CN111909935B

CN111909935B - Expression vector of recombinant human frizzled protein receptor 4 (FZD 4) and application thereof

Info

Publication number: CN111909935B
Application number: CN202010691720.2A
Authority: CN
Inventors: 李斌; 贺从武
Original assignee: Wuhan Niufusi Biological Technology Co ltd
Current assignee: Wuhan Niufusi Biological Technology Co ltd
Priority date: 2020-07-17
Filing date: 2020-07-17
Publication date: 2022-11-15
Anticipated expiration: 2040-07-17
Also published as: CN111909935A

Abstract

The present application relates to a recombinant nucleic acid comprising a nucleotide sequence encoding human frizzled receptor 4 (FZD 4).

Description

Expression vector of recombinant human frizzled protein receptor 4 (FZD 4) and application thereof

Technical Field

The application relates to the field of biomedicine, in particular to an expression vector of a recombinant human frizzled protein receptor 4 (FZD 4) and application thereof.

Background

Familial Exudative Vitreoretinopathy (FEVR) is a serious inherited vitreoretinal disease. It is one of the causes of retinal detachment and blindness in adolescents. It is typically characterized by incomplete peripheral retinal vascularization and hairbrush-like peripheral capillaries. Patients with incomplete peripheral retinal vascularization may not have any ocular symptoms and may develop varying degrees of pathology and visual impairment when retinal hypoxia develops further due to vascular abnormalities. The genetic modes of FEVR are various, and the established FEVR pathogenic gene exists in Wnt and Norrin-beta-catenin signal pathways which are highly conserved in evolution and play an important role in the development of eye structures and the formation of new blood vessels. Currently, there is no study on FEVR gene therapy. Therefore, there is a great need in the art to develop a therapeutically effective recombinant human frizzled receptor 4 (FZD 4) expression system and its applications.

Disclosure of Invention

The present application provides a recombinant nucleic acid comprising a nucleotide sequence encoding human frizzled receptor 4 (FZD 4) and the nucleotide sequence including at least one sequence selected from the group consisting of seq id nos:

(a) The nucleotide sequence is shown as SEQ ID NO. 1;

(b) The nucleotide sequence has more than or equal to 99 percent of identity with the nucleotide sequence shown in SEQ ID No. 1;

(c) The nucleotide sequence has more than or equal to 98 percent of sameness with the nucleotide sequence shown in SEQ ID No. 1;

(d) The nucleotide sequence has more than or equal to 95 percent of sameness with the nucleotide sequence shown in SEQ ID No. 1; and

(e) The nucleotide sequence has more than or equal to 80 percent of identity with the nucleotide sequence shown in SEQ ID NO. 1, preferably more than or equal to 85 percent of identity, and more preferably more than or equal to 90 percent of identity.

In certain embodiments, the nucleotide sequence comprises at least one sequence selected from the group consisting of seq id no:

(a) The nucleotide sequence is shown as SEQ ID NO. 1;

(b) The nucleotide sequence has more than or equal to 99 percent of sameness with the nucleotide sequence shown in SEQ ID NO. 1;

(c) The nucleotide sequence has more than or equal to 98 percent of sameness with the nucleotide sequence shown in SEQ ID No. 1; and

(d) The nucleotide sequence has more than or equal to 95 percent of sameness with the nucleotide sequence shown in SEQ ID No. 1.

In certain embodiments, the recombinant nucleic acid encodes a protein having the sequence set forth in SEQ ID No. 3.

The present application also provides a fusion nucleic acid having a structure of formula I from 5 'end to 3' end:

Z1-Z2-Z3(I)

in the formula (I), the compound is shown in the specification,

each "-" is independently a bond or a nucleotide linking sequence;

z1 is nothing, or a 5' -UTR sequence;

z2 is a nucleotide sequence as described herein; and

z3 is a 3' -UTR sequence.

The present application also provides a vector comprising a recombinant nucleic acid as described herein or a fusion nucleic acid as described herein.

In certain embodiments, the vector is selected from a plasmid or a viral vector.

In certain embodiments, the vector is selected from a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, or a combination thereof.

In certain embodiments, the vector is an AAV vector.

In certain embodiments, the vector has a serotype selected from the group consisting of AAV2, AAV5, AAV7, AAV8, or a combination thereof.

In certain embodiments, the vector is selected from a DNA viral vector or a retroviral vector.

The present application also provides a use of a vector as described herein for the preparation of a formulation or composition for restoring vision and/or treating an ocular disease in a subject.

The present application also provides a host cell comprising a vector as described herein, or having integrated into its chromosome an exogenous recombinant nucleic acid as described herein or a fusion nucleic acid as described herein.

In certain embodiments, the host cell is selected from 293T cells, photoreceptor cells, other visual cells, (optic) nerve cells, or combinations thereof.

In certain embodiments, the photoreceptor cells are cone cells and/or rod cells and the other visual cells are binodal cells.

The present application also provides a pharmaceutical formulation comprising:

(a) A vector as described herein, and

(b) A pharmaceutically acceptable carrier and/or excipient.

In certain embodiments, the pharmaceutical formulation is in a dosage form selected from the group consisting of: lyophilized formulations, liquid formulations, and combinations thereof.

In certain embodiments, the carrier is present in the pharmaceutical formulation in an amount of 1 × 10 ⁹ -1×10 ¹⁶ Individual virus/ml, preferably 1X 10 ¹¹ -1×10 ¹³ One virus/ml, more preferably 2X 10 ¹¹ -1×10 ¹² Individual virus/ml.

The present application also provides the use of a pharmaceutical formulation as described herein for the treatment of an ocular disease, preferably retinopathy.

In certain embodiments, the retinopathy is hereditary retinopathy, preferably familial exudative retinopathy FEVR.

In certain embodiments, the vector or pharmaceutical formulation significantly increases the expression and/or activity of the frizzled eye receptor 4 (FZD 4).

In certain embodiments, the vector or pharmaceutical formulation is effective to increase the expression and/or activity of frizzled receptor 4 (FZD 4) for up to 3 months, preferably up to 6 months.

The present application also provides a method for preparing a recombinant human frizzled receptor 4 (FZD 4), comprising the steps of: culturing the host cell described herein to obtain recombinant human frizzled receptor 4 (FZD 4).

The recombinant nucleic acids, fusion nucleic acids, vectors, host cells and/or pharmaceutical formulations of the present application have one or more of the following effects: can increase transcription and/or expression of frizzled receptor 4 (FZD 4), can be used to restore vision and/or treat ocular diseases in a subject, can treat hereditary retinopathy and/or can treat familial exudative retinopathy FEVR.

Other aspects and advantages of the present application will be readily apparent to those skilled in the art from the following detailed description. Only exemplary embodiments of the present application have been shown and described in the following detailed description. As those skilled in the art will recognize, the disclosure of the present application enables those skilled in the art to make changes to the specific embodiments disclosed without departing from the spirit and scope of the invention as it is directed to the present application. Accordingly, the descriptions in the drawings and the specification of the present application are illustrative only and not limiting.

Drawings

The specific features of the invention to which this application relates are set forth in the appended claims. The features and advantages of the invention to which this application relates will be better understood by reference to the exemplary embodiments described in detail below and the accompanying drawings. The drawings are briefly described as follows:

FIG. 1 shows a comparison of the nucleotide sequence of applicants' frizzled receptor 4 (FZD 4) with the nucleotide sequence of wild-type human frizzled receptor 4 after sequence optimization. Wherein, the uplink represents the optimized nucleotide sequence of the application, the downlink is a wild-type nucleotide sequence, and the "|" represents that the corresponding sites of the two are consistent; the homology between the two is 77.5%.

FIG. 2 shows a schematic protein structure of the frizzled receptor 4 transcript. Wherein domain A encodes the Frizzled domain of Frizzled receptor 4 (CRD _ FZ domain) and domain B encodes the G protein-coupled receptor family 2domain of Frizzled receptor 4 (7 transmembrane receptor, 7tm_2domain).

FIG. 3 shows the electrophoresis detection of PCR products, and the correct clone with target band of about 1614bp is selected from the recombinant clones. Wherein lane M is protein marker; lane 1 shows the correct recombinant adeno-associated virus expression vector AAV-MCS-rAAV2/2-rhFZD4.

FIG. 4 shows a schematic structural diagram of the recombinant adeno-associated virus expression vector AAV-MCS-rAAV2/2-rhFZD4 of the present application.

FIG. 5 shows the result of Coomassie blue staining of recombinant adeno-associated virus rAAV2/2-rhFZD4 purity detected by SDS-PAGE electrophoresis. Wherein lane 1 is protein marker; lane 2 is recombinant adeno-associated virus rAAV2/2-rhFZD4 of the present application.

FIG. 6 shows the results of the quantitative PCR-based fluorescence measurement of the relative expression level of human frizzled receptor 4 in rabbit eye retina. The experimental group A is a group injected with rAAV2/2-rhFZD4, the experimental group B is a group injected with wild type rAAV2/2-rhFZD4, and the control group is a group injected with rAAV 2/2-ZsGreen.

FIG. 7 shows the result of quantitative analysis of Western blot detection of human frizzled receptor 4 on the retina of rabbit eyes, where experimental group A is injected with rAAV2/2-rhFZD4 group, experimental group B is injected with wild rAAV2/2-hFZD4 group, and control group is injected with rAAV2/2-ZsGreen group.

Detailed Description

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification.

Definition of terms

In the present application, the term "about" generally refers to a value or composition that is within an acceptable error range for the particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, "about 100" includes 99 and 101 and all values in between (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

In this application, the terms "comprising" or "including" generally refer to the open, semi-closed, and closed types. In other words, the term also includes "consisting essentially of …," or "consisting of ….

