into 3 fragments, which were cloned separately into the pBR322 vector. The size of the fragment is determined based on BtgZI cleavage sites possessed by the DHN3 genome itself (BtgZI is shown in FIG. 14 for a structural schematic diagram of the DHN3 which is divided into 3 parts) so as to facilitate subsequent in vitro DNA fragment connection.

The specific construction method comprises the following steps:

A. preparation of plasmid fragment: the pBR322 vector is double digested with Hind III and NheI (as shown in FIG. 15), and recovered through gel, and the target fragment of pBR322 plasmid recovered through double digestion has size of 4161 bp.

B. Preparing a target gene fragment: the primers with the homologous arms and corresponding templates (see table 11 below) are used for amplifying DNA fragments with the homologous arms under the action of high-fidelity R050 respectively, and the DNA fragments are recovered for standby after being verified by running DNA gel.

C. The obtained target fragment and the plasmid fragment of pBR322 after enzyme digestion are recombined by a recombinase (see Table 12 below). Transforming by competent cell DH5 alpha, initially selecting by single colony PCR, amplifying plasmid DNA, checking by DNA gel after enzyme cutting plasmid DNA, and finally sequencing and verifying.

The genomic fragments involved in the construction of the pBR322-PNP plasmid include NP, MINI, and P.

The genomic fragments involved in the construction of the pBR322-PDP plasmid include P, PD1 and PD2, PD 3.

The genomic fragments involved in the construction of the pBR322-LDP plasmid include L1, L2, L3, L4 and PD 3.

The above 3 intermediate plasmids are shown in FIGS. 16-18, respectively, wherein FIG. 16 is a schematic view of pBR322-PNP plasmid; FIG. 17 is a schematic diagram of pBR322-PDP plasmid; FIG. 18 is a schematic diagram of pBR322-LPD3 plasmid.

TABLE 11 template and primer tables for reference to fragments of interest

TABLE 12 recombination System for each plasmid

Remarking:

1. after the target fragments required for constructing the pBR322-PNP plasmid, the pBR322-PDP plasmid and the pBR322-LPD3 plasmid were amplified respectively, the plasmids were mixed according to the recombination system of Table 12 above, and then the corresponding plasmids were constructed by performing the procedure of homologous recombination.

2. The pBR322-DHN3 plasmid construction strategy shows that the virus genome contains two BtgZI enzyme cutting sites, and the whole virus genome is divided into 3 large fragments according to the two enzyme cutting sites, namely three large fragments contained in three plasmids of pBR322-PNP, pBR322-PDP and pBR322-LPD3 are constructed. Meanwhile, when basic sequencing is carried out on the viral genome, the whole viral genome is divided into 10 small fragments (NP, P, PD1, PD2, PD3, L1, L2, L3 and L4), and BtgZ I enzyme cutting sites are just in the overlapping region of the P fragment and the PD3 fragment, so that P fragment and PD3 are substituted by P left, P right, PD3 left and PD3 right when plasmids pBR322-PNP, pBR322-PDP and pBR322-LPD3 are amplified.

3. Since the L protein is the nucleocapsid protein of NDV virus, plasmid pXJ40-L was first constructed after completion of plasmids pMD19-L1, pMD19-L2, pM D19-L3, pMD19-L4, and was used as a helper protein for rescuing viruses. Thus, pXJ40-L was one of the templates used in the construction of the pBR322-LPD3 plasmid, which already included the entire sequence of the L gene.

In the process of constructing pBR322-LPD3, the L gene is divided into 2 segments for amplification, which are called L1-2 and L3-4, (wherein L1-2 refers to the continuous sequence of small fragments L1 and L2, and is obtained by amplifying primers C-L1-R, pXJ40-L2-R and a template is pXJ40-L, and L3-4 refers to the continuous sequence of small fragments L3 and L4 and is obtained by amplifying primers pXJ40-L3-F, C-HindBtNot-L4-F template pXJ 40-L). And it should be noted that the primer C-HindBtNot-L4-F for amplifying L3-4 contains the homologous region required for constructing pBR322-DHN3 plasmid and a BtgZI digestion sequence, so that the virus genome sequence in pBR322-LPD3 can be completely cut off by BtgI, and the cut-off fragment is directly used for constructing pBR322-DHN3 plasmid.

4. In the above Table 12, all the enzymes used in the PCR amplification reaction involved in the construction of pBR322-PNP plasmid, pBR322-PDP plasmid, and pBR322-LPD3 plasmid were Prime STAR GXL DNA Polymerase (R050, TAK ARA), and the reaction system was referred to the above.

5. All the homologous recombination methods involved in the present invention use the Kit of Clon Express Multi One Step Cloning Kit (C113, Novozan), which will not be described again.

4.2 construction of pBR322-Base vector

To obtain recombinant viruses, 1 basic plasmid (pBR322-Base) was first constructed to obtain single-stranded minus-strand RNA from the whole genome. In order to obtain higher transcription level and ensure that the transcribed RNA does not contain any exogenous ribonucleic acid, 1T 7 promoter, 1T 7 terminator and 1 HDV ribozyme are respectively introduced into a pBR322 plasmid, so that DHN3 whole genome minus strand full-length RNA can be accurately synthesized under the action of exogenous T7RNA polymerase. When the pBR322-Base plasmid is designed and synthesized, a virus genome sequence is respectively synthesized at the downstream of a T7 promoter and the upstream of an HDV ribozyme to be used as a homologous region of homologous recombination. Wherein, the sequence added downstream of the T7 promoter is HC-1, and the corresponding viral genome has the position 15159-15192. The sequence added upstream of the HDV ribozyme is HC-2, corresponding to a position 1-141 in the genome of the virus, to provide the two homology arms required for recombination. DNA fragments containing T7 terminator and HDV ribozyme, HC-2, HC1, T7 promoter were artificially synthesized and combined with pBR322 vector by homologous recombination to obtain pBR322-T7Pro-HDV Ter (i.e., Base plasmid pBR322-Base), the schematic diagram of which is shown in FIG. 19, and the DHN3 genome assembled in this way is shown in FIG. 20.

4.3 construction of the Whole genome expression vector pBR322-DHN3

4.3.1 preparation of fragment DHN3-A

Preparation of DHN3-a fragment: recovering the PNP fragment, the PDP fragment, and the LPD fragment 3 from pBR322-PNP plasmid, pBR322-PDP plasmid, and pBR322-LPD3 plasmid by enzymatic cleavage; and connecting the fragment PNP, the fragment PDP and the fragment LPD3 to obtain full-length DHN3-A for later use. Specifically, referring to Table 13 below, pBR322-PNP plasmid with BtgZI and HindIII double enzyme digestion and recovery fragment PNP; the method for recovering fragment PDP from pBR322-PDP plasmid is as follows: the pBR322-PDP plasmid is digested with BtgZI single enzyme and then the fragment PDP is recovered; the method for recovering the fragment LDP3 from the pBR322-LPD3 plasmid comprises the following steps: the pBR322-LPD3 plasmid is digested with BtgZI single enzyme, and the fragment LPD3 is recovered;

TABLE 13 restriction system for each plasmid fragment

Remarking:

1. the preparation of the fragment PNP, the fragment PDP and the fragment LPD3 is carried out according to the enzyme digestion system and time in the table; after the enzyme digestion is finished, a small amount of the enzyme is used for gel electrophoresis to observe whether the enzyme digestion is complete, if the enzyme digestion is incomplete, a little more enzyme is added properly or the incubation time is prolonged, or both the enzyme digestion and the incubation time are both required;

2. the preparation of the fragment PNP requires the cleavage by two enzymes HindIII and BtgZ I. It should be noted that the two enzymatic reactions are performed separately, not simultaneously. Namely, HindIII is firstly used for enzyme digestion, and BtgZI is used for enzyme digestion after the target product is recovered by agarose electrophoresis gel. Therefore, PBR 322-PNP' in the above table refers to the HindIII cleaved product.

3. A0.6% agar (TsingKe, TSJ001) gel containing 0.03% of the whole gold staining solution was prepared. 0.6 microgram of agar is added with 100 milliliters of TAE buffer solution and placed in a microwave oven to be heated for 1 to 2 minutes until the agar is completely melted, and after the agar is cooled to about 50 ℃, the whole gold dyeing solution (diluted by 1: 3000 times) is added and mixed evenly, and then the glue is spread. Note that the stain adds a link that may inhibit the DNA fragments. All the above digestion products were separated by gel electrophoresis as described above. The gel was placed on a clean glass plate and the correct target fragment was cut off and recovered with a disposable stainless steel blade. Purification was performed using GelExtractionkit (D2500-02, OMEGA) as provided in the kit.

4. The PNP fragment, the PDP fragment and the LDP3 fragment are connected in vitro by high-concentration T4 ligase to obtain the full-length DHN 3-A. The connection specific parameters refer to table 14. The ligation product was directly purified with a kit (Mini BEST DNA fragment purification kit version4.0, TAKARA, 9761) and the product was purified for use.

TABLE 14 DHN3-A ligation System

4.3.2 preparation of plasmid fragments with homology arms

Using the above pBR322-Base plasmid as a template, primers A2-F/A2-R (A2-F: ATCGGTAGA AGGTTCCCTCAGGTTC, (SEQ ID NO: 61); A2-R: GGTCCTATAGTGAGTCGTATTAA TG, (SEQ ID NO: 62)) containing homology arms were subjected to PCR amplification using high fidelity enzyme R050. The PCR amplification product of this step was purified by the above purification kit (Mini BESTDNA fragment purification kit version4.0, TAKARA, 9761) by the method provided in the kit to prepare a plasmid fragment having a homology arm.

4.3.3 recombinant plasmid pBR322-DHN3

And carrying out homologous recombination on the constructed plasmid fragment containing the homology arm and DHN3-A to obtain a whole genome expression vector pBR322-DHN 3. Specific parameters can be referred to in table 15.