In the present application, sequence "identity" or "identity" is typically determined by comparing two aligned sequences along a predetermined comparison window (which may be 50%, 60%, 70%, 80%, 90%, 95% or 100% of the length of a reference nucleotide sequence or protein) and determining the number of positions at which identical residues occur. Typically, this is expressed as a percentage. The measurement of sequence "identity" or "identity" of nucleotide sequences is a method well known to those skilled in the art. For example, "identity" may refer to the relatedness of two sequences based on nucleotide-to-nucleotide comparisons over a particular comparison window or segment. Identity is thus defined as the degree of identity, correspondence or equivalence between the identical strands (sense or antisense) of two DNA segments. The "percent sequence identity" is calculated as: comparing the two optimally aligned sequences over a specific region; determining the number of positions in the two sequences at which the same base or amino acid occurs to obtain the number of matching positions; the number of such positions is divided by the total number of positions in the compared section and the resulting quotient is multiplied by 100. Optimal alignment of sequences can be determined by Smith & Waterman, appl.math.2:482 (1981), needleman & Wunsch, J.mol.biol.48:443 (1970), pearson & Lipman, proc.natl.acad.sci. (USA) 85:2444 (1988) and Computer programs for performing the related algorithms (e.g., clustal Macaw Pileup (Higgins et al, CABIOS.5L151-153 (1989)), FASTDB (intelligentics), BLAST (National Center for biological Information; altschul et al, nucleic Acids Research 25 3389-3402 (1997)), PILEUP (Genetics Computer Group, madison, wis) or GAP, BESTFIT, FASTA and TFASTA (Wisconsics genes Software Package 7.0, genetics Computer Group, madison, wis) (see U.S. Pat. No. 5,912,120)

In the present application, the terms "subject", "subject in need thereof" generally refer to any mammal or non-mammal. Mammals include, but are not limited to, humans, vertebrates such as rodents, non-human primates, rabbits, rats, mice, horses, dogs, cats, pigs, sheep, goats.

In the present application, the terms "(recombinant) human frizzled receptor 4", "FZD4 (protein)", "hFZD4 (protein)", "polypeptide of the present application", and "protein of the present application" generally have the same meaning and are used interchangeably herein. FZD4 is one of the Frizzled gene family members that encodes a protein containing 537 amino acids with seven transmembrane helical structures forming 3 intracellular loops and 3 extracellular loops; the PDZ domain located at the intracellular C-terminus provides a site of action for intracellular receptors, and the highly conserved cysteine-rich region (CRD) at the extracellular N-terminus is a receptor for the Wnt signaling pathway located on the cell surface. For example, the frizzled receptor 4 may be the amino acid sequence shown in SEQ ID No. 3.

In the present application, the term "familial exudative retinopathy" or "FEVR" generally refers to a severe inherited vitreoretinal disease. It is one of the causes of retinal detachment and blindness in adolescents.

In the present application, the term "encoding" generally refers to the inherent nature of a particular nucleotide sequence in a polynucleotide, such as a gene, DNA, or mRNA, i.e., the sequence can serve as a template to synthesize other polymers and macromolecules in biological processes having a defined nucleotide sequence (e.g., rRNA, tRNA, and mRNA) or a defined amino acid sequence, and the biological properties resulting therefrom. Thus, when transcription and translation of mRNA corresponding to a gene in a cell or other biological system results in production of the protein, then the gene, cDNA, or RNA can encode the protein. Both the coding strand (whose nucleotide sequence is identical to the mRNA sequence, as is typically provided in sequence listings) and the non-coding strand (which serves as a template for transcription of a gene or cDNA) may be referred to as encoding a protein, or other product of the gene or cDNA. For example, the gene encoding frizzled receptor 4 of the present application can be used to synthesize the corresponding mRNA and/or the corresponding polypeptide in a biological process.

In the present application, the term "vector" generally refers to an expression vector containing a recombinant nucleic acid or fusion nucleic acid DNA sequence of the present application and appropriate transcription/translation control signals. Methods for constructing the vector may include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to a suitable promoter in an expression vector to direct mRNA synthesis. The expression vector may also include ribosome binding sites for translation initiation, regulatory sequences, and transcription terminators. Regulatory sequences may include promoters, enhancers, transcription termination signals, polyadenylation sequences, origins of replication, nucleic acid restriction sites, and homologous recombination sites operably linked to a nucleic acid sequence. The vector may also include a selectable marker, for example, to determine expression of the vector in a growth system (e.g., bacterial cells) or in retinal target cells. For example, a vector comprising the appropriate DNA sequence described above, together with appropriate promoter or regulatory sequences, may be used to transform an appropriate host cell so that it can express the polypeptide. For example, plasmid vectors and/or viral vectors comprising sequences encoding frizzled receptor 4.

In the present application, the term "viral vector" generally means that a gene therapy vector suitable for transduction and expression in a target cell is provided. For example, the target cell may be a retinal target cell. Viral vectors include those derived from: adenoviruses, adeno-associated viruses (AAV) including mutated forms, retroviruses, lentiviruses, herpes viruses, vaccinia viruses, MMLV, gaLV, simian Immunodeficiency Virus (SIV), HIV, poxviruses, and SV40. For example, the viral vector may generally remain extrachromosomal and not integrate into the genome of the target retinal cell, or may integrate into the genome of the target retinal cell. The viral vector used to introduce the nucleic acid sequence encoding the FZD4 protein into the retinal target cells can be an AAV vector, such as a self-complementary adeno-associated virus (scAAV). Selective targeting can be achieved using specific AAV serotypes (AAV serotype 2 through AAV serotype 12) or modified versions of any of these serotypes, including AAV 4YF and AAV7m8 vectors.

In this application, the term "adeno-associated virus" or "AAV", also commonly referred to as adeno-associated virus, belongs to the genus dependovirus of the family Microviridae, and is the simplest structurally single-stranded DNA-deficient virus of the type currently found, requiring a helper virus (usually an adenovirus) to participate in replication. It encodes the cap and rep genes in inverted repeats (ITRs) at both ends. The inverted repeat sequence at the end is crucial for replication and packaging of the virus. The cap gene encodes the viral capsid protein, and the rep gene is involved in viral replication and integration. Adeno-associated viruses can infect a variety of cells. For example, adeno-associated viruses can be incorporated as recombinant adeno-associated viral vectors into the genome of the cells they infect in a stable and site-specific manner. Adeno-associated viral vectors can be prepared using standard procedures in the art, and any serotype of adeno-associated virus is suitable. Replication-defective recombinant adeno-associated viruses can be prepared by co-transfecting the following plasmids into a cell line infected with a human helper virus (e.g., adenovirus): plasmids containing the nucleic acid sequence of interest flanked by two adeno-associated virus Inverted Terminal Repeat (ITR) regions, and plasmids carrying adeno-associated virus encapsidation genes (rep and cap genes). The resulting adeno-associated virus recombinants are then purified by standard techniques. For example, a recombinant adeno-associated viral vector can be encapsidated into a virion (e.g., an AAV virion including, but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV 16). For example, a recombinant adeno-associated viral vector of the present application comprises a sequence encoding frizzled receptor 4.

In the present application, the term "serotype" generally refers to the detection of epitopes on the capsid surface of adeno-associated viruses by serological methods and the typing of adeno-associated viruses. Adeno-associated viruses have a variety of common serotypes, with over 100 virus variants. In the present application, the AAV capsid, ITRs and other selected AAV components are selected from any AAV, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV8bp, AAV7M8 and AAVAnc80, variants of any known or mentioned AAV or yet to be discovered AAV or variants or mixtures thereof.

In the present application, the term "host cell" may generally refer to a prokaryotic cell, or a lower eukaryotic cell, or a higher eukaryotic cell, such as a mammalian cell (including human and non-human mammals). Representative examples may include the following groups: CHO, NS0, COS7, or 293 cells. For example, 293T cells, photoreceptor cells (including cone cells and/or rod cells), other visual cells (e.g., binodal cells), neural cells are selected as host cells. For example, the host cell is selected from the group consisting of: rod cells, cone cells, light donating bipolar cells, light withdrawing bipolar cells, horizontal cells, ganglion cells, amacrine cells, or combinations thereof. Transformation of a host cell with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is prokaryotic, e.g., E.coli, competent cells capable of DNA uptake can be harvested after exponential growth phase using CaCl ₂ Methods, the steps used are well known in the art. Another method is to use MgCl ₂ . If desired, transformation can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods may be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome encapsulation, etc.

In the present application, the term "culturing" may generally be culturing a host cell by a conventional method to express the protein encoded by the gene of the present application. The medium used in the culture may be selected from various conventional media depending on the host cell used. The culturing is performed under conditions suitable for the growth of the host cell. After the host cells have been grown to an appropriate cell density, the selected promoter is induced by suitable means (e.g., temperature shift or chemical induction) and the cells are cultured for an additional period of time.

In the present application, the term "obtaining" of said frizzled receptor 4 may generally be obtaining recombinant human frizzled receptor 4 expressed by the host cell by conventional methods. The frizzled receptor 4 may be expressed intracellularly or on the cell membrane, or secreted extracellularly. If desired, the proteins can be isolated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of such methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (such as salt precipitation), centrifugation, cell lysis by osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques, and combinations thereof.

In the present application, the term "recombinant nucleic acid" may refer to a recombinant human frizzled receptor FZD4 optimized gene sequence. The recombinant human frizzled protein receptor FZD4 gene has an optimized nucleotide sequence shown in SEQ ID NO:1, 1614bp in size, starting from codon ATG, coding for 537 amino acids, wherein positions 40-483 may be the coding sequence of the Frizzled domain; positions 654-1509 may be the coding sequence of G protein-coupled receptor family 2 (7 tm _2domain). The recombinant nucleic acids of the present application may be in the form of DNA or RNA. For example, the recombinant nucleic acid is DNA. The form of DNA includes cDNA, genomic DNA or synthetic DNA, which may be single-stranded or double-stranded, and the DNA may be coding or non-coding.

In the present application, the term "fusion nucleic acid" may generally refer to a nucleic acid in which two or more nucleotide sequences of different origin are linked, or a nucleic acid in which two or more nucleotide sequences of the same origin but not linked to each other in their natural position are linked. For example, the nucleic acid encoding human frizzled receptor 4 (FZD 4) can be operably linked to a UTR sequence. For example, the nucleic acid encoding human frizzled receptor 4 (FZD 4) may be operably linked to a promoter sequence. For example, the nucleic acid encoding human frizzled receptor 4 (FZD 4) can be operably linked to a ployA sequence containing a stable structure.