TABLE 15 formulation table for homologous recombination of plasmid fragments with DHN3-A

Reagent	Dosage of
		DHN3-A	200ng
pBR322-Base	91.02ng
		5×CE MultiS Buffer	4μl
Exnase MultiS	2μl
		ddH20	up to 20μl

The recombinant product was transformed into DH5 α competent cells. The primer sequence is expressed by using a specific primer C-pBR 322-R: GAAATTGCATCAA CGCATATAGCGC, (SEQ ID NO: 63); C-NP-F: CATCTGGTTGCCCTTGCGGCTTGTT C, (SEQ ID NO: 44) was subjected to single colony PCR to obtain 3 positive colonies A1-A3, the results of which are shown in FIG. 21. A1 was cultured for amplification and plasmid DNA was extracted. The A1 plasmid was digested with Sac1 for preliminary identification, and the correct digestion products should be 1 fragment of 8482bp, 1 fragment of 7065bp, 1 fragment of 3132bp, 1 fragment of 908bp and 1 fragment of 32bp, and the results are shown in FIG. 22, which shows that the digestion products are consistent with the results of sequence inference. The 32bp fragment was too small to be visualized in an agar electrophoresis gel. The plasmid was named pBR322-DHN3 (see FIG. 23 for plasmid map). The plasmid was re-sequenced and amplified for future use after verification.

5. Rescue of virus rDNN 3 on BHK-21 cells

BHK-21 cells were plated on 30mm dishes and prepared for transfection when the cells grew to around 80%. Cotransfection was carried out with pBR322-D HN3, pXJ40-NP, pXJ40-P and pXJ40-L, pXJ40-DE3 (see Table 16 for the amounts). Signs of cell fusion after 4 days are unclear. Freeze thawing the culture dish in a refrigerator at-20 deg.C for 2 times, collecting the cells and the culture solution in a sterile centrifuge tube, centrifuging at 12000rpm for 10 min, and collecting the supernatant. The virus fluid (rDNN 3-P1) was further infected with BHK-21 cells in 100. mu.l, and cell fusion lesions were observed 2 to 3 days later (see FIG. 24). After further 1 day of incubation, the plates were freeze-thawed 2 times in a-20 freezer and harvested for 10 minutes at 12000 rpm. The supernatant was collected. 100 mul of the collected virus liquid is inoculated to 9-day-old SPF chick embryos, and the chick embryos die in about 48 hours. Chick embryo allantoic fluid is harvested, viral RNA is extracted, and JF-F: CCTTGCAGCTGCAGGAATT G, (SEQ ID NO: 2); JF-R: GCTCTATACAGTATGAGGTGTCAAG, (SEQ ID NO: 3) the NDV virus F gene was amplified and the band of interest was detected.

TABLE 16 DHN3 Virus rescue of the respective plasmid use cases

Plasmids	Dosage of
		pXJ40-NP	2.5μg
pXJ40-P	1.25μg
		pXJ40-L	1.25μg
pXJ40-DE3	3μg
		pBR322-DHN3	4μg

6. Construction of the plasmid pBR322-mNPDHN3

In this summary we replaced the codon of NP gene in pBR322-DHN3 to form a new plasmid pBR 322-mNPDN 3. To construct this plasmid we will 1. count the frequency of each codon usage in the NP gene in DHN3 genome and replace the codon part with the codon using the highest frequency of usage of the corresponding amino acid. 2. The replaced gene sequence was synthesized. 3. The synthesized sequence is replaced on a pBR322-DHN3 plasmid to form a new plasmid pBR 322-mNPDN 3. The following will be described in detail:

6.1 statistics of all codons in the NP gene coding region in the DHN3 genome, as shown in Table 17 below.

TABLE 17 statistics of codon usage frequency of coding region in NP gene of DHN3 Virus genome

As shown in Table 17, we made statistics on the codons in the NP gene coding region of DHN3, and the numbers in parentheses represent the number of times that the codon in the NP gene appears in the preceding codon (two points are described below: 1. the codon in the NP gene of DHN3 genome counted in the present invention.2. in the present invention, in order to avoid the too large change in the gene sequence when performing codon substitution, the virus could not be rescued effectively, so the present invention only replaced the 1 st-245 th amino acid codon sequence of the NP gene coding region, and totally 735nt, the sequence name of the replaced DHN3 genome, which is 122 and 856 nt., was sequence two (see SEQ ID NO: 64) according to the statistical results in Table 17, but after the replacement in this way, 17-19nt and 23-25nt, which would result in the replaced sequence, were "ATG", as shown in FIG. 25, the substituted sequence may encode 1 or 2 more polypeptides, with 2 more start codons in the initial coding region. In order to avoid the effect of these potential polypeptides on viral rescue, it was decided not to replace the corresponding amino acids. The Asp at position 6 of the NP-coding region corresponding to this 17-19nt sequence still uses "GAC" instead of the statistically most frequently used "GAT"; the amino acid Tyr at position 8 of the coding region of the NP gene corresponding to 23-25nt still used "TAC" instead of the "TAT" which appeared the highest in the frequency of Table 17. Except the two sites, the other basic groups are unified according to the replaced codons, and the unified sequence is named as sequence three (the specific sequence is shown in SEQ ID NO: 65)

6.2 Synthesis of the Gene sequence after codon substitution, construction of the pBR322-mNPDHN3 plasmid

We sent the gene sequence after codon replacement to Guangzhou Ongke science and technology Limited company for synthesis, and Guangzhou Ongke BioLimited company connected the synthesized sequence to vector pUC57 by TA ligation (order No. QNB 0020670-1). And transforming the ligation product into TOP10 competent cells, selecting a monoclonal positive colony, and verifying the correctness by sequencing. Then, the positive colony is amplified and cultured, the plasmid is extracted, and the synthesized fragment is recovered for later use after BsiWI/XbaI double enzyme digestion (the name of the synthesized sequence is sequence four, and the specific sequence is shown in SEQ ID NO: 66).

The method comprises the following specific steps:

6.2.1 BsiWI/XbaI from the pBR322-DHN3 plasmid were selected as the cleavage sites for the target fragment (BsiWI at position 4416-4421 of pBR322-DHN3 and XbaI at position 5894-5899 of pBR322-DHN 3). The pBR322-DHN3 was digested with BsiWI/XbaI, and the desired fragment 18141bp was recovered.

6.2.2 preparation of the synthetic sequence. Now, if two sites BsiWI/XbaI on pBR322-DHN3 are used, the synthesized sequence should include the sequence from the original sequence to the position between the two sites (see FIG. 26), i.e., 4416-4484 and 5220-5899 of the plasmid fragment pBR322-DHN3, in addition to the substituted sequence, to total 749bp, and the substituted sequence 735bp to total 1484bp (the final synthesized sequence is shown in SEQ ID NO: 66).

6.2.3 the synthesized sequence was cloned into plasmid pUC57 by TA ligation and the ligation product was transformed into TOP10 competent cells. Positive bacteria were selected and verified by XbaI/HindIII digestion (see FIG. 27), and the sequence was sequenced to obtain the desired sequence in pUC57 plasmid to form a new plasmid Y0016495-1 (see FIG. 28). And then digesting the plasmid Y0016495-1 by BsiWI/XbaI to obtain a synthetic fragment 1484bp, connecting the recovered fragment with the fragment prepared in 6.2.1, transforming the connection product into TOP10 competent cells, selecting a positive colony, carrying out digestion verification by SacI (see figure 29), and carrying out sequencing verification to obtain the plasmid pBR322-mNPDHN3 (see figure 30).

7. Rescue of the virus rDNN 3-mNP on BHK-21 cells

BHK-21 cells were plated on 30mm dishes and grown to confluence within 24 hours. Cotransfection was carried out with PBR322-mNPDHN3, pXJ40-NP, pXJ40-P and pXJ40-L, pXJ40-DE3 (see Table 18 for the amounts). Cell fusion was evident after 2 days (see FIG. 31). After 4 days of incubation, the culture dish was frozen and thawed in a-20 ℃ freezer for 2 times, cells and the culture solution were collected in a sterile centrifuge tube, centrifuged at 12000rpm for 10 minutes, and the supernatant was collected. BHK-21 cells were further infected with 100. mu.l of virus fluid (rDNN 3-mNP-P1), and cell fusion lesions were observed for about 24 hours. After further culturing for 1 day, the plates were frozen and thawed in a-20 ℃ freezer 2 times, and then collected and centrifuged at 12000rpm for 10 minutes. The supernatant was collected. 100 mul of the collected virus liquid is inoculated to 9-day-old SPF chick embryos which die in about 40 hours. Collecting allantoic fluid of chicken, extracting virus RNA, and using JF-F: CCTTGCAGCTGCA GGAATTG (SEQ ID NO: 2); JF-R: GCTCTATACAGTATGAGGTGTCAAG, (SEQ ID NO: 3) amplified NDV virus F gene, resulting in a positive band. Continuously expanding rDNN 3-mNP in SPF chick embryos, and collecting allantoic fluid after 10 generations of expansion. F gene and NP gene fragments of rDNN 3-mNP were amplified using JF-F/JF-R and NDV-ST-W/C-NP-F (NDV-ST-W: ACCAAACA GAGAATCCGTGAGGTA, (SEQ ID NO: 22); C-NP-F: CATCTGGTTGCCCTTGCGGCT TGTTC, (SEQ ID NO: 44)), respectively, and the presence or absence of mutation in the sequencing results was examined. The results are shown in FIG. 32, which shows that rDNN 3-mNP has not been mutated in SPF chick embryos until the F gene and NP gene are propagated to the tenth generation.

TABLE 18 rDNHN 3-mNP Virus rescues the use of each plasmid

Plasmids	Dosage of
		pXJ40-NP	2.5μg
pXJ40-P	1.25μg
		pXJ40-L	1.25μg
pXJ40-DE3	3μg
		pBR322-mNPDHN3	4μg

8. Determination of related virulence indexes of DHN3, rDNN 3 and rDNN 3-mNP

According to OIE standards, we will determine HA, TCID50, EID50, MDT (mean Dead time) and virus growth curves for three strains of DHN3, rDNN 3, rDNHN 3-mNP included in the present invention.

8.1 HA

1. The virus to be tested is diluted with physiological saline to make dilutions (10) of different concentrations^-1-10^-10)；

2. Adding 25 mul of physiological saline into each well of a 96-well plate;

3. adding virus solutions of different dilutions into corresponding wells, 25 μ l per well (one virus per row, no virus solution added in the last row for comparison);

4. add 25. mu.l of 1% chicken red blood cells to each well;

blood coagulation was observed after 5.15-20 minutes.

8.2 TCID50

1. BHK-21 cells were plated in 96-well plates one night in advance, and the next experiment was started when the cells grew to 80-90% (3 replicates per virus fluid, calculating the average of CPE and non-CPE);

2. discarding the culture solution, and washing the cells twice with PBS;

3. the virus solution to be tested was diluted with DMEM to different dilutions (10)^-1-10^-11)；

4. Adding virus liquid with different dilutions into corresponding wells, respectively, 100 μ l each well (one 96-well plate measures half of tissue infection amount of one virus, each column is one dilution, each row represents different dilutions, and the last column is left for blank control);

lesions were observed after 5.4-6 days and the results were calculated using the Reed-Muench method.

8.3 EID50

1. Selecting fresh and healthy SPF (specific pathogen free) chick embryos of 9-11 days old for experiment;

2. diluting the virus solution to be detected with physiological saline solution in a gradient manner 10^-1-10^-10；

3. Choose 10^-5-10^-10The dilutions were used for experiments, 5 SPF chick embryos per dilution, 100 μ l of diluted virus solution per inoculation;

4. discarding dead embryos within 24 h;

5. freezing and storing dead embryos in time for three times every day;

6. observing for 6-7 days, and calculating half infection amount of chick embryo by using a Reed-Muench method (half lethal amount ELD50 of chick embryo and average lethal time MDT of chick embryo can be calculated at the same time of secondary experiment).

8.4 MDT(Mean Dead Time)

1. Selecting fresh and healthy SPF (specific pathogen free) chick embryos of 9-11 days old for experiment;

2. diluting the virus solution to be detected with physiological saline solution in a gradient manner 10^-1-10^-11；

3. Choose 10^-5-10^-10The dilutions were used for experiments, 5 SPF chick embryos per dilution, 100 μ l of diluted virus solution per inoculation;

4. discarding dead embryos within 24 h;

5. freezing and storing dead embryos in time for three times every day;

6. the observation period is 6-7 days, and the average death time of the chick embryos is calculated by using a Reed-Muench method.

8.5 growth characteristics of the Virus

1. Infecting BHK-21 cells with the virus at 1 MOI;

2. incubating for 2h, discarding virus solution, and washing with PBS for three times;

3. then 4h,8h,16h,24h,36h,48h and 60h after infection are selected to obtain infected virus liquid, and the final virus liquid is obtained after repeated freeze thawing;

4. the harvested virus liquid is made into TCID50 respectively;

5. viral TCID50 was measured at different infection times and growth curves were plotted.

The results of the above-described related tests are shown in tables 19 and 20 below.

TABLE 19 associated virulence indices of each strain of NDV

TABLE 20 determination of NDV strains growth curves at different time points TCID50

Remarking: in the table above 1, 2, 3 for each strain represents three replicates of the experiment. The growth curves of TCID50 at various time points plotted according to table 20 are shown in fig. 33.

According to the above results, it follows:

1. the invention successfully rescues the virus rDNN 3.

2. The invention changes the codon composition of the NP gene under the condition of not changing the amino acid sequence of the NP gene, and saves a codon replacement strain NDV rDNHN 3-mNP.

3. The experimental result shows that rDNN 3-mNP has shorter MDT and similar TCID50 compared with the original virus strain DHN3 and the rescued strain rDNN 3, the EID50 is obviously increased, and the growth curve of the virus shows that the rescued virus rDNN 3-mNP still accords with the replication curve of NDV after codon replacement. Taken together, these data indicate that codon substitutions do improve some properties. This resulted in a more rapid lethality of the virus upon infection of chick embryos (MDT, 46.2h) and higher titers (EID50, 10)^8.48In ml). These changes are made by replacing part of the nucleotide sequence of the NP gene, but not by changing the amino acid sequence of the NP gene. The invention can provide another research means for researching NDV.

Sequence listing

<110> southern China university of agriculture

<120> rescue method of gene VII type Newcastle disease virus through codon replacement

<130> 2020.4.27

<160> 66

<170> SIPOSequenceListing 1.0

<210> 1

<211> 15192

<212> DNA

<213> Artificial sequence ()