In the present application, the term "nucleotide linker" generally refers to a nucleic acid that is used to link two or more nucleotide sequences. For example, the nucleotide linking sequence can be a linker. For example, the linker comprises an oligonucleotide of a length selected from the group consisting of: 1-30 nucleotides, 1-15 nucleotides and 3-6 nucleotides. For example, the linker comprises a nucleotide linker sequence that is cleaved by the restriction enzymes EcoRI and/or SalI.

In the present application, the term "operably linked" may refer to nucleic acid sequences that are functionally related to the sequences to which they are operably linked, such that they are linked in a manner that affects the expression or function of each other. For example, a nucleic acid sequence operably linked to a promoter will have an expression pattern that is affected by the promoter.

In the present application, the term "expression" may refer to the transcription of an RNA of interest and/or the translation of a protein of interest in a host cell from a recombinant nucleic acid, fusion nucleic acid, vector of the present application. For example, the protein of interest may be frizzled receptor 4. The recombinant nucleic acid or the fusion nucleic acid coding for the frizzled receptor 4 can produce the frizzled receptor 4 or the frizzled receptor 4 fusion protein in vitro or in vivo, and the fusion protein or the preparation containing the fusion protein can be applied to preparing FEVR for treating familial exudative retinopathy. The optimized frizzled protein receptor 4-encoding nucleic acid has higher expression level, so that more frizzled protein receptors 4 can be translated, and the optimized frizzled protein receptor 4 can be more easily expressed in human host cells. A medicament containing the recombinant nucleic acid, the fusion nucleic acid and the vector can be injected into the vitreous cavity of the rabbit eye, and the medicament can keep activity in the vitreous cavity and is transfected into retinal cells. The nucleic acids of the present application may encode more frizzled receptor 4 than is expressed in the prior art, and may be used to treat familial exudative retinopathy (FEVR).

In the present application, the term "treatment" generally refers to interventions that attempt to alter the natural course of the treated subject and may be used prophylactically or during clinical pathology. Desirable effects include, but are not limited to, preventing occurrence or recurrence of a disease, alleviating symptoms, suppressing, reducing or inhibiting any direct or indirect pathological consequences of a disease, ameliorating or alleviating a disease state, and causing remission or improving prognosis. For example, treating an ocular disorder can be restoring vision in a subject, can be increasing or maintaining the thickness of a retinal nerve fiber layer in a subject, and can be increasing or maintaining the number of retinal ganglion cells in a subject.

In the present application, the term "hereditary retinopathy" generally refers to a pathological condition of retinal abnormalities due to genetic factors. For example, the genetic pattern may be autosomal dominant, autosomal recessive, or X-linked. For example, the hereditary retinopathy may be Familial Exudative Vitreoretinopathy (FEVR). For example, retinal abnormalities or retinopathy may include, but is not limited to, retinal folds, macular ectopy, and retinal detachment and/or with ocular secondary pathologies.

In the present application, the term "retrovirus" generally refers to an integrating virus that infects dividing cells. For example, the retroviral vector of the present application can be constructed from the following retroviruses: HIV, moMuLV (Moloney murine leukemia Virus), MSV (Moloney murine sarcoma Virus), haSV (Ha Wei sarcoma Virus), SNV (splenic necrosis Virus), RSV (Rous sarcoma Virus), frand (Friend) Virus, murine Stem Cell Virus (MSCV), lentivirus, or a defective retroviral vector as disclosed.

In the present application, the term "DNA viral vector" generally refers to any DNA virus known to those skilled in the art. For example, the DNA viral vector infects mammalian cells. Examples of mammals can include, for example, laboratory animals (e.g., dogs, cats, rats, mice, and rabbits), farm animals (e.g., cows, horses, and sheep), and primates (e.g., monkeys and humans). For example, the DNA virus may be a single-stranded or double-stranded DNA virus. For example, the DNA virus may be an EB virus (EBV). For example, the DNA virus may be Kaposi's sarcoma-associated herpes virus, also known as herpes virus 8 (KSHV). For example, the DNA virus may be cytomegalovirus (HCMV).

In the present application, the term "integration" generally refers to the production of double-stranded DNA molecules from two RNA molecules carried in a viral particle, for example, by a molecular process called reverse transcription, after infection of a cell by a retrovirus, which DNA is then covalently integrated into the host cell genome, with the help of cellular and/or viral factors expressing the genes of the virus.

In the present application, the term "plasmid" generally refers to a self-contained molecule of double-stranded DNA that readily accepts additional (foreign) DNA and is readily introduced into a suitable host cell. Many vectors, including plasmids and fungal vectors, have been described that can replicate and/or express in a variety of eukaryotic and prokaryotic hosts. Non-limiting examples may include pKK plasmids (Clonetech), pUC plasmids, pET plasmids (Novagen, inc., madison, wis.), pRSET or pREP plasmids (Invitrogen, san Diego, calif.), or pMAL plasmids (New England Biolabs, beverly, mas.) and many suitable host cells using methods disclosed or referenced herein or known to those skilled in the relevant art.

In the present application, the term "pharmaceutically acceptable carrier" or "excipient" refers to: one or more compatible solid or liquid fillers or gel substances which are suitable for human use and must be of sufficient purity and sufficiently low toxicity. Compatibility as used herein may mean that the components of the composition are capable of being combined with the active ingredients of the present application and intermixed therewith without significantly diminishing the efficacy of the active ingredient. Examples of pharmaceutically acceptable carrier (carrier) moieties are cellulose and its derivatives (e.g., sodium carboxymethylcellulose, sodium ethylcellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (e.g., stearic acid, magnesium stearate), calcium sulfate, vegetable oils (e.g., soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (e.g., propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifiers (e.g., tween), wetting agents (e.g., sodium lauryl sulfate), colorants, flavors, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

In the present application, the term "pharmaceutical formulation" or "composition" may refer to a combination having a safe and effective amount of an active ingredient and a pharmaceutically acceptable carrier (carrier) or excipient (excipient). For example, an "active ingredient" in a pharmaceutical composition described herein can refer to a vector (vector) described herein, such as a viral vector (including adeno-associated viral vectors). For example, the active ingredients, formulations and/or compositions described herein may be used to treat ocular diseases. For example, a "safe and effective amount" as used herein refers to: the amount of active ingredient is sufficient to significantly ameliorate the condition or symptom without causing serious side effects. For example, the pharmaceutical formulations of the present application may be liquid or solid, such as a powder, gel or paste. For example, the pharmaceutical formulation may be a liquid, an injectable liquid. For example, the pharmaceutical formulation may be a dry powder, lyophilized formulation. Suitable excipients will be known to those skilled in the art. For example, the "pharmaceutical formulation" or "composition" may be administered to the eye by subretinal or intravitreal administration. In either mode of administration, the "pharmaceutical formulation" or "composition" is provided as an injectable liquid. For example, the injectable liquid may be provided as a capsule or a syringe. The compositions may comprise physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols and suitable mixtures thereof.

Detailed Description

Recombinant nucleic acids

In one aspect, the present application provides a recombinant nucleic acid that may comprise a nucleotide sequence encoding frizzled receptor 4 (FZD 4) or a truncation thereof. The frizzled receptor 4 may comprise the amino acid sequence shown in SEQ ID No. 3.

For example, the frizzled receptor 4-encoding nucleotide sequence may comprise the nucleotide sequence in SEQ ID No. 1.

For example, the nucleotide sequence encoding the frizzled receptor 4 may comprise any one of the nucleotide sequences having at least 90% homology to SEQ ID No. 1, such as at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homology, and the administration of the nucleotide sequence is capable of activating the Wnt signaling pathway and/or the Norrin- β -catenin signaling pathway and/or increasing the expression of the frizzled receptor 4.

For example, the nucleotide sequence encoding the frizzled receptor 4 may comprise a nucleotide sequence that is fully complementary to a nucleotide sequence having at least 90% homology to SEQ ID No. 1, e.g. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homology to any one of the nucleotide sequences, and the administration of the nucleotide sequence is capable of activating the Wnt signaling pathway and/or the Norrin- β -catenin signaling pathway and/or increasing the expression of the frizzled receptor 4.

For example, the frizzled receptor 4-encoding nucleotide sequence may comprise a frizzled receptor 4 truncation-encoding nucleotide sequence.

In one aspect, the frizzled receptor 4-encoding nucleotide sequence may comprise a truncation of frizzled receptor 4. For example, the frizzled receptor 4-encoding nucleotide sequence may comprise a frizzled receptor 4 domain a and domain B-encoding nucleotide sequence. For example, the domain a may be the Frizzled domain (CRD _ FZ domain) of Frizzled receptor 4, which is used for binding to a ligand. For example, domain B may be the G protein coupled receptor family 2domain (7 transmembrane receptor domain,7tm 2domain) of frizzle receptor 4, which is used to conduct signals to downstream molecules of the pathway. For example, the nucleotide sequence coding the structural domain A is the nucleotide sequence from 40 th to 483 th positions shown in SEQ ID NO. 1, the nucleotide sequence coding the structural domain B is the nucleotide sequence from 654 th to 1509 th positions shown in SEQ ID NO. 1, and the nucleotide sequence is applied to activate a Wnt signal path and/or a Norrin-beta-catenin signal path and/or improve the expression of a frizzled protein receptor 4.

In another aspect, the present application provides a recombinant nucleic acid, which may comprise DNA, cDNA and/or mRNA. For example, the recombinant nucleic acid comprises a single-stranded recombinant nucleic acid and/or a double-stranded recombinant nucleic acid.