<400> 1

accaaacaga gaatccgtga ggtacgataa aaggcgaaga agcaatcgag atcgtacggg 60

tagaaggtgt gaaccccgaa cgcgagatcg aagcttgaac ctgagggaac cttctaccga 120

tatgtcgtct gtttttgacg aatacgagca gctccttgct gcccagaccc gccctaacgg 180

agcccatgga gggggagaga aagggagcac cttaaaagtt gaggtcccag tatttaccct 240

aaacagtgat gatccagagg atagatggaa ctttgcggta ttctgtcttc ggattgccgt 300

tagtgaggat gccaacaaac cactcaggca aggtgctctt atatccctct tatgctccca 360

ttctcaggtg atgagaaacc atgttgccct tgcaggaaaa cagaacgagg ccacactagc 420

tgttcttgag atcgatggtt ttgctaataa tgtgccccag ttcaacaata ggagtggagt 480

gtccgaggag agagcacaga gattcatggt aattgcaggg tctctccctc gggcatgcag 540

caacggtact ccgtttgtca cggctggggt tgaagatgat gcaccagaag atatcactga 600

cactctggaa aggatcctat ctgtccaagt ccaagtatgg gtcacggtag caaaggccat 660

gactgcatat gagacagcag atgagtcaga aacaagaaga ataaataagt atatgcagca 720

gggtagagtc cagaagaagt acatccttca tcctgtatgc aggagtgcaa ttcaactcat 780

aatcagacat tctctggcag tccgtatttt cctggttagt gagctcaaga ggggccgtaa 840

tacagcaggt gggagctcta catattacaa tttggtcggg gatgtagact catacatcag 900

aaataccggg cttactgcgt ttttcctaac actcaaatat ggaatcaata ccaagacgtc 960

agctctcgca ctcagcagcc tcacaggtga tatccaaaaa atgaaacagc tcatgcgttt 1020

atatcggatg aaaggtgaaa atgcaccata catgacattg ttaggtgaca gtgaccagat 1080

gagctttgcg ccagccgaat atgcacaact ttattctttt gccatgggca tggcatcagt 1140

cttagataag ggaactggca agtaccaatt tgccagggac tttatgagca catcattctg 1200

gcgacttgga gtagagtatg ctcaggctca gggaagtagt atcaatgaag acatggctgc 1260

tgagttaaaa ctaaccccag cagcaaggag aggcctggca gctgctgccc aacgagtatc 1320

tgaagaaatc ggcagcatgg acattcctac tcaacaagca ggagtcctca ccgggctcag 1380

tgacgaaggc ccccgaactc cacagggtgg atcgaacaag ccgcaagggc aaccagatgc 1440

tggggatggg gagacccaat tcctggattt tatgagaaca gtggcgaaca gcatgcggga 1500

atcgcctaat cctgcacaga gcaccactca tctagagcct cccccgaccc ctggggcatc 1560

ccaagacaac gacactgact gggggtactg atcgactact cccagcctgc ctccatagga 1620

ccacaccaaa cccctccccc aaaacccccc cacacccccc gacccacaac cccgcacgac 1680

ccccccaaca aaagctcccc cccaccctct cccccacccc cagccacacg accccatcca 1740

cccgggacaa cacaggcaca gctcggccag tcaacaatcc tcccagagtc caaggtatta 1800

gaaaaaaata cgggtagaag agagacatcc agagaccagg acgggtcacc aagctctctg 1860

ttctcccttc tacccggtga gttagggtga agatggctac ctttacagat gcggagatag 1920

atgacatact tgagaccagt gggactgtca ttgatagcat aattacggcc cagggcaaat 1980

cagccgagac cgtcggaaga agtgcgatcc cgcagggcaa gaccaaagct ccaagcacag 2040

cacgggagaa gcacgggagt gcccagccac acgccagtca ggacgtcccc gaccaacaag 2100

acagaacaga aaaacagcca tccacacctg agcaggcaac cccacacaac aacccaccga 2160

ccacacccac cgaaccgccc tccacccagg ccgcaagcga gaccagcgac acacagctca 2220

aaaccggagc aagcaactcc cttctgtcca tgctcgacaa attaagcaat aaatcgtcta 2280

atgctaaaaa gggcccatgg tcgggtcccc aagaagggca tcaccaatct ccggcccaac 2340

aacacgggaa ccagtcgagc catggaagca accagggaag accacagcac caggtcaagg 2400

ccgtctctgg aaaccggggc atagacgaga acacagcata tcatggacaa cggaaggagt 2460

cacaaccatc agctggtgca acccctcatg cgccccagtc agggcagagc caagacaata 2520

ttcctgtacc tgtggatcgt gtccagctac ctgccgactt tgcgcaggcg atgatgtcta 2580

tgatggaggc attatctcag aaggtaagta aagttgatca tcagctggat ctggtcttga 2640

aacagacatc ctctattcct atgatacgat ctgaaatcca acagctcaag acatctgttg 2700

cgatcatgga agctaactta ggtatgatga aaattctgga ccctggttgt gccaacattt 2760

catctttaag tgatctccgg gcagtagccc gatcccaccc agtcctagtt tcgggccccg 2820

gagacccatc tccttacgtg acacaagagg gtgaaatgac gctcaataaa ctctcacaac 2880

cagtgcagca cccttctgaa ttgattaagt ctgccaccgc aagcgggcct gacatgggag 2940

tggagaagga cactgtccgc gcattaatca cctcacgccc gatgcatcca agctcctcgg 3000

ctaagctcct gagcaagcta gatgcagcca agtcaattga agagatcagg aagatcaagc 3060

gccttgcgct gaatggttga tggccgtcac aactcatagc aggctcctgt cgcttcagca 3120

tcacacggaa tcccccggga gccccccctt gcgaatccat gcttcaacac cccagacaac 3180

agccctctct caccatcccc aatccctcgc atgatcgcac aactgcaacc aatctagcag 3240

cattagagat taagaaaaaa cacgggtaga atcaaagtgc ctcgattgaa ccaaaatgga 3300

ctcatccagg acaatcgggc tgtactttga ttctgccctt ccttccagta gcctattagc 3360

atttccgatt atcttacaag atacaggaga cgggaagaaa caaatcactc cacaatacag 3420

gatccagcat cttgattcgt ggacagacag taaggaagac tcggtattta tcaccaccta 3480

cgggttcatc tttcaagttg ggaatgaagg agccactgtc ggtgtgatca atgacaatcc 3540

caggcatgag ctactctctt ccgcaatgct ctgcttaggg agtgtcccga acaacggaga 3600

tcttgttgag ctggcgagag cctgcctcac tatggtggta acctgcaaga agagtgcaac 3660

taacactgag agaatagtct tctcagtagt gcaggcacct cgagtgctgc aaaattgtat 3720

ggttgtgtca aatcggtact catcagtgaa tgcagtgaag catgtgaagg cgcccgaaaa 3780

gatccctggg agcggaaccc tagagtataa agtgaatttt gtctccttga ctgtggtgcc 3840

gagaagggat gtctacagga tcccaactac agtattgaaa gtgtctggct cgagcctgta 3900

caatcttgcg ctcaatgtca ctattgatgt ggacgtggat ccgaagagcc cgttagtcaa 3960

atccctttct aagtccgata gcgggtacta tgcgaatctt tttctgcata tcggacttat 4020

gtccactgta gataagagag gaaagaaagt gacatttgac aagatagagg aaaagataag 4080

gagactcaat ctatctgttg ggctcagtga tgtgctcgga ccctctgtgc ttgtgaaggc 4140

gagaggtgca cggactaagc tacttgctcc tttcttctct agcagtggga cagcctgcta 4200

tcctatagca aatgcctctc cccaggttgc caagatactc tggagccaga ccgcgcacct 4260

gcggagcgtg aaagtcatca ttcaagccgg cactcagcgt gctgttgcag tgaccgccga 4320

tcatgaggta acctccacta agatagagaa gaagcatgcc attgctaaat acaatccttt 4380

cagaaaatag gttacatccc taagactgca gttcacctgc tttcccgaat catcatgaca 4440

ccagataatg atccatctcg actgcttgta gttagttcac ctgtccagca aattagaaaa 4500

aacacgggta gaagagtctg gaccccgacc ggcacactca ggacacagca tgggctccaa 4560

accttctacc aggatcccag cacctctaat gctaatcact cgaattatgc tgatattgaa 4620

ctgcatccgt ctgacaagtt ctcttgacgg caggcccctt gcagctgcag gaattgtaat 4680

aacaggagat aaggcagtca atgtatatac ctcgtctcag acagggtcaa tcatagtcaa 4740

gttgctcccg aatatgccca gagataagga ggcatgtgca agagccccat tggaggcata 4800

taacagaaca ctgactactc tgctcactcc tcttggcgac tccattcgca agatccaagg 4860

gtctgtatcc acgtccggag gaaggagaca aaaacgcttt ataggtgctg ttattggcag 4920

tgtagctctc ggggttgcaa cagcggcaca gataacagca gctgcggccc taatacaagc 4980

caaacagaat gctgccaaca tcctccggct taaggagagc attgctgcga ccaatgaagc 5040

tgtgcatgaa gtcaccgacg gattatcaca attatcagtg gcagttggga agatgcaaca 5100

gtttgtcaat gaccagttta ataacacggc gcgagaatta gactgcataa aaatcacaca 5160

acaggtcggt gtagaactca acctatacct aactgagcta actacagtat tcgggccaca 5220

gatcacctcc cctgcattaa ctcagctaac catccaggcg ctctataatt tagctggtgg 5280

caatatggac tacttattaa ctaagttagg tataggaaac aatcaactca gctcattaat 5340

tggtagcggc ctgatcactg gttaccctat actgtatgac tcacatactc aactcttggg 5400

catacaagtt aatctgccct cagtcgggaa cttaaataat atgcgtgcca cctatctgga 5460

gaccttatct gtaagtacaa ccaaaggata tgcctcagca ctggtcccga aagtagtgac 5520

acaagtcggt tctgtgatag aagagcttga cacctcatac tgtatagagt ccgatctgga 5580

tttatattgt actagaatag tgacattccc catgtctcca ggtatttatt cctgtttaag 5640

tggcaacaca tcagcctgca tgtattcaaa gactgaaggc gcactcacta cgccgtatat 5700

ggcccttagg ggctcagtta ttgctaattg taagataaca acatgcagat gtacagaccc 5760

tcctggcatc atatcgcaaa attatggaga agctgtatcc ctgatagata gacactcgtg 5820

caatgtctta tcattagacg gcataactct gaggctcagt ggggaatttg atgcaactta 5880

tcaaaagaac atctcaatat tagattctca ggtcatcgtg acaggcaatc ttgatatatc 5940

aactgaactt ggaaacgtca ataattcgat cagcaatgcc ttggacaagt tggcagaaag 6000

caacagcaaa ctagaaaaag tcaacgtcag actaactagc acatccgctc tcattaccta 6060

tattgttcta actgtcattt ccctaatttt cggtgcactt agtctggttt tagcgtgtta 6120

cctgatgtac aagcagaagg cacaacaaaa gaccctgtta tggcttggga acaataccct 6180

cgatcagatg agagccacca tgagagcatg aatgcaaata ggaagtggac ggacacccaa 6240

cggcagcccg tgtgtcaatt ccgataacct gtcaagtagg agacttaaga aaaaattact 6300

gggaacaagc aaccaaagag caatacacgg gtagaacggt cagaggagcc acccttcaat 6360

tgaaaattag gcttcacaac atccgttcta ccacaccacc aacaacaaga gtcaatcatg 6420

gaccgcgtgg ttaacagagt catgctggag aatgaagaaa gagaagcaaa gaacacatgg 6480

cgcttagttt tccggatcgc agtcttattt ttaatggtaa tgattctagc tatctctgcg 6540

gctgccctgg catacagcat ggaggccagt acgccacacg acctcgcagg catatcgact 6600

gtgatctcca agacagaaga taaggttacg tctttactca gttcaagcca agatgtgata 6660

gataagatat acaagcaggt agctcttgaa tccccgctgg cactattaaa caccgaatct 6720

gtaattatga atgcaataac ctctctttct tatcaaatta acggggctga gaacagtagc 6780

ggatgcggtg cgcccgttca tgacccagat tatatcgggg ggataggcaa agaactcata 6840

gtggacgaca ttagtaatgt cgcatcattt tatccttctg catatcaaga acacttgaat 6900

ttcatcccgg cacctactac aggatctggt tgcactcgga taccctcatt tgacatgggc 6960

accacccatt attgttatac tcacaatgtg atactatctg gttgcagaga tcactcacac 7020

tcacatcaat acctagcact tggtgtgctt cggacatctg caacagggag ggtattcttt 7080

tctactctgc gctccatcaa tttagatgac actcaaaatc ggaagtcttg cagtgtgagt 7140

gcaacccctt taggttgtga tatgctgtgc tctaaggtca cagggactga agaggaggat 7200

tacaagtcag ttgcccccac atcaatggtg cacggaaggc taggatttga cggtcaatac 7260

catgagaaag acttagacac cacggtctta tttaaggatt gggtggcaaa ttacccgggg 7320

gtgggaggag ggtcttttat tgacggccgt gtatggttcc cagtttacgg agggctcaaa 7380

cctaattcac ccagtgacat cgcacaagaa gggaaatatg taatatacaa gcgccataat 7440

aacacatgcc ccgataaaca agattaccaa attcggatgg ctaagtcctc atataaacct 7500

gggcgatttg gtggaaagcg cgtacagcaa gctatcctat ctatcaaagt gtcaacatcc 7560

ctgggtaagg acccggtgct gactattcca cctaatacaa tcacactcat gggagccgaa 7620

ggcagaatcc tcacagtagg gacatctcac ttcttgtatc aacgagggtc ttcatatttc 7680

tcccctgcct tattgtatcc catgacagta agtaacaaaa cggctacact ccatagtcct 7740

tacatgttta atgctttcac tcggccaggt agtgtccctt gccaggcatc agcaaggtgc 7800

cccaactcat gcatcactgg ggtctatacc gatccatatc ccttaatctt ctataggaat 7860

catactctac gaggggtctt cgggacgatg cttgatgatg aacaagcgag gcttaacccc 7920

gtatctgcag tatttgacaa catatctcgc agtcgtgtca cccgggtgag ttcaagcaac 7980

accaaggcag catacacgac atcgacatgt tttaaagttg tcaagactaa taaagtttat 8040

tgtcttagta tcgcagaaat atccaatacc ctattcgggg aatttaggat cgttcccttg 8100

ctagttgaga tcctcaaaga tgatagagtt taagaagcta gacttggccg attgagccaa 8160

tcataggatg gttgggagga cgacattgcg ccaatcatct cccataatgc ttagagtcaa 8220

gctgaacatt agcataaatc aggatcccgt gttgttgggc aaccgcaatc cgacaatgct 8280

gacatgattg ttctgagtct cgctcactgt cactttatta agaaaaaaca caagaagcat 8340

tgacatataa gggaaaataa ccaacaagag agaacacggg taggacatgg cgggctccgg 8400

tcctgagagg gcagagcacc agatcatcct accagagtca catttatcct ctccattggt 8460

caagcacaaa ttgttatact actggaaatt aaccgggcta ccgcttcctg atgaatgcga 8520

ctttgatcat ctcattatca gcaggcaatg gaagagaata ctggagtcag ccactcctga 8580

cacagagaga atgataaaac ttgggcgggc ggtgcaccag actctcaacc acaattccaa 8640

gatgactgga gtgctccatc ccaggtgttt agaagaactg gctagtattg aggtccctga 8700

ttcaactaac aaattccgga agattgaaaa gaagatccag attcacaaca caagatatgg 8760

agacctgttc acaaagctgt gcgtgcaagt tgagaagaaa ttgctagggt catctctgtc 8820

taataatgtc ccacgatcag aggaattcaa cagcatccgt acagatccgg cattctggtt 8880

tcactcaaaa tggtccagag ccaagttcgc gtggctccat ataaaacaag tccaaaggca 8940

tctgattgta gcagcaagga caaggtctgc agtcaacaag ttagtaacat taaatcataa 9000

gataggccat gtctttatta ctcctgagct tgtcattgtg acacacacag acgagaacaa 9060

gttcacatgt ctcacccagg aacttgtatt gatgtatgcg gatatgatgg aaggcaggga 9120

catggtcaat ataatatctt ctacagcagc acatctcagg aacctatccg agaaaattga 9180

tgatattctg cggttagtag atgctctggc aaaggactta ggtaatcaag tctatgatgt 9240

tgtagcatta atggagggat ttgcatacgg tgccgttcag ctgcttgagc catcaggtac 9300

atttgcagga gatttctttg catttaacct acaggagctc aaaaacacgt taatcgaact 9360

tctccccaat aatatagcgg aagcagtaac tcacgctatt gccactgtat tctctggatt 9420

agaacagaac caagcagctg agatgttgtg cttgctgcgt ttgtggggtc atccattgct 9480

tgagtctcgt agtgcagcaa gagcagtcag gagccagatg tgcgcaccaa agatggtaga 9540

ctttgatatg atcctccagg tattatcttt ctttaaagga acaatcatca atggatacag 9600

aaaaaagaac tcaggtgtgt ggccacgcgt caaagtagat acaatatatg gaaatatcat 9660

tgggcagcta catgctgatt cagcagagat ctcacatgat gtcatgttga gggagtacaa 9720

gagtttatcc gctcttgaat ttgagccatg tatagattat gaccctgtta ccaatctaag 9780

catgttccta aaagacaagg caatcgcaca tcctagtgat aactggctcg cctcatttag 9840

gcggaaccta ctctctgagg accagaagaa acagataaag gaggcaactt caactaaccg 9900

cctcctgata gagttcttag aatcaaatga ttttgatcca tataaagaaa tggaatacct 9960

gacaaccctc gagtacctaa gagatgacag tgtggcagta tcgtactcac tcaaagagaa 10020

agaggtgaaa gtgaatggac ggatttttgc taaattaaca aagaaactaa ggaattgcca 10080

ggtaatggca gaaggaattc tagctgacca gattgcacct ttcttccagg gaaatggggt 10140

cattcaagat agcatatcct tgacaaagag tatgttagca atgagtcaac tgtcctttaa 10200

cagcaataag aaacgtatcg ctgactgcaa agagagggtt tcctcaaacc gcaatcatga 10260

tcccaagagc aagaatcgta gaagagttgc cacctttatc acgactgacc tacaaaagta 10320

ttgtcttaac tggagatatc agacagtcaa actattcgcc catgccatca atcagctgat 10380

gggcctacct catttctttg agtggattca tcttaggctg atggacacta caatgtttgt 10440

aggggatcct ttcaatcctc caagtgaccc gaccgactgt gatctatcaa gagtcccaaa 10500

tgatgatata tatattgtca gtgctagagg gggcattgag ggactctgtc agaagctatg 10560

gacgatgatc tcaattgctg caatccaact tgccgcagca agatctcatt gtcgagttgc 10620

ctgcatggta caaggtgaca atcaagtaat agctgtaacg agagaggtga gatcagatga 10680

ttccccggat atggtattga cgcagttgca tcaggctagt gataatttct tcaaggaatt 10740

gattcatgtc aatcatctga ttggccataa cctgaaggat cgtgaaacca ttagatcaga 10800

cacattcttc atatacagca aacgaatatt caaagatgga gcaatactca gtcaggtcct 10860

caaaaattca tctaaattgg tgctaatatc aggtgacctt agcgaaaaca ctgtaatgtc 10920

ctgtgccaac attgcatcca ctgtagcacg actatgtgag aatgggcttc ctaaggactt 10980

ctgttactat ttgaactacc taatgagttg cgtgcagaca tattttgatt cagagttttc 11040

tattactcac agctcacagt cagattccaa ccagtcctgg attgaggata tctctttcgt 11100

acactcatac gtgttaaccc ctgcccaact ggggggactg agtaaccttc aatactcaag 11160

gctctacaca aggaatattg gcgacccagg gaccactgcc tttgcagagg tcaagcgact 11220

agaagcagtg gggttgttga gtcccagcat catgactaac atcttaacca ggccacctgg 11280

caatggagat tgggccagcc tatgcaacga cccatactct tttaattttg agactgttgc 11340

aagcccaaat attgtcctca agaaacatac acagaaagtc ctatttgaga catgttcaaa 11400

ccctttatta tccggggtac atacagagga caatgaggca gaagagaaag cattggctga 11460

attcttactc aatcaagaag tgattcaccc acgtgtcgca catgctatca tggaagcaag 11520

ctctgtgggt aggagaaagc aaattcaagg gcttgttgac acaacgaaca ctgtgattaa 11580

gattgcactg actaggaggc ccctcggtat caaaagactg atgcggataa tcaattactc 11640

aagcatgcat gcaatgttgt tcagggatga tattttctta tccactagat ccaaccaccc 11700

attagtttct tctaatatgt gctcgctgac gctagcagat tatgctcgga acagaagctg 11760

gtcacccctg acagggggca ggaaaatact gggtgtatcc aaccccgata ccatagaact 11820

tgtggaggga gagattctca gcgtcagtgg agggtgcaca aaatgtgaca gcggagatga 11880

gcagtttact tggttccatc ttccaagcaa tatagagttg actgatgaca ccagcaaaaa 11940

tcccccgatg agagtgccat atctcgggtc gaagactcaa gagagaagag ccgcctcact 12000

tgcgaaaata gcccatatgt caccacatgt gaaagcagca ctaagggcat catccgtgtt 12060

aatctgggct tatggggaca atgaagtgaa ctggactgct gctcttaata ttgcaaggtc 12120

tcgatgcaac ataagctcag agtatcttcg gctattgtca cccctgccca cagctgggaa 12180

tctccaacat agattggatg atggcataac ccagatgaca tttacccctg catctctcta 12240

cagagtgtcg ccttacattc acatatccaa tgattctcaa aggctgttca ccgaagaagg 12300

ggtcaaagag ggaaacgtgg tttaccagca aattatgctc ttgggtttat ctctaattga 12360

gtcactcttc ccaatgacaa caaccagaac atacgatgag atcacattac acctccacag 12420

taaatttagc tgctgtatcc gagaagcgcc tgtcgcagtt cctttcgagc tcctcggact 12480

ggtaccggaa ttaaggatgg taacctcaaa taagttcatg tatgatccta gccctatatc 12540

agagagggat tttgcgagac ttgacttagc tatattcaag agttatgagc ttaacttgga 12600

atcatatccc acgctggagc taatgaacat tctttcgata tctagcggga aattgattgg 12660

ccaatctgtg gtttcttatg atgaagatac ttctataaag aatgatgcta taatagtgta 12720

tgacaacaca cggaattgga ttagtgaggc acagaactca gatgtggtcc gcctgtttga 12780

gtatgcagca ctcgaagtgc tcctcgactg tgcttatcaa ctctactatc tgagggtaag 12840

gggtctaaac aacatcgtcc tatacatgaa tgacttatat aagaacatgc cagggatcct 12900

actctccaat attgcagcca cgatatccca ccccctcatt cactcaaggt tgaatgcagt 12960

aggtctaatt aatcatgacg ggtcacacca gcttgcagat atagactttg tcgaggtgtc 13020

tgcgaaattg ttagtctcct gcactcgacg cgtggtctca ggtttatatg cagggagtaa 13080

gtatgatctg ctgtttccat ctgtcttaga tgataacctg aatgagaaga tgcttcaact 13140

aatttcccgg ttatgctgct tgtacacagt gctctttgct acaacaagag aaatcccaaa 13200

aataaggggc ctatcagcag aagagaaatg ctcaatactc actgagtatc tattgtcgga 13260

tgctgtaaaa ccgttgctta ggtccgaaca attgagttct atcatgtctc ccaacataat 13320

cacgttccca gccaatctat actacatgtc taggaagagc cttaatttga tcagagaacg 13380

agaggacaga gatactatct tgtcgttgtt gttccctcag gagtcactgc ttgagcttcg 13440

cccagtacgg gacattggtg ctcgagtgaa agacccgttt acccgacaac ccgcatcttt 13500

catacaagag ctggatctga gtgccccagc aaggtacgac gcgtttacac tgagtaagat 13560

ttgcttcgag cacacactac cgaacccaag ggaagattac ctagtacgat acttgttcag 13620

aggagtaggg actgcttcat cttcttggta taaggcgtct catcttctat ccatatctga 13680

ggttaggtgt gcaagacatg ggaactcttt atacttagcg gaaggaagcg gagccatcat 13740

gagtcttctt gaattgcata taccacatga gaccatctat tacaatacac ttttctcgaa 13800

tgagatgaac cctccacagc ggcatttcgg acctacacca acacagtttc taaactcggt 13860

cgtttatagg aatctacaag cggaagtgcc atgtaaagat ggatatgtcc aggagttcta 13920

tccattatgg agagagaatg cagaagaaag tgatctgacc tcagataagg cagttggata 13980

tatcacatct gtagtaccct acaggtctgt atcattacta cattgtgaca ttgagattcc 14040

tccagggtcc agtcaaagct tattagatca actggctact aatttatccc tgattgccat 14100

gcattctgtg agagagggcg gggtagtgat catcaaggta ctgtatgcaa tggggtacta 14160

cttccactta ctcatgaatt tattcactcc atgttccacg aaaggataca tactttccaa 14220

tggctacgcc tgtagagggg atatggagtg ttacctgata ttcgttatgg gctgcttagg 14280

cgggcccact ttcgtgcacg aagtggtaag gatggcaaaa gctctaatac aacgacacgg 14340

tacacttcta tctaaatcag atgaaatcac attgactaag ctatttacct cacagcagcg 14400

tcgtgtaaca gatctcctat ccagcccttt accgaagcta atgaggctct taagtgaaaa 14460

cattgatgct gcactaattg aagccggggg acagcccgtc cgtccatttt gtgcagaaag 14520

tttggtgagc acactaacaa atacgaccca gacaactctg atcattgcca gccacattga 14580

cacagtcatc cggtccgtga tttacatgga ggctgagggt gacctcgccg acacagtgtt 14640

cttattaact ccttacaatc tatccacaga cggtaaaaag agaacatcac ttaagcagtg 14700

caccaaacag atcttggaag tcacaatatt gggtctcaga gccaaagaca tcaataaaat 14760

aggtgatgta atcagcttag tactcagagg tgcgatttcc ctagaggacc tcatcccatt 14820

aaggacatac ctgaagcaca gtacctgtcc taaatacctg aaagcggtcc taggtattac 14880

taagctcaaa gaaatgttca caggtacttc gttattgtac ttgactcgcg ctcaacaaaa 14940

attctacatg aaaactatag gtaatgctgc caagggatat tacagtaata atgactctta 15000

aaggcaatcg tacaccaatc agttatcttc ttaactgatg actccctcat tgacttgatt 15060

ataccagatt agaaaaaagt taaattctga ctctttggaa ctcgtattcg gattcagtta 15120

gttaacttta agcaaaaatg cgcaaagtcg tctctaatca cagctatgtc attcaccaaa 15180

tctctgtttg gt 15192

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 2

ccttgcagct gcaggaattg 20

<210> 3

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 3

gctctataca gtatgaggtg tcaag 25

<210> 4

<211> 19

<212> DNA

<213> Artificial sequence ()