In another aspect, the recombinant nucleic acid sequence of the present application may be DNA, RNA, cDNA or Peptide Nucleic Acid (PNA). The nucleic acid sequence may be genomic, recombinant or synthetic. The nucleic acid sequence may be isolated or purified. The nucleic acid sequence may be single-stranded or double-stranded. For example, the nucleic acid sequence will encode frizzled receptor 4 as described herein. Nucleic acid sequences can be derived by Cloning, for example using standard Molecular Cloning techniques including restriction, ligation, gel electrophoresis, for example as described in Sambrook et al Molecular Cloning: A Laboratory manual, cold Spring harbor Laboratory Press). The nucleic acid sequence may be isolated, for example, using PCR techniques. Isolation means the isolation of a nucleic acid sequence from any impurities and from other nucleic acid sequences and/or proteins that are naturally found in association with the nucleic acid sequence in its source. For example, the nucleic acid molecules of the present application may also be free of cellular material, culture media, or other chemicals from purification/production processes. The nucleic acid sequence may be synthetic, for example produced by direct chemical synthesis. The nucleic acid sequence may be provided as naked nucleic acid or may be provided complexed with a protein or lipid.

On the other hand, the recombinant nucleic acid of the application can improve the transcription level and the expression level compared with the wild-type nucleotide sequence for encoding the frizzled receptor 4.

Fusion nucleic acids

In one aspect, the present application provides a fusion nucleic acid comprising a recombinant nucleic acid encoding frizzled receptor 4 or a truncation thereof as described herein.

In another aspect, the fusion nucleic acid can further comprise one or more promoter sequences. For example, the promoter sequence may comprise CMV. For example, the promoter may be linked directly or indirectly to the nucleotide sequence of the recombinant nucleic acid. For example, the promoter may be operably linked to the nucleotide sequence of the recombinant nucleic acid. For example, the promoter may be operably linked to the nucleotide sequence of the recombinant nucleic acid. For example, the 3 'end of the promoter and the 5' end of the nucleotide sequence of the recombinant nucleic acid may be linked directly or indirectly.

In another aspect, the fusion nucleic acid can further comprise one or more UTR sequences. For example, the UTR sequence can comprise a 5' -UTR sequence. For example, the UTR sequence can comprise a 3' -UTR sequence.

In another aspect, the promoter sequence may comprise one or more 5' -UTR sequences. For example, the 5' -UTR sequence may be linked directly or indirectly to the nucleotide sequence of the recombinant nucleic acid. For example, the 5' -UTR sequence can be operably linked to the nucleotide sequence of the recombinant nucleic acid. For example, the 3' end of the 5' -UTR sequence and the 5' end of the nucleotide sequence of the recombinant nucleic acid may be linked directly or indirectly.

In another aspect, the promoter sequence may comprise one or more 3' -UTR sequences. For example, the 3' -UTR sequence may be linked directly or indirectly to the nucleotide sequence of the recombinant nucleic acid. For example, the 3' -UTR sequence can be operably linked to the nucleotide sequence of the recombinant nucleic acid. For example, the 5' end of the 3' -UTR sequence and the 3' end of the nucleotide sequence of the recombinant nucleic acid may be linked directly or indirectly. For example, the 3' -UTR sequence can comprise a polyA sequence.

In another aspect, the fusion nucleic acid can further comprise a promoter sequence and a 5' -UTR sequence. For example, the promoter sequence and 5' -UTR sequence may be directly or indirectly linked to the nucleotide sequence of the recombinant nucleic acid. For example, the promoter sequence and 5' -UTR sequence may be operably linked to the nucleotide sequence of the recombinant nucleic acid. For example, the 3' end of the promoter sequence may be directly or indirectly linked to the 5' end of the nucleotide sequence of the recombinant nucleic acid, and the 3' end of the 5' -UTR sequence may be directly or indirectly linked to the 5' end of the nucleotide sequence of the recombinant nucleic acid.

In another aspect, the fusion nucleic acid can further comprise a promoter sequence and a 3' -UTR sequence. For example, the promoter sequence and the 3' -UTR sequence may be linked directly or indirectly to the nucleotide sequence of the recombinant nucleic acid. For example, the promoter sequence and 3' -UTR sequence may be operably linked to the nucleotide sequence of the recombinant nucleic acid. For example, the 3' end of the promoter sequence may be directly or indirectly linked to the 5' end of the nucleotide sequence of the recombinant nucleic acid, and the 5' end of the 3' -UTR sequence may be directly or indirectly linked to the 3' end of the nucleotide sequence of the recombinant nucleic acid. For example, the 3' -UTR sequence can comprise a polyA sequence.

In another aspect, the fusion nucleic acid can further comprise a promoter sequence, a 5'-UTR sequence, and a 3' -UTR sequence. For example, the promoter sequence, 5'-UTR sequence and 3' -UTR sequence may be linked directly or indirectly to the nucleotide sequence of the recombinant nucleic acid. For example, the promoter sequence, 5'-UTR sequence and 3' -UTR sequence may be operably linked to the nucleotide sequence of the recombinant nucleic acid. For example, the 3 'end of the promoter sequence may be directly or indirectly linked to the 5' end of the nucleotide sequence of the recombinant nucleic acid, the 3 'end of the 5' -UTR sequence may be directly or indirectly linked to the 5 'end of the nucleotide sequence of the recombinant nucleic acid, and the 5' end of the 3'-UTR sequence may be directly or indirectly linked to the 3' end of the nucleotide sequence of the recombinant nucleic acid. For example, the 3' -UTR sequence can comprise a polyA sequence.

In another aspect, the indirect linkage may comprise linkage through a linker. For example, the linker may comprise an oligonucleotide of a length selected from the group consisting of: 1-30 nucleotides, 1-15 nucleotides and 3-6 nucleotides. For example, the linker may comprise an oligonucleotide of a length selected from the group consisting of: 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 8 nucleotides, 10 nucleotides, 15 nucleotides, 20 nucleotides, 25 nucleotides, 30 nucleotides.

For example, the linker may comprise a nucleotide linker sequence, which may be formed by restriction endonuclease cleavage. For example, the restriction enzyme may comprise EcoRI and/or SalI.

Carrier

In one aspect, the present application provides a vector that may comprise one or more of the whole, truncated, and/or fragments thereof of a recombinant nucleic acid and/or fusion nucleic acid described herein. For example, the vector may comprise a sequence encoding frizzled receptor 4.

In another aspect, the vector may comprise one or more promoters. A promoter may mediate the expression of a nucleic acid sequence to which it is linked. Promoters may be constitutive or may be inducible. The promoter may direct non-specific expression in the inner retinal cells, or neuron-specific expression. In the latter case, the promoter may direct cell type specific expression, for example, to an apparent ganglion cell. Suitable promoters will be known to those skilled in the art. For example, suitable promoters may be selected from the group consisting of L7, thy-1, restorer protein, calbindin, human CMV, GAD-67, chicken beta actin, hSyn, grm6, the Grm6 enhancer, SV40 fusion protein. Targeting can be achieved using cell-specific promoters, e.g., grm6-SV40 for selective targeting to optic nerve cells. The Grm6 promoter is a fusion of the 200 base pair enhancer sequence of the Grm6 gene, which encodes a metabotropic glutamate receptor mGluR6 specific for optic nerve cells, and the SV40 eukaryotic promoter. The source of the Grm6 gene can be mouse and human. Ubiquitous expression can be achieved using pan-neuronal promoters, examples of which are known and available in the art. For example, it may be CAG. The CAG promoter is a fusion of the CMV early enhancer and the chicken beta actin promoter. For example, the promoter may be the immediate early Cytomegalovirus (CMV) promoter sequence. The promoter sequence is a strong constitutive promoter sequence capable of driving high level expression of any polynucleotide sequence operably linked thereto. For example, the promoter may be elongation growth factor-1 α (EF-1 α). For example, other constitutive promoter sequences may also be used, and may include, but are not limited to, the simian virus 40 (SV 40) early promoter, the mouse mammary cancer virus (MMTV), the Human Immunodeficiency Virus (HIV) Long Terminal Repeat (LTR) promoter, the MoMuLV promoter, the avian leukemia virus promoter, the Epstein-Barr (Epstein-Barr) virus immediate early promoter, the rous sarcoma virus promoter, and human gene promoters, which may include, but are not limited to, the actin promoter, myosin promoter, heme promoter, and creatine kinase promoter. Further, the present application should not be limited to the use of constitutive promoters, and inducible promoters are also contemplated as part of the present application. The use of an inducible promoter provides a molecular switch that turns on expression of the polynucleotide sequence operably linked to the inducible promoter when expression is desired or turns off expression when expression is not desired. Examples of inducible promoters may include, but are not limited to, metallothionein promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters. For example, one or more of the promoters may be CMV, CAG, and/or the neural specific promoter SYN. For example, the promoter may be CMV.

For example, the one or more promoters CMV can be located anywhere in the vector and the CMV can initiate expression of the frizzled receptor 4. For example, CMV can precede the sequence encoding frizzled receptor 4.

In another aspect, the vector may comprise one or more enhancers. For example, the one or more enhancers can be located anywhere in the vector, and the enhancer can enhance the expression of frizzled receptor 4. For example, the enhancer may be located upstream and/or downstream from the initiation site.

In another aspect, the vector may comprise one or more transcription termination signals, polyadenylation sequences, origins of replication, selectable markers, nucleic acid restriction sites, and/or homologous recombination sites. For example, the vector may contain the gene sequence of one or more selectable markers to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli.

For example, a promoter may be operably linked to one or more of the transcription termination signal, the polyadenylation sequence, the origin of replication, the selectable marker, the nucleic acid restriction site and/or the homologous recombination site. For example, the transcription termination signal, the polyadenylation sequence, the origin of replication, the selectable marker, the nucleic acid restriction site and/or the homologous recombination site may be located near upstream and/or downstream of a promoter and/or enhancer.

In another aspect, a number of expression vectors can be used to express frizzled receptor 4 in mammalian cells (preferably human). For example, the vector may be selected from the group consisting of: lentiviral vectors, DNA viral vectors, retroviral vectors, adenoviral vectors, and adeno-associated viral vectors. For example, the vector may be selected from adeno-associated viruses. For example, the serotype of the subject vector can be selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV8bp, AAV7M8, and/or AAVAnc80, or variants and combinations thereof. For example, the adeno-associated virus can be selected from AAV2, AAV5, AAV7, and/or AAV8, or a combination thereof. For example, the adeno-associated virus can be selected from AAV2.

For example, the AAV2 vector can be AAV2/2, AAV2/5, AAV2/8, or AAV2/9. For example, the AAV2 vector can comprise pAAV-RC5-Amp, RC8-cap, AAV2/8, AAV-helper-Amp, AAV-helper. For example, the viral vector comprises a plasmid AAV-MCS.

In another aspect, the viral vector may be modified to delete any non-essential sequences. For example, AAV viruses may be modified to delete all or part of the IX, ela and/or Elb genes. Replication of wild-type AAV in the absence of a helper virus such as adenovirus can be very inefficient. For example, the replication genes and/or capsid genes of the recombinant adeno-associated virus can be provided in trans in the pRep/Cap plasmid. For example, only the 2 ITRs of the AAV genome are retained and packaged into virions, while the desired adenoviral genes are provided by adenovirus or another plasmid. For example, modifications described above can also be made to lentiviral vectors.

In another aspect, a non-viral vector such as a plasmid can be used in conjunction with an adjuvant to facilitate uptake of the vector by a target cell. For example, the adjuvant may include a polycationic agent. For example, a delivery system such as a liposome-based delivery system may be used. The vector for use in the present application may be suitable for use in vivo or in vitro, and may be suitable for use in humans.

Host cell

In one aspect, the present application provides a host cell. For example, the host cell can comprise one or more of the recombinant nucleic acids, fusions, whole, truncations, and/or fragments thereof, and/or vectors described herein. For example, the host cell has integrated into its chromosome one or more exogenous recombinant nucleic acids, whole bodies of fusion nucleic acids, truncations, and/or fragments thereof as described herein.

In another aspect, the host cell comprises a mammalian cell. For example, the host cell comprises a human cell. For example, the host cell may comprise 293T cells, photoreceptor cells, other visual cells, and/or optic nerve cells. For example, the photoreceptor cells may comprise cone cells (cones) and/or rod cells (rods). For example, the other visual cells may include, but are not limited to, feeder bipolar cells, withdrawal bipolar cells, horizontal cells, muller cells, retinal ganglion cells, and/or amacrine cells.

Pharmaceutical preparation, treatment and pharmaceutical use

In one aspect, the present application provides a pharmaceutical formulation. For example, the pharmaceutical formulation may comprise one or more recombinant nucleic acids of the present application, one or more fusion nucleic acids of the present application, and/or one or more vectors of the present application, and a pharmaceutically acceptable carrier or excipient. A pharmaceutically acceptable carrier or excipient may refer to any ingredient that is not therapeutically active and has acceptable toxicity, such as buffers, solvents, tonicity agents, stabilizers, antioxidants, surfactants, or polymers that may be used in formulating a pharmaceutical product. For example, the formulation may be a liquid formulation.

For example, the pharmaceutical formulation may comprise one or more carriers of the present application. For example, the vector may comprise a recombinant nucleic acid, which may comprise a nucleotide sequence encoding frizzled receptor 4, and/or a fusion nucleic acid.

In another aspect, the pharmaceutical formulation comprises a carrier of the present application. For example, the carrier may be present in an amount of 1X 10 ⁹ -1×10 ¹⁶ Individual virus/ml. For example, the carrier may be present in an amount of 1X 10 ¹¹ -1×10 ¹³ Individual virus/ml. For example, the carrier may be present in an amount of 2X 10 ¹¹ -1×10 ¹² One virus/ml. For example, the carrier may be present in an amount of 1X 10 ⁹ 1X 10 individual viruses/ml ¹⁰ 1X 10 individual viruses/ml ¹¹ 2X 10 virus/ml ¹¹ 2X 10 virus/ml ¹¹ Individual virus/ml, 4X 10 ¹¹ Individual virus/ml, 6X 10 ¹¹ Individual virus/ml, 8X 10 ¹¹ Virus/ml, 9X 10 ¹¹ 1X 10 virus/ml ¹² 2X 10 virus/ml ¹² Individual virus/ml, 3X 10 ¹² Individual virus/ml, 5X 10 ¹² 1X 10 virus/ml ¹³ 1X 10 individual viruses/ml ¹⁴ 1X 10 virus/ml ¹⁵ 1X 10 individual viruses/ml ¹⁶ Individual virus/ml.

For example, when the pharmaceutical formulation comprises a vector of the present application, the pharmaceutical formulation can be administered by administering the vector to a cell or subject. For example, when the pharmaceutical formulation comprises two or more vectors of the present application, the pharmaceutical formulation can be administered by administering the two or more vectors to the cell or subject simultaneously. For example, when the pharmaceutical formulation comprises two or more vectors of the present application, the pharmaceutical formulation may be administered by administering the two or more vectors to the cell or subject in any order. For example, the pharmaceutical formulation may be injected intraocularly. For example, the formulation may be injected in the vitreous cavity.

In another aspect, the present application provides a method of restoring vision and/or treating an ocular disorder in a subject. For example, the ocular disease may be retinopathy. For example, the retinopathy may be Familial Exudative Vitreoretinopathy (FEVR). For example, a pharmaceutical formulation described herein is administered to a cell or subject.

In another aspect, the present application provides a method of increasing the expression and/or activity of frizzled receptor 4 (FZD 4). For example, the medicament is used for activating a Wnt signaling pathway and/or a Norrin-beta-catenin signaling pathway. For example, a pharmaceutical formulation described herein is administered to a cell or subject.

In another aspect, the present application provides the use of a vector, recombinant nucleic acid, fusion nucleic acid and/or pharmaceutical formulation in the manufacture of a medicament. For example, the medicament is for restoring vision and/or treating an ocular disease in a subject. For example, the ocular disease may be retinopathy. For example, the retinopathy may be Familial Exudative Vitreoretinopathy (FEVR). For example, the medicament is for increasing the expression and/or activity of frizzled receptor 4 (FZD 4). For example, the medicament is used for activating a Wnt signaling pathway and/or a Norrin-beta-catenin signaling pathway.

In another aspect, the present application provides a vector, recombinant nucleic acid, fusion nucleic acid, and/or pharmaceutical formulation. For example, it is used to restore vision in a subject and/or to treat an ocular disease. For example, the ocular disease may be retinopathy. For example, the retinopathy may be Familial Exudative Vitreoretinopathy (FEVR). For example, it is useful for increasing the expression and/or activity of frizzled receptor 4 (FZD 4). For example, the medicament is used for activating a Wnt signaling pathway and/or a Norrin-beta-catenin signaling pathway.

For example, the pharmaceutical formulation may cause long-term high expression of the frizzled receptor 4 (FZD 4) in retinal cells. For example, the high expression may mean that the amount of protein expressed in a cell or a subject after administration of the pharmaceutical preparation described herein may be 1.1 times or more, 1.3 times or more, 1.5 times or more, two times or more, three times or more, five times or more, ten times or more, twenty times or more, thirty times or more, fifty times or more, one hundred times or more, one thousand times or more, or fifteen hundred times or more, which is not administered. For example, the high expression may mean that the expression level of the protein in the cell or the subject after administration of the pharmaceutical preparation described herein is 1.1 times or more, 1.3 times or more, 1.5 times or more, two times or more, three times or more, five times or more, ten times or more, twenty times or more, thirty times or more, fifty times or more, one hundred times or more, one thousand times or more, or one thousand times or more, of the expression level in the cell or the subject after administration of the control vector. For example, the long-acting can mean that, after administration of a vector or pharmaceutical formulation of the present application, the high expression level can be maintained in a cell or subject for a period of at least 7 days, at least 15 days, at least 20 days, at least 30 days, at least 45 days, at least 60 days, at least 90 days, or at least three months, at least four months, at least five months, at least six months, as compared to no administration or administration of a control vector.

For example, the pharmaceutical formulation may activate the Wnt signaling pathway and/or the Norrin- β -catenin signaling pathway for a long period of time. For example, the activation may refer to the level of activation and/or inhibition of a Wnt signaling pathway and/or a Norrin- β -catenin signaling pathway downstream protein in a cell or subject after administration of a pharmaceutical formulation described herein may be 1.1 times or more, 1.3 times or more, 1.5 times or more, two times or more, three times or more, five times or more, ten times or more, twenty times or more, thirty times or more, fifty times or more, one hundred times or more, one thousand times or more, of the level of activation and/or inhibition of the Wnt signaling pathway and/or the Norrin- β -catenin signaling pathway downstream protein in the cell or subject. For example, the activation may refer to the level of activation and/or inhibition of a downstream protein of the Wnt signaling pathway and/or the Norrin- β -catenin signaling pathway in a cell or a subject after administration of the pharmaceutical preparation described herein may be 1.1 times or more, 1.3 times or more, 1.5 times or more, two times or more, three times or more, five times or more, ten times or more, twenty two times or more, thirty times or more, fifty times or more, one hundred times or more, five hundred times or more, one thousand times or more, or fifteen hundred times or more of the expression amount after administration of the control vector. For example, the long-acting may refer to a cell or subject that can maintain the level of activation and/or inhibition of a protein downstream of the Wnt signaling pathway and/or Norrin- β -catenin signaling pathway described above for a period of at least 7 days, at least 15 days, at least 20 days, at least 30 days, at least 45 days, at least 60 days, at least 90 days, or at least three months, at least four months, at least five months, at least six months after administration of a vector or pharmaceutical formulation of the present application as compared to no administration or administration of a control vector.

For example, intraocular injection of the pharmaceutical formulation may not cause a significant inflammatory response or other complications in the subject. For example, the inflammatory response or other complication may be increased intraocular pressure, conjunctival congestion, ocular inflammation, ocular fundus hemorrhage or leukogenic damage to the lens, ocular secretions increase and/or endophthalmitis.

In the present application, the subject may include humans and non-human animals. For example, the subject may include, but is not limited to, a cat, dog, horse, pig, cow, sheep, rabbit, mouse, rat, or monkey; for example, the subject may comprise a DBA/2J mouse. In the present application, the cells may comprise bacterial cells (e.g., E.coli), yeast cells, or other eukaryotic cells, such as COS cells, chinese Hamster Ovary (CHO) cells, heLa cells, HEK293 cells, COS-1 cells, NS0 cells, or myeloma cells, 293T cells.