<400> 4

ggatggttgg gaggacgac 19

<210> 5

<211> 19

<212> DNA

<213> Artificial sequence ()

<400> 5

gcaactgcgt caacaccat 19

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence ()

<400> 6

gttagcaatg agtcaactgt cc 22

<210> 7

<211> 22

<212> DNA

<213> Artificial sequence ()

<400> 7

cttcttcggt gaacagcctt tg 22

<210> 8

<211> 19

<212> DNA

<213> Artificial sequence ()

<400> 8

ctacagagtg tcgccttac 19

<210> 9

<211> 21

<212> DNA

<213> Artificial sequence ()

<400> 9

ggtaaagggc tggataggag a 21

<210> 10

<211> 21

<212> DNA

<213> Artificial sequence ()

<400> 10

tctccaatgg ctatgcctgt a 21

<210> 11

<211> 29

<212> DNA

<213> Artificial sequence ()

<400> 11

gcgcaccaaa cagagatttg gtgaatgac 29

<210> 12

<211> 17

<212> DNA

<213> Artificial sequence ()

<400> 12

tgggagtgga gaaggac 17

<210> 13

<211> 17

<212> DNA

<213> Artificial sequence ()

<400> 13

gttatctgtg ccgctgt 17

<210> 14

<211> 16

<212> DNA

<213> Artificial sequence ()

<400> 14

gactccattc gcaaga 16

<210> 15

<211> 16

<212> DNA

<213> Artificial sequence ()

<400> 15

cattctccag cacgac 16

<210> 16

<211> 19

<212> DNA

<213> Artificial sequence ()

<400> 16

ccgataacct gtcaagtag 19

<210> 17

<211> 17

<212> DNA

<213> Artificial sequence ()

<400> 17

gtcagcattg tcggatt 17

<210> 18

<211> 16

<212> DNA

<213> Artificial sequence ()

<400> 18

gaacaagccg caaggg 16

<210> 19

<211> 32

<212> DNA

<213> Artificial sequence ()

<400> 19

catctgcaga cagtcccact ggtctcaagt at 32

<210> 20

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 20

catacttgag accagtggga ctgtc 25

<210> 21

<211> 18

<212> DNA

<213> Artificial sequence ()

<400> 21

caggagcctg ctatgagt 18

<210> 22

<211> 24

<212> DNA

<213> Artificial sequence ()

<400> 22

accaaacaga gaatccgtga ggta 24

<210> 23

<211> 17

<212> DNA

<213> Artificial sequence ()

<400> 23

tcagtacccc cagtcag 17

<210> 24

<211> 17

<212> DNA

<213> Artificial sequence ()

<400> 24

gtaaaacgac ggccagt 17

<210> 25

<211> 17

<212> DNA

<213> Artificial sequence ()

<400> 25

caggaaacag ctatgac 17

<210> 26

<211> 40

<212> DNA

<213> Artificial sequence ()

<400> 26

atatgaattc gccaccatgg ctacctttac agatgcggag 40

<210> 27

<211> 29

<212> DNA

<213> Artificial sequence ()

<400> 27

tatactcgag tcaaccattc agcgcaagg 29

<210> 28

<211> 44

<212> DNA

<213> Artificial sequence ()

<400> 28

accggaattc gccaccatgt cgtctgtttt tgacgaatac gagc 44

<210> 29

<211> 32

<212> DNA

<213> Artificial sequence ()

<400> 29

atatctcgag tcagtacccc cagtcagtgt cg 32

<210> 30

<211> 49

<212> DNA

<213> Artificial sequence ()

<400> 30

actcactata gggcgaattc ggatccgcca tgaacacgat taacatcgc 49

<210> 31

<211> 50

<212> DNA

<213> Artificial sequence ()

<400> 31

taagatctgg taccgagctc ctgcagttac gcgaacgcga agtccgactc 50

<210> 32

<211> 2652

<212> DNA

<213> Artificial sequence ()

<400> 32

atgaacacga ttaacatcgc taagaacgac ttctctgaca tcgaactggc tgctatcccg 60

ttcaacactc tggctgacca ttacggtgag cgtttagctc gcgaacagtt ggcccttgag 120

catgagtctt acgagatggg tgaagcacgc ttccgcaaga tgtttgagcg tcaacttaaa 180

gctggtgagg ttgcggataa cgctgccgcc aagcctctca tcactaccct actccctaag 240

atgattgcac gcatcaacga ctggtttgag gaagtgaaag ctaagcgcgg caagcgcccg 300

acagccttcc agttcctgca agaaatcaag ccggaagccg tagcgtacat caccattaag 360

accactctgg cttgcctaac cagtgctgac aatacaaccg ttcaggctgt agcaagcgca 420

atcggtcggg ccattgagga cgaggctcgc ttcggtcgta tccgtgacct tgaagctaag 480

cacttcaaga aaaacgttga ggaacaactc aacaagcgcg tagggcacgt ctacaagaaa 540

gcatttatgc aagttgtcga ggctgacatg ctctctaagg gtctactcgg tggcgaggcg 600

tggtcttcgt ggcataagga agactctatt catgtaggag tacgctgcat cgagatgctc 660

attgagtcaa ccggaatggt tagcttacac cgccaaaatg ctggcgtagt aggtcaagac 720

tctgagacta tcgaactcgc acctgaatac gctgaggcta tcgcaacccg tgcaggtgcg 780

ctggctggca tctctccgat gttccaacct tgcgtagttc ctcctaagcc gtggactggc 840

attactggtg gtggctattg ggctaacggt cgtcgtcctc tggcgctggt gcgtactcac 900

agtaagaaag cactgatgcg ctacgaagac gtttacatgc ctgaggtgta caaagcgatt 960

aacattgcgc aaaacaccgc atggaaaatc aacaagaaag tcctagcggt cgccaacgta 1020

atcaccaagt ggaagcattg tccggtcgag gacatccctg cgattgagcg tgaagaactc 1080

ccgatgaaac cggaagacat cgacatgaat cctgaggctc tcaccgcgtg gaaacgtgct 1140

gccgctgctg tgtaccgcaa ggacaaggct cgcaagtctc gccgtatcag ccttgagttc 1200

atgcttgagc aagccaataa gtttgctaac cataaggcca tctggttccc ttacaacatg 1260

gactggcgcg gtcgtgttta cgctgtgtca atgttcaacc cgcaaggtaa cgatatgacc 1320

aaaggactgc ttacgctggc gaaaggtaaa ccaatcggta aggaaggtta ctactggctg 1380

aaaatccacg gtgcaaactg tgcgggtgtc gataaggttc cgttccctga gcgcatcaag 1440

ttcattgagg aaaaccacga gaacatcatg gcttgcgcta agtctccact ggagaacact 1500

tggtgggctg agcaagattc tccgttctgc ttccttgcgt tctgctttga gtacgctggg 1560

gtacagcacc acggcctgag ctataactgc tcccttccgc tggcgtttga cgggtcttgc 1620

tctggcatcc agcacttctc cgcgatgctc cgagatgagg taggtggtcg cgcggttaac 1680

ttgcttccta gtgaaaccgt tcaggacatc tacgggattg ttgctaagaa agtcaacgag 1740

attctacaag cagacgcaat caatgggacc gataacgaag tagttaccgt gaccgatgag 1800

aacactggtg aaatctctga gaaagtcaag ctgggcacta aggcactggc tggtcaatgg 1860

ctggcttacg gtgttactcg cagtgtgact aagcgttcag tcatgacgct ggcttacggg 1920

tccaaagagt tcggcttccg tcaacaagtg ctggaagata ccattcagcc agctattgat 1980

tccggcaagg gtctgatgtt cactcagccg aatcaggctg ctggatacat ggctaagctg 2040

atttgggaat ctgtgagcgt gacggtggta gctgcggttg aagcaatgaa ctggcttaag 2100

tctgctgcta agctgctggc tgctgaggtc aaagataaga agactggaga gattcttcgc 2160

aagcgttgcg ctgtgcattg ggtaactcct gatggtttcc ctgtgtggca ggaatacaag 2220

aagcctattc agacgcgctt gaacctgatg ttcctcggtc agttccgctt acagcctacc 2280

attaacacca acaaagatag cgagattgat gcacacaaac aggagtctgg tatcgctcct 2340

aactttgtac acagccaaga cggtagccac cttcgtaaga ctgtagtgtg ggcacacgag 2400

aagtacggaa tcgaatcttt tgcactgatt cacgactcct tcggtaccat tccggctgac 2460

gctgcgaacc tgttcaaagc agtgcgcgaa actatggttg acacatatga gtcttgtgat 2520

gtactggctg atttctacga ccagttcgct gaccagttgc acgagtctca attggacaaa 2580

atgccagcac ttccggctaa aggtaacttg aacctccgtg acatcttaga gtcggacttc 2640

gcgttcgcgt aa 2652

<210> 33

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 33

gcaacgtgct ggttattgtg 20

<210> 34

<211> 24

<212> DNA

<213> Artificial sequence ()