Preparation method

In one aspect, the present application provides a method of making frizzled receptor 4. For example, the full-length nucleotide sequence of the recombinant nucleic acid and/or fusion nucleic acid of the present application or a fragment thereof can be obtained by a PCR amplification method, a recombinant method, or a synthetic method. For example, in the case of PCR amplification, primers can be designed based on the disclosed nucleotide sequences, particularly open reading frame sequences, and the sequences can be amplified using a commercially available cDNA library or a cDNA library prepared by a conventional method known to those skilled in the art as a template. For example, when the sequence is long, two or more PCR amplifications can be performed, and then the amplified fragments can be spliced together in the correct order. For example, a DNA sequence encoding frizzled receptor 4 can be obtained entirely by chemical synthesis, and then the DNA sequence can be introduced into various existing DNA molecules (or vectors) and cells known in the art. For example, a recombinant nucleic acid, fusion nucleic acid, vector or host cell of the present application can be isolated.

On the other hand, after obtaining the sequences of the present application, the sequences can be obtained in large quantities by recombinant methods. For example, it can be cloned into a vector, transferred into a host cell, and then isolated from the propagated host cell by conventional culture and isolation methods to obtain the relevant sequence. For example, the sequence can be synthesized by artificial synthesis, and a long fragment can be obtained by synthesizing a plurality of small fragments and then connecting the small fragments. For example, the nucleic acid sequences of the present application can be obtained by methods for amplifying DNA/RNA using PCR techniques. The primers used for PCR can be appropriately selected according to the sequence information of the present application disclosed herein, and can be synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

In another aspect, the nucleotide sequence encoding frizzled receptor 4 of the present application can be introduced into a host cell (e.g., a mammalian cell) using conventional techniques. For example, it includes the transfer of a recombinant nucleic acid, fusion nucleic acid, or vector of the present application into a host cell. For example, the resulting host cell can be cultured by a conventional method to express frizzled receptor 4 encoded by the gene of the present application. The medium used in the culture may be selected from various conventional media depending on the host cell used. The culture is performed under conditions suitable for the growth of the host cells, and after the host cells have grown to an appropriate cell density, the selected promoter may be induced by an appropriate method (e.g., temperature shift or chemical induction) and the cells are cultured for an additional period of time.

In another aspect, the frizzled receptor 4 can be expressed within a host cell, or on the cell membrane, or secreted outside the cell. For example, physical, chemical and other properties of frizzled receptor 4 can be exploited for isolation and purification by various isolation methods. Examples of such methods known to those skilled in the art include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (such as salt precipitation), centrifugation, cell lysis by osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques, and combinations thereof.

The present application also provides the following embodiments:

1. a recombinant nucleic acid comprising a nucleotide sequence encoding frizzled receptor 4 (FZD 4) or a truncation thereof.

2. The recombinant nucleic acid of embodiment 1, comprising a nucleotide sequence selected from the group consisting of:

a) The nucleotide sequence shown in SEQ ID NO. 1;

b) A nucleotide sequence with homology of more than or equal to 99 percent with the nucleotide sequence shown in SEQ ID NO. 1;

c) A nucleotide sequence with homology of more than or equal to 98 percent with the nucleotide sequence shown in SEQ ID NO. 1;

d) A nucleotide sequence with homology of more than or equal to 95 percent with the nucleotide sequence shown in SEQ ID NO. 1;

e) A nucleotide sequence with homology of more than or equal to 90 percent with the nucleotide sequence shown in SEQ ID NO. 1;

f) A nucleotide sequence with homology of more than or equal to 85 percent with the nucleotide sequence shown in SEQ ID NO. 1; and

g) A nucleotide sequence with homology of more than or equal to 80 percent with the nucleotide sequence shown in SEQ ID NO. 1.

3. The recombinant nucleic acid of any one of embodiments 1-2, comprising a nucleotide sequence selected from the group consisting of

Complementary nucleotide sequence:

a) The nucleotide sequence shown in SEQ ID NO. 1;

4. The recombinant nucleic acid according to embodiment 1, wherein the truncation comprises a domain A and a domain B, wherein the nucleotide sequence encoding the domain A is the nucleotide sequence from position 40 to 483 as shown in SEQ ID No. 1, and the nucleotide sequence encoding the domain B is the nucleotide sequence from position 654 to 1509 as shown in SEQ ID No. 1.

5. The recombinant nucleic acid according to any one of embodiments 1-4, comprising DNA, cDNA and/or mRNA.

6. The recombinant nucleic acid according to any one of embodiments 1-5, comprising a single-stranded recombinant nucleic acid and/or a double-stranded recombinant nucleic acid.

7. A fusion nucleic acid comprising the nucleotide sequence of the recombinant nucleic acid of any one of embodiments 1-6.

8. The fusion nucleic acid of embodiment 7, comprising a promoter sequence.

9. The fusion nucleic acid of embodiment 8, wherein the promoter comprises CMV.

10. The fusion nucleic acid according to any one of embodiments 8-9, wherein the promoter is linked directly or indirectly to the nucleotide sequence of the recombinant nucleic acid.

11. The fusion nucleic acid according to any one of embodiments 8-10, wherein the 3 'end of the promoter is linked directly or indirectly to the 5' end of the nucleotide sequence of the recombinant nucleic acid.

12. The fusion nucleic acid according to any one of embodiments 7-11, comprising a UTR sequence.

13. The fusion nucleic acid of any one of embodiments 7-12, comprising a 5' -UTR sequence.

14. The fusion nucleic acid of embodiment 13, wherein the 5' -UTR sequence is directly or indirectly linked to a nucleotide sequence of the recombinant nucleic acid.

15. The fusion nucleic acid according to any one of embodiments 13-14, wherein the 3' end of the 5' -UTR sequence is directly or indirectly linked to the 5' end of the nucleotide sequence of the recombinant nucleic acid.

16. The fusion nucleic acid of any one of embodiments 7-15, comprising a 3' -UTR sequence.

17. The fusion nucleic acid of embodiment 16, wherein the 3' -UTR sequence comprises a polyA sequence.

18. The fusion nucleic acid according to any one of embodiments 16-17, wherein the 3' -UTR sequence is directly or indirectly linked to a nucleotide sequence of the recombinant nucleic acid.

19. The fusion nucleic acid according to any one of embodiments 16-18, wherein the 5' end of the 3' -UTR sequence is linked directly or indirectly to the 3' end of the nucleotide sequence of the recombinant nucleic acid.

20. The fusion nucleic acid of any one of embodiments 10-19, wherein said indirect linkage comprises linkage via a linker.

21. The fusion nucleic acid of embodiment 20, wherein the linker comprises an oligonucleotide of a length selected from the group consisting of: 1-30 nucleotides, 1-15 nucleotides and 3-6 nucleotides.

22. The fusion nucleic acid of any one of embodiments 20-21, wherein the linker comprises a nucleotide linker sequence formed by cleavage with a restriction enzyme.

23. The fusion nucleic acid of embodiment 22, wherein the restriction enzyme comprises EcoRI and/or SalI.

24. A vector comprising the recombinant nucleic acid of any one of embodiments 1-6 and/or the fusion nucleic acid of any one of embodiments 7-23.

25. The vector of embodiment 24, comprising a promoter.

26. The vector of embodiment 25, wherein the promoter is operably linked to the nucleotide sequence of the recombinant nucleic acid and/or the fusion nucleic acid.

27. The vector according to any one of embodiments 24-26, comprising an enhancer, a transcription termination signal, a polyadenylation sequence, an origin of replication, a selectable marker, a nucleic acid restriction site and/or a homologous recombination site.

28. The vector of embodiment 27, said enhancer, said transcription termination signal, said polyadenylation sequence, said origin of replication, said selectable marker, said nucleic acid restriction site and/or said homologous recombination site being operably linked to said promoter.

29. The vector according to any one of embodiments 24-28, comprising a plasmid and/or a viral vector.

30. The vector of embodiment 29, wherein the viral vector is a lentiviral vector, a DNA viral vector, a retroviral vector, an adenoviral vector, and an adeno-associated viral vector.

31. The vector according to any one of embodiments 29-30, wherein the viral vector is an adeno-associated virus having a serotype selected from the group consisting of: AAV1, AAV2, AAV5, AAV6, AAV7, AAV8, AAV9 and AAVrh10.

32. The vector of any one of embodiments 29-31, wherein the viral vector comprises a plasmid AAV-MCS.

33. The vector according to any one of embodiments 24-32 for expressing frizzled receptor 4.

34. An isolated cell comprising the recombinant nucleic acid of any one of embodiments 1-6, the fusion nucleic acid of any one of embodiments 7-23, and/or the vector of any one of embodiments 24-33, or having integrated into the chromosome of the cell an exogenous recombinant nucleic acid of any one of embodiments 1-6 or the fusion nucleic acid of any one of embodiments 7-23.

35. The cell of embodiment 34, comprising a mammalian cell.

36. The cell of embodiment 35, wherein the mammal comprises a human.

37. The cell according to any one of embodiments 34-36, selected from the group consisting of: 293T cells, photoreceptor cells, ganglion cells and optic nerve cells.

38. The cell of embodiment 37, wherein the photoreceptor cell comprises a cone cell and/or a rod cell.

39. The cell according to any one of embodiments 34-38, selected from the group consisting of: rod cells, cone cells, light donating bipolar cells, light withdrawing bipolar cells, horizontal cells, retinal ganglion cells, and amacrine cells.

40. A pharmaceutical formulation comprising the recombinant nucleic acid of any one of embodiments 1-6, the fusion nucleic acid of any one of embodiments 7-23, and/or the vector of any one of embodiments 24-33, and a pharmaceutically acceptable adjuvant.

41. The pharmaceutical formulation of embodiment 40, comprising a lyophilized formulation and/or a liquid formulation.

42. The pharmaceutical formulation of any one of embodiments 40-41, wherein the carrier is present in an amount comprising 1 x 10 ⁹ -1×10 ¹⁶ Individual virus/ml.

43. The pharmaceutical formulation of any one of embodiments 40-42, wherein the carrier is present in an amount comprising 1 x 10 ¹¹ -1×10 ¹³ Individual virus/ml.

44. The pharmaceutical formulation of any one of embodiments 40-43, wherein the carrier is present in an amount comprising 2 x 10 ¹¹ -1×10 ¹² Individual virus/ml.

45. The pharmaceutical formulation of any one of embodiments 40-44, wherein the pharmaceutical formulation is for use in treating an ocular disease comprising Familial Exudative Vitreoretinopathy (FEVR).

46. The pharmaceutical formulation according to any one of embodiments 40-45, wherein the pharmaceutical formulation is for increasing the expression and/or activity of the frizzled 4 receptor (FZD 4).

47. The pharmaceutical formulation of any one of embodiments 40-46, wherein the pharmaceutical formulation is for increasing expression of frizzled receptor 4 (FZD 4) three times or more than three times background expression.

48. The pharmaceutical formulation of any one of embodiments 40-47, wherein the pharmaceutical formulation is for increasing expression of frizzled receptor 4 (FZD 4) by five or more times background expression.

49. A method of chronically increasing the expression and/or activity of frizzled receptor 4 (FZD 4), the method comprising administering to a subject in need thereof a therapeutically effective amount of the recombinant nucleic acid of any one of embodiments 1-6, the fusion nucleic acid of any one of embodiments 7-23, the vector of any one of embodiments 24-33, and/or the pharmaceutical formulation of any one of embodiments 40-48.

50. The method of embodiment 49, wherein the vector comprises an adeno-associated viral vector.

51. The method according to any one of embodiments 49-50, which activates the Wnt signaling pathway and/or the Norrin- β -catenin signaling pathway.

52. A use comprising administering to a subject in need thereof a therapeutically effective amount of the recombinant nucleic acid of any one of embodiments 1-6, the fusion nucleic acid of any one of embodiments 7-23, the vector of any one of embodiments 24-33, and/or the pharmaceutical formulation of any one of embodiments 40-48.

53. The use according to embodiment 52, comprising treating an ocular disease.

54. The use of embodiment 53, wherein the ocular disease comprises treatment of Familial Exudative Vitreoretinopathy (FEVR).

55. The use of embodiment 54, the familial exudative vitreoretinopathy is caused by a frizzled receptor 4 mutation.

56. The use of any one of embodiments 52-55, wherein the vector comprises an adeno-associated viral vector.

57. The use of any one of embodiments 52-56, wherein said recombinant nucleic acid, said fusion nucleic acid, said vector and/or said pharmaceutical formulation is injected intraocularly.

58. The use of embodiment 57, the intraocular injection comprises a vitreous intracavitary injection.

59. The use according to any one of embodiments 52-58, wherein the subject comprises a human and a non-human mammal.

60. The use according to any one of embodiments 52-59, which increases the expression and/or activity of frizzled receptor 4 (FZD 4).

61. The use according to any one of embodiments 52-60, which increases the expression and/or activity of frizzled receptor 4 (FZD 4) for 3 months or more than 3 months.

62. The use according to any one of embodiments 52-61, which increases the expression and/or activity of frizzled receptor 4 (FZD 4) for 6 months or more than 6 months.

63. The use according to any one of embodiments 52-62, which activates the Wnt signaling pathway and/or the Norrin- β -catenin signaling pathway.

64. Use of the recombinant nucleic acid of any one of embodiments 1-6, the fusion nucleic acid of any one of embodiments 7-23, and/or the vector of any one of embodiments 24-33 in the preparation of a medicament for restoring vision and/or treating an ocular disease in a subject.

65. The use of embodiment 64, wherein the ocular disease comprises retinopathy.

66. The use according to any one of embodiments 64-65, wherein the ocular disease comprises Familial Exudative Vitreoretinopathy (FEVR).

67. A recombinant nucleic acid according to any one of embodiments 1 to 6, a fusion nucleic acid according to any one of embodiments 7 to 23, and/or a vector according to any one of embodiments 24 to 33 for use in restoring vision and/or treating an ocular disease in a subject.

68. A recombinant nucleic acid according to any one of embodiments 1 to 6, a fusion nucleic acid according to any one of embodiments 7 to 23, and/or a vector according to any one of embodiments 24 to 33 for use in the treatment of a retinopathy.

69. A recombinant nucleic acid according to any one of embodiments 1 to 6, a fusion nucleic acid according to any one of embodiments 7 to 23, and/or a vector according to any one of embodiments 24 to 33 for use in the treatment of Familial Exudative Vitreoretinopathy (FEVR).

70. A method of making a frizzled receptor 4 comprising culturing a cell of any one of embodiments 34-39.

71. The method of embodiment 70, further comprising the step of isolating the frizzled receptor 4 produced.

Without intending to be bound by any theory, the following examples are merely intended to illustrate the fusion proteins, preparation methods, uses, etc. of the present application, and are not intended to limit the scope of the invention of the present application.

Examples

Example 1 viral vector construction and viral packaging purification thereof

The present application optimizes the gene sequence of the wild-type applicant frizzled receptor 4 (FZD 4), and the expression level of the non-optimized wild-type DNA coding sequence is low. Through the sequence optimization, and through analysis and experimental screening, the nucleotide sequence encoding the human frizzled receptor 4 of the application is obtained. Wherein, the amino acid sequence of the human frizzled protein receptor 4 is shown as SEQ ID NO. 3, the nucleotide sequence of the wild type coding human frizzled protein receptor 4 is shown as SEQ ID NO. 2, and the nucleotide sequence subjected to sequence optimization in the application is shown as SEQ ID NO. 1.

As shown in fig. 1, the sequence similarity of the recombinant nucleic acid of the present application with the wild-type nucleotide sequence was 77.5% by sequence alignment. As shown in fig. 2, the protein structure of the frizzled receptor 4 transcript is schematically shown. Wherein domain A encodes the Frizzled domain of Frizzled receptor 4 (CRD _ FZ domain) and domain B encodes the G protein-coupled receptor family 2domain of Frizzled receptor 4 (7 transmembrane receptor, 7tm_2domain).

And (3) constructing a virus vector. The recombinant human frizzled protein receptor 4 gene (the nucleotide sequence is shown in SEQ ID NO: 1) is added with EcoRI and SalI restriction sites, PCR amplification is carried out on a new gene design primer, the obtained product and an AAV-MCS plasmid vector are respectively subjected to EcoRI and SalI double restriction, the restriction enzyme product is recovered, and T4DNA Ligase (Ligase) is connected overnight. And transforming the connecting product into competent cells to obtain the recombinant adeno-associated virus expression vector.

Screening and identifying recombinants. Taking an LB plate to coat the obtained recombinant adeno-associated virus expression vector, and culturing at 37 ℃ to generate blue spots and white spots, wherein white is recombinant clone. White colonies were picked up and added to LB liquid medium containing 100mg/L ampicillin (Amp), and cultured at 37 ℃ at 200 rpm for 8 hours. After culturing, the bacterial liquid was taken out, and plasmids were extracted, and the plasmid extraction procedure was performed by referring to extraction kit (Biomiga) and the instructions. 1 microliter of plasmid was used as a template for PCR amplification, and the procedure for PCR amplification is shown in Table 1.

TABLE 1 PCR amplification procedure

The specific primers are as follows:

a forward primer (1F) 5'-TTGGCAAAGAATTGGGATTC-3' (the sequence is shown as SEQ ID No.: 4);

the reverse primer (1R) is 5'-TGCTCGAGAGATCTACGGGT-3' (the sequence is shown in SEQ ID NO. 5).

As shown in FIG. 3, the PCR product was electrophoretically detected to obtain a target band of about 1614bp in size. The identification result shows that the clone contains the target gene.

And (3) preserving bacterial liquid, performing PCR amplification and sequencing fragments of the bacterial liquid. Sucking 1mL of identified bacterial liquid and sterilized glycerol 1:3 in proportion, mixing uniformly, storing at-80 ℃ and sequencing bacterial liquid. And comparing and analyzing the sequence obtained by sequencing with a recombinant human II mitochondrial dynamic protein sample GTP enzyme gene. Successfully obtaining the recombinant adeno-associated virus expression vector AAV-MCS-rAAV2/2-rhFZD4 with correct sequence.

As shown in FIG. 4, the structural diagram of the expression vector AAV-MCS-rAAV2/2-rhFZD4 is shown.

The recombinant adeno-associated virus rAAV2/2-rhFZD4 is coated. The day before transfection, 293T cells were seeded at 225cm ² In a cell culture flask, the inoculation density is 3.0 × 10 ⁷ The cells/mL, the culture medium is DMEM containing 10% bovine serum, and the cells are placed at 37 ℃ and contain 5% CO ₂ The incubator of (2) for overnight culture; on the day of transfection, cells were changed and fresh 10% bovine blood was usedThe culture was continued in clear DMEM medium. When the cells grow to 80-90%, the culture medium is discarded, and transfection is carried out by using a plasmid Trans II (VGTC) transfection kit (Invitrogen), and the specific steps are as follows: mixing pAdhelper (Biovector), pAAV-r2c5 (Biovector) and AAV-MCS-rAAV2/2-rhFZD4 plasmids according to the requirements of the specification in each transfection bottle, uniformly mixing the plasmids with DMEM-added plasmid Trans II (VGTC) (transfection reagent) in a 1.5mL sterile Ep tube, numbering as reagent A, and standing at room temperature for 10-15 minutes; uniformly mixing the reagent A with 30mL of DMEM containing 10% bovine serum, and numbering the reagent B; adding reagent B into cell culture bottle uniformly, and adding 5% CO at 37 deg.C ₂ Continuously culturing in the incubator; 16 hours after transfection, the medium was replaced with DMEM containing 10% bovine serum. 48 hours after transfection, cells were harvested, and the harvested cells were resuspended in PBS and freeze-thawed repeatedly 3 times to obtain cells containing the viral vector rAAV2/2-rhFZD4 as described herein.