<400> 34

gaagtccgac tctaagatgt cacg 24

<210> 35

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 35

ggacagttga ctcattgcta acata 25

<210> 36

<211> 49

<212> DNA

<213> Artificial sequence ()

<400> 36

actcactata gggcgaattc ggatccggat ggttgggagg acgacattg 49

<210> 37

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 37

tatgttagca atgagtcaac tgtcc 25

<210> 38

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 38

gtgaatgtaa ggcgacactc tgtag 25

<210> 39

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 39

ctacagagtg tcgccttaca ttcac 25

<210> 40

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 40

cgaatatcag gtaacactcc atatc 25

<210> 41

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 41

gatatggagt gttacctgat attcg 25

<210> 42

<211> 48

<212> DNA

<213> Artificial sequence ()

<400> 42

taagatctgg taccgagctc ctgcaggcgc accaaacaga gatttggt 48

<210> 43

<211> 71

<212> DNA

<213> Artificial sequence ()

<400> 43

attgcatcaa cgcatatagc gctagcgcga tgtaccgcgg atcgttacca aacagagaat 60

ccgtgaggta c 71

<210> 44

<211> 26

<212> DNA

<213> Artificial sequence ()

<400> 44

catctggttg cccttgcggc ttgttc 26

<210> 45

<211> 26

<212> DNA

<213> Artificial sequence ()

<400> 45

gaacaagccg caagggcaac cagatg 26

<210> 46

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 46

gacagtccca ctggtctcaa gtatg 25

<210> 47

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 47

catacttgag accagtggga ctgtc 25

<210> 48

<211> 52

<212> DNA

<213> Artificial sequence ()

<400> 48

tgtttgacag cttatcatcg ataagcttcc tccatcatag acatcatcgc ct 52

<210> 49

<211> 50

<212> DNA

<213> Artificial sequence ()

<400> 49

attgcatcaa cgcatatagc gctagcaggc gatgatgtct atgatggagg 50

<210> 50

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 50

gacagtgtcc ttctccactc ccatg 25

<210> 51

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 51

catgggagtg gagaaggaca ctgtc 25

<210> 52

<211> 26

<212> DNA

<213> Artificial sequence ()

<400> 52

gacccttgga tcttgcgaat ggagtc 26

<210> 53

<211> 26

<212> DNA

<213> Artificial sequence ()

<400> 53

gactccattc gcaagatcca agggtc 26

<210> 54

<211> 24

<212> DNA

<213> Artificial sequence ()

<400> 54

gtctcctact tgacaggtta tcgg 24

<210> 55

<211> 24

<212> DNA

<213> Artificial sequence ()

<400> 55

ccgataacct gtcaagtagg agac 24

<210> 56

<211> 53

<212> DNA

<213> Artificial sequence ()

<400> 56

tgtttgacag cttatcatcg ataagcttgt gcgatgtcac tgggtgaatt agg 53

<210> 57

<211> 51

<212> DNA

<213> Artificial sequence ()

<400> 57

attgcatcaa cgcatatagc gctagcccta attcacccag tgacatcgca c 51

<210> 58

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 58

cgcaatgtcg tcctcccaac catcc 25

<210> 59

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 59

ggatggttgg gaggacgaca ttgcg 25

<210> 60

<211> 89

<212> DNA

<213> Artificial sequence ()

<400> 60

ttgacagctt atcatcgata agcttgcgat gagcggccgc tccattaata cgactcacta 60

taggaccaaa cagagatttg gtgaatgac 89

<210> 61

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 61

atcggtagaa ggttccctca ggttc 25

<210> 62

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 62

ggtcctatag tgagtcgtat taatg 25

<210> 63

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 63

gaaattgcat caacgcatat agcgc 25

<210> 64

<211> 735

<212> DNA

<213> Artificial sequence ()

<400> 64

atgagcagcg tctttgatga gtatgagcag ctcctcgcag cacagaccag accaaatggg 60

gcacatgggg ggggggagaa ggggagcacc ctcaaggtcg aggtcccagt ctttaccctc 120

aatagcgatg atccagagga tagatggaat tttgcagtct tttgcctcag aatcgcagtc 180

agcgaggatg caaataagcc actcagacag ggggcactca tcagcctcct ctgcagccat 240

agccaggtca tgagaaatca tgtcgcactc gcagggaagc agaatgaggc aaccctcgca 300

gtcctcgaga tcgatgggtt tgcaaataat gtcccacagt ttaataatag aagcggggtc 360

agcgaggaga gagcacagag atttatggtc atcgcaggga gcctcccaag agcatgcagc 420

aatgggaccc catttgtcac cgcaggggtc gaggatgatg caccagagga tatcaccgat 480

accctcgaga gaatcctcag cgtccaggtc caggtctggg tcaccgtcgc aaaggcaatg 540

accgcatatg agaccgcaga tgagagcgag accagaagaa tcaataagta tatgcagcag 600

gggagagtcc agaagaagta tatcctccat ccagtctgca gaagcgcaat ccagctcatc 660

atcagacata gcctcgcagt cagaatcttt ctcgtcagcg agctcaagag agggagaaat 720

accgcagggg ggagc 735

<210> 65

<211> 735

<212> DNA

<213> Artificial sequence ()

<400> 65

atgagcagcg tctttgacga gtacgagcag ctcctcgcag cacagaccag accaaatggg 60

gcacatgggg ggggggagaa ggggagcacc ctcaaggtcg aggtcccagt ctttaccctc 120

aatagcgatg atccagagga tagatggaat tttgcagtct tttgcctcag aatcgcagtc 180

agcgaggatg caaataagcc actcagacag ggggcactca tcagcctcct ctgcagccat 240

agccaggtca tgagaaatca tgtcgcactc gcagggaagc agaatgaggc aaccctcgca 300

gtcctcgaga tcgatgggtt tgcaaataat gtcccacagt ttaataatag aagcggggtc 360

agcgaggaga gagcacagag atttatggtc atcgcaggga gcctcccaag agcatgcagc 420

aatgggaccc catttgtcac cgcaggggtc gaggatgatg caccagagga tatcaccgat 480

accctcgaga gaatcctcag cgtccaggtc caggtctggg tcaccgtcgc aaaggcaatg 540

accgcatatg agaccgcaga tgagagcgag accagaagaa tcaataagta tatgcagcag 600

gggagagtcc agaagaagta tatcctccat ccagtctgca gaagcgcaat ccagctcatc 660

atcagacata gcctcgcagt cagaatcttt ctcgtcagcg agctcaagag agggagaaat 720

accgcagggg ggagc 735

<210> 66

<211> 1484

<212> DNA

<213> Artificial sequence ()

<400> 66

cgtacgggta gaaggtgtga accccgaacg cgagatcgaa gcttgaacct gagggaacct 60

tctaccgata tgagcagcgt ctttgacgag tacgagcagc tcctcgcagc acagaccaga 120

ccaaatgggg cacatggggg gggggagaag gggagcaccc tcaaggtcga ggtcccagtc 180

tttaccctca atagcgatga tccagaggat agatggaatt ttgcagtctt ttgcctcaga 240

atcgcagtca gcgaggatgc aaataagcca ctcagacagg gggcactcat cagcctcctc 300

tgcagccata gccaggtcat gagaaatcat gtcgcactcg cagggaagca gaatgaggca 360

accctcgcag tcctcgagat cgatgggttt gcaaataatg tcccacagtt taataataga 420

agcggggtca gcgaggagag agcacagaga tttatggtca tcgcagggag cctcccaaga 480

gcatgcagca atgggacccc atttgtcacc gcaggggtcg aggatgatgc accagaggat 540

atcaccgata ccctcgagag aatcctcagc gtccaggtcc aggtctgggt caccgtcgca 600

aaggcaatga ccgcatatga gaccgcagat gagagcgaga ccagaagaat caataagtat 660

atgcagcagg ggagagtcca gaagaagtat atcctccatc cagtctgcag aagcgcaatc 720

cagctcatca tcagacatag cctcgcagtc agaatctttc tcgtcagcga gctcaagaga 780

gggagaaata ccgcaggggg gagctctaca tattacaatt tggtcgggga tgtagactca 840

tacatcagaa ataccgggct tactgcgttt ttcctaacac tcaaatatgg aatcaatacc 900

aagacgtcag ctctcgcact cagcagcctc acaggtgata tccaaaaaat gaaacagctc 960

atgcgtttat atcggatgaa aggtgaaaat gcaccataca tgacattgtt aggtgacagt 1020

gaccagatga gctttgcgcc agccgaatat gcacaacttt attcttttgc catgggcatg 1080

gcatcagtct tagataaggg aactggcaag taccaatttg ccagggactt tatgagcaca 1140

tcattctggc gacttggagt agagtatgct caggctcagg gaagtagtat caatgaagac 1200

atggctgctg agttaaaact aaccccagca gcaaggagag gcctggcagc tgctgcccaa 1260

cgagtatctg aagaaatcgg cagcatggac attcctactc aacaagcagg agtcctcacc 1320

gggctcagtg acgaaggccc ccgaactcca cagggtggat cgaacaagcc gcaagggcaa 1380

ccagatgctg gggatgggga gacccaattc ctggatttta tgagaacagt ggcgaacagc 1440

atgcgggaat cgcctaatcc tgcacagagc accactcatc taga 1484

Claims (9)

1. A rescue method of gene VII type Newcastle disease virus subjected to codon replacement is characterized by comprising the following steps:

(1) cloning NP gene, P gene and L gene of Newcastle disease virus into pXJ40 vector respectively to obtain auxiliary plasmids pXJ40-NP, pXJ40-P and pXJ 40-L;

(2) cloning a DE3 gene capable of expressing T7RNA polymerase in cells into a pXJ40 vector to obtain a plasmid pXJ40-DE 3;

(3) cloning the whole genome cDNA of the Newcastle disease virus into a plasmid pBR322 to obtain a whole genome expression vector pBR322-DHN 3;

(4) counting the usage frequency of codons for coding each amino acid in the NP gene of the Newcastle disease virus, then partially replacing the codons for coding the corresponding amino acids with the codons with the highest usage frequency to obtain an NP gene sequence after codon replacement, and replacing the NP gene sequence after the replacement with a pBR322-DHN3 plasmid to form a new plasmid pBR322-mNPDHN 3;

(5) BHK-21 cells were cotransfected with the three helper plasmids pXJ40-NP, pXJ40-P and pXJ40-L from step (1), plasmid pXJ40-DE3 from step (2) and plasmid pBR322-mNPDHN3 from step (4) to obtain rescued virus rDNN 3-mNP.

2. The rescue method of the gene VII type Newcastle disease virus subjected to codon replacement according to claim 1, which is characterized in that: the Newcastle disease virus is gene VII type Newcastle disease virus, and the whole genome sequence of the Newcastle disease virus is shown in a sequence table SEQ ID NO: 1; the NP gene is shown in a sequence table SEQ ID NO: the 1 middle position is 1-1591 nt; the P gene is shown in a sequence table SEQ ID NO: the position in the 1 is 1925 and 3109 nt; the L gene is shown in a sequence table SEQ ID NO: the 1 position is 8166 + 15192 nt.

3. The rescue method of a gene VII type Newcastle disease virus with codon replacement as claimed in claim 2, characterized in that the helper plasmids pXJ40-NP and pXJ40-P are obtained by the following method:

(1) carrying out double digestion on pXJ40 plasmids by using EcoRI and XhoI, and taking the cut fragments as plasmid fragments for constructing pXJ40-NP and pXJ 40-P;

(2) amplifying NP gene by using primers pXJ40-NP-F and pXJ40-NP-R, amplifying P gene by using primers pXJ40-P-F and pXJ40-P-R, and performing double digestion on the amplified product by using EcoRI and Xho I;

(3) respectively connecting the plasmid fragment obtained in the step (1) with the NP gene sequence and the P gene sequence subjected to enzyme digestion in the step (2) to obtain helper plasmids pXJ40-NP and pXJ 40-P;

the sequences of the two pairs of primers are respectively as follows:

pXJ40-NP-F：ACCGGAATTCGCCACCATGTCGTCTGTTTTTGACGAATACGAGC；

pXJ40-NP-R：ATATCTCGAGTCAGTACCCCCAGTCAGTGTCG；

pXJ40-P-F：ATATGAATTCGCCACCATGGCTACCTTTACAGATGCGGAG；

pXJ40-P-R：TATACTCGAGTCAACCATTCAGCGCAAGG。

4. the method for rescuing newcastle disease virus of gene vii through codon substitution according to claim 2, characterized in that the helper plasmid pXJ40-L is obtained by:

(1) carrying out double digestion on pXJ40 plasmid by using BamHI and PstI, and taking the cut fragment as a plasmid fragment for constructing pXJ 40-L;

(2) designing four pairs of specific primers of homologous recombination sequences, and amplifying gene fragments L1, L2, L3 and L4 covering the complete sequence of the L gene respectively, wherein the 5 'end of the fragment L1 is provided with a homologous arm which is homologous with a pXJ40 BamHI end, and the 3' end of the fragment L4 is provided with a homologous arm which is homologous with a pXJ40PstI end;

(3) adding the L1, L2, L3 and L4 gene fragments obtained in the step (2) and the plasmid fragment of the vector pXJ40 subjected to double enzyme digestion in the step (1) together, and performing homologous recombination under the action of recombinase to obtain an auxiliary plasmid pXJ 40-L;

the L1 gene is shown in a sequence table SEQ ID NO: the position in the 1 position is 8166 + 10709 nt; the L2 gene is shown in a sequence table SEQ ID NO: the 1-position is 10174 and 12299 nt; the L3 gene is shown in a sequence table SEQ ID NO: the 1-position is 12238-; the L4 gene is shown in a sequence table SEQ ID NO: position 14214 + 15192nt in 1;

the specific primer sequences of the four pairs of homologous recombination sequences are respectively as follows:

pXJ40-L1-F：5’-ACTCACTATAGGGCGAATTCGGATCCGGATGGTTGGGAGGACGACATTG-3’；

pXJ40-L1-R：5’-GGACAGTTGACTCATTGCTAACATA-3’；

pXJ40-L2-F：5’-TATGTTAGCAATGAGTCAACTGTCC-3’；

pXJ40-L2-R：5’-GTGAATGTAAGGCGACACTCTGTAG-3’；

pXJ40-L3-F：5’-CTACAGAGTGTCGCCTTACATTCAC-3’；

pXJ40-L3-R：5’-CGAATATCAGGTAACACTCCATATC-3’；

pXJ40-L4-F：5’-GATATGGAGTGTTACCTGATATTCG-3’；

pXJ40-L4-R：5’-TAAGATCTGGTACCGAGCTCCTGCAGGCGCACCAAACAGAGATTTGGT-3’。

5. the rescue method of a codon-substituted gene VII-type Newcastle disease virus according to claim 2, characterized in that the plasmid pXJ40-DE3 is obtained by the following method:

(1) carrying out double digestion on pXJ40 plasmid by using BamHI and PstI, and taking the cut fragment as a plasmid fragment for constructing pXJ40-DE 3;

(2) designing primers pXJ40-DE3-F and pXJ40-DE3-R to amplify a gene sequence DE3 capable of expressing T7RNA polymerase from escherichia coli BL 21;

(3) carrying out homologous recombination on the plasmid fragment cut out in the step (1) and the DE3 gene in the step (2) under the action of recombinase to obtain a plasmid pXJ40-DE 3;

the primer sequences are as follows:

pXJ40-DE3-F：ACTCACTATAGGGCGAATTCGGATCCGCCATGAACACGATTAACATCGC；

pXJ40-DE3-R：TAAGATCTGGTACCGAGCTCCTGCAGTTACGCGAACGCGAAGTCCGACTC；

the sequence of the DE3 gene is shown in a sequence table SEQ ID NO: 32.

6. the rescue method for the gene VII type Newcastle disease virus subjected to codon replacement as claimed in claim 2, characterized in that the whole genome expression vector pBR322-DHN3 is obtained by the following method:

(1) establishing a pBR322-Base vector: artificially synthesizing a gene fragment sequentially containing HC-1, a T7 promoter, an HDV ribozyme, a T7 terminator and HC-2, and inserting the gene fragment into a pBR322 vector to obtain a basic plasmid pBR 322-Base; the sequence HC-1 at the downstream of the T7 promoter corresponds to the sequence table SEQ ID NO: 1 at positions 15159-15192nt, and the sequence HC-2 upstream of the HDV ribozyme corresponds to the sequence set forth in SEQ ID NO: 1 at positions 1-141nt to provide the two homology arms required for recombination;

(2) constructing a transition vector: the transition vector is plasmid pBR322-PNP, plasmid pBR322-PDP and plasmid pBR322-LPD 3; the plasmid pBR322-PNP consists of segments NP, MINI and P; the plasmid pBR322-PDP consists of a segment P, PD1, PD2 and PD 3; the plasmid pBR322-LPD3 consists of fragments PD3, L1, L2, L3 and L4;

(3) constructing virus whole genome DHN 3-A: carrying out enzyme digestion on the plasmid pBR322-PNP, the plasmid pBR322-PDP and the plasmid pBR322-LPD3 to obtain fragments PNP, PDP and LPD3, and connecting the fragments PNP, PDP and LPD3 through T4 ligase to obtain virus whole genome DHN 3-A;

(4) constructing a plasmid fragment with a homology arm: taking the pBR322-Base vector in the step (1) as a template, and carrying out amplification by using primers A2-F and A2-R containing homology arms to obtain a plasmid fragment with the homology arms;

the primer sequences are as follows:

A2-F:ATCGGTAGAAGGTTCCCTCAGGTTC；

A2-R:GGTCCTATAGTGAGTCGTATTAATG；

(5) constructing a DHN3 whole genome expression vector pBR322-DHN 3; carrying out homologous recombination on the plasmid fragment in the step (4) and the virus whole genome DHN3-A in the step (3) to obtain a whole genome expression vector pBR322-DHN 3;

the MINI gene is shown in a sequence table SEQ ID NO: the 1 position is 1414-; the PD1 gene is shown in a sequence table SEQ ID NO: the 1-position is 2935-; the PD2 gene is shown in a sequence table SEQ ID NO: the 1 middle position is 4838 and 6454 nt; the PD3 gene is shown in a sequence table SEQ ID NO: the 1 position is 6261 and 8283 nt; the L1 gene is shown in a sequence table SEQ ID NO: the position in the 1 position is 8166 + 10709 nt; the L2 gene is shown in a sequence table SEQ ID NO: the 1-position is 10174 and 12299 nt; the L3 gene is shown in a sequence table SEQ ID NO: the 1-position is 12238-; the L4 gene is shown in a sequence table SEQ ID NO: position 14214- > 15192nt in 1.

7. The rescue method of the gene VII type Newcastle disease virus subjected to codon replacement according to claim 2, which is characterized in that: the partial replacement in the step (4) means that the codons corresponding to the 1 st to 245 th amino acids of the coding region of the NP gene are replaced but the original amino acid sequence is kept unchanged, and the total number is 735nt, and the partial replacement corresponds to the amino acid sequence shown in the sequence table SEQ ID NO: the position on 1 is 122-.

8. The rescue method of the gene VII type Newcastle disease virus subjected to codon replacement according to claim 2, which is characterized in that: in the partial replacement process described in step (4), if a new start codon is generated near the start coding region of the sequence after the replacement, the replacement is not performed.

9. The rescue method for the codon-substituted gene VII Newcastle disease virus according to claim 2, characterized in that the step of substituting the codon-substituted NP gene sequence onto the pBR322-DHN3 plasmid in the step (4) is as follows:

(1) carrying out double digestion on pBR322-DHN3 by using BsiWI and XbaI, and recovering a target fragment;

(2) artificially synthesizing a fragment containing the replaced NP gene sequence and a sequence between BsiWI and XbaI double enzyme cutting sites;

(3) and (3) connecting the target fragment in the step (1) with the artificially synthesized fragment in the step (2) to obtain a pBR322-mNPDHN3 plasmid.

Images