And (3) purifying and concentrating the recombinant adeno-associated virus rAAV2/2-rhFZD4. And separating, concentrating and purifying the recombinant adeno-associated virus rAAV2/2-rhFZD4 by three steps of chloroform treatment, PEG/NaCl precipitation and chloroform extraction.

And (5) virus purity verification. And pouring SDS-PAGE separation gel and lamination gel, wherein the concentration of the separation gel is 10%. Each well was loaded with 15. Mu.g of the sample. After electrophoresis, the gel is stained with Coomassie brilliant blue, and is decolorized with corresponding decolorizing solution until a clear band with low background is shown.

As shown in figure 5, the recombinant adeno-associated virus rAAV2/2-rhFZD4 has clear bands, normal proportion, no visible miscellaneous bands and purity of more than 99 percent.

The titer of the recombinant adeno-associated virus rAAV2/2-rhFZD4 is determined by a fluorescent quantitative PCR method. Experimental materials: SYBR ii (takara); target fragment primers (20 uM) are used for accurately quantifying packaging viruses by using target plasmids, the viruses to be detected are subjected to fluorescent quantitative detection, and PCR reaction conditions in a PCR eight-tube (Bio-red) are pre-denaturation: 10 minutes at 95 ℃; and (3) circulation: 95 ℃ for 15 seconds, 60 ℃ for 1 minute. Finally, the genome titer of the recombinant adeno-associated virus rAAV2/2-rhFZD4 is determined to be 1 x 10 ¹² vg/mL。

By referring to the method, the viral vector rAAV2/2-hFZD4 expressing wild-type human frizzled receptor 4 is constructed, separated and purified.

Example 2 Rabbit intravitreal injection experiment

Dividing 24 rabbits into 3 groups, including experiment group A (rAAV 2/2-rhFZD 4), experiment group B (wild type rAAV2/2-hFZD 4) and control group (rAAV 2/2-ZsGreen, source: shandong Weizhen Biotech Co., ltd.), and respectively sucking 50 μ l of 1 × 10 ¹² vg/mL of rAAV2/2-rhFZD4, rAAV2/2-hFZD4 and rAAV2/2-ZsGreen penetrated the pars plana of the ciliary body 3 mm outside the limbus into the vitreous cavity for intravitreal injection. Each group of rabbits was examined for slit lamp and intraocular pressure at 1, 3, 7, and 30 days after surgery. All rabbits had no obvious abnormality, no conjunctival congestion, no secretion, no endophthalmitis, and no increase in intraocular pressure. After 30 days of intravitreal injection, the retinas were dissected and RNA and protein were extracted for expression testing.

And detecting the expression of the human frizzled protein receptor 4 by real-time fluorescent quantitative PCR. Total RNA of rabbit retinas of an experimental group A (rAAV 2/2-rhFZD4 in the application), an experimental group B (wild type rAAV2/2-rhFZD 4) and a control group (rAAV 2/2-ZsGreen) is extracted by using a TRIZOL kit and is reversely transcribed to synthesize a cDNA template. Then, according to the primer design principle of fluorescent quantitative PCR, a primer premier 5 is used for designing a primer (rabbit-actin is used as an internal reference):

rabbit-actin-forward primer: CCTTCTACAACGAGCTGCGC (SEQ ID NO.: 6);

rabbit-actin-reverse primer: TACAGGGACAGCACGGCC (sequence as shown in SEQ ID No.: 7);

hFZD 4-forward primer: CCTGAGCGCCCCATCATATT (SEQ ID NO: 8);

hFZD 4-reverse primer: GAACAGGTTCTGCTGCCTCT (SEQ ID NO: 9);

rhFZD 4-forward primer: ACTGGGCTGTGTTATGTCGG (SEQ ID NO: 10);

rhFZD 4-reverse primer: GTTTGTCGGTTTTCGTCCCG (sequence shown in SEQ ID No.: 11).

And (3) carrying out fluorescent quantitative PCR reaction. The fluorescent quantitative PCR was performed on a Real-time fluorescent quantitative PCR instrument (Real-time PCR Detection System). SYBR Green mix 12.5. Mu.l was added to a 0.2mL PCR reaction tube,ddH ₂ O8. Mu.l, 1. Mu.l each of a pair of primers, 2.5. Mu.l of cDNA sample, and 25. Mu.l of total. Each sample is used for amplifying a target gene and an internal reference gene rabbit-actin, and amplification of each gene is repeated three times. In order to reduce errors in actual sample application, reagents common to the individual PCR reaction tubes may be added together and then dispensed. After the sample is added, performing fluorescence quantitative PCR. Amplification was performed according to a 40 cycle reaction program of pre-denaturation at 95 ℃ for 1 second, denaturation at 94 ℃ for 15 seconds, annealing at 55 ℃ for 15 seconds, and extension at 72 ℃ for 45 seconds, and fluorescence signals were collected at the extension stage of each cycle. And after the reaction is finished, analyzing a melting curve at 94-55 ℃. The difference of gene expression quantity is researched by adopting a relative quantification method, a standard curve is not required to be made by the method, the housekeeping gene rabbit-actin is taken as an internal reference gene, and the analysis software carried by an instrument can automatically generate an expression numerical value.

As shown in FIG. 6, the relative expression levels of mRNA in the genes of the experimental group A and the experimental group B were higher than those of the control group, and the relative expression level of mRNA in the experimental group A was higher than that in the experimental group B. The expression level of the frizzled receptor 4 of the viral vector rAAV2/2-rhFZD4 on the retina is obviously higher than that of the wild type.

Western immunoblotting (Western blot) examined the expression of human frizzled receptor 4. The anti-rabbit anti-human frizzled protein receptor 4 comes from sigma, and the secondary antibody is goat anti-rabbit and comes from sigma. The retinas of rabbit eyeballs of an experimental group A (rAAV 2/2-rhFZD4 of the application), an experimental group B (wild type rAAV2/2-hFZD 4) and a control group (rAAV 2/2-ZsGreen) are separated, RIPA lysate with corresponding volume is added according to 100 microliter/50 mg of tissues, and the supernatant is collected by centrifugation after homogenate by a homogenizer. After the BCA method determines the protein concentration, the loading volume of each group is calculated according to 50 micrograms of total protein, and SDS-PAGE gel electrophoresis and protein immunoblotting detection are carried out. Antibody incubation was followed by chemiluminescence reagent (ECL) development.

As shown in fig. 7, the relative expression level of human frizzled receptor 4 in experimental group a is significantly higher than that in experimental group B and control group, and the significant difference P > 0.05 indicates that the expression level of human frizzled receptor 4 on retina in experimental group a is significantly increased, which is increased by about 2 times and 5 times compared to experimental group B and control group, respectively.

The foregoing detailed description is provided by way of illustration and example, and is not intended to limit the scope of the appended claims. Various modifications of the presently described embodiments will be apparent to those of ordinary skill in the art and are intended to be within the scope of the appended claims and their equivalents.

Sequence listing

<110> Wuhan Newcastle Biotechnology Ltd

<120> expression vector of recombinant human frizzled protein receptor 4 (FZD 4) and application thereof

<130> 0179-PA-004

<160> 11

<170> PatentIn version 3.5

<210> 1

<211> 1614

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> rhFZD4

<400> 1

atggcatgga gaggagctgg accatctgta ccaggagctc ctggaggtgt tggccttagt 60

ctgggtcttc tgctgcagct cctgcttctt ttgggccccg ccagaggctt tggcgatgag 120

gaagaaagac gctgcgatcc tattaggatc tccatgtgtc agaatttggg gtataacgtt 180

acaaaaatgc ctaacctcgt tggccatgag ctgcagacag atgctgagct tcaactgaca 240

acatttacac ccctgatcca gtatggctgc tccagccagc ttcagttctt cctgtgttca 300

gtgtatgttc ccatgtgcac ggaaaaaatc aacattccca ttggtccatg tggggggatg 360

tgtctctccg tcaaaaggcg ctgtgagcct gtcctgaaag aatttgggtt cgcatggccc 420

gagtccctta actgtagcaa attcccacca cagaacgacc ataaccacat gtgtatggag 480

gggcccgggg atgaagaggt acctctccct cataagactc ccattcagcc gggcgaagaa 540

tgtcactcag ttggaaccaa cagtgaccaa tacatttggg tgaagaggag cctgaactgt 600

gtcctgaaat gcgggtatga tgcgggcttg tactccagga gtgctaaaga atttaccgac 660

atttggatgg ctgtgtgggc tagcctctgt ttcatttcaa ccgctttcac agtcctgact 720

tttctcatcg actctagtcg gttttcttac cctgaaagac caattatttt cctcagcatg 780

tgttataaca tttacagtat cgcctacatc gtacggttga ccgtcggaag agagcgcatt 840

tcttgtgatt ttgaggaggc tgcagaaccc gtgctgatcc aggaaggcct taaaaacaca 900

gggtgcgcta tcatctttct gttgatgtac ttcttcggga tggccagttc tatctggtgg 960

gtcatcctga ctctgacatg gtttcttgcc gccggcctta aatggggtca tgaagccatt 1020

gagatgcatt cttcttactt ccatatagcg gcttgggcta taccggcagt gaaaaccatt 1080

gtgatcttga ttatgcggct ggttgatgcg gatgagttga ctgggctgtg ttatgtcgga 1140

aatcagaact tggatgcctt gaccggcttt gttgtggctc cactctttac ttatcttgtg 1200

atcggaaccc tctttatcgc cgcaggactg gttgcccttt tcaagatacg atccaacctg 1260

caaaaggacg ggacgaaaac cgacaaactc gaacggctta tggtgaagat cggcgttttc 1320

agcgtgctgt ataccgtacc cgctacctgc gtgatagcat gctacttcta tgagatcagt 1380

aactgggccc ttttccgata ttctgcagac gacagtaaca tggcagtgga aatgttgaaa 1440

atcttcatgt ctctgctcgt tggaatcacc agcggcatgt ggatctggtc agctaagacc 1500

ctgcacacat ggcagaagtg cagcaatagg ctggttaact caggcaaagt gaaaagggaa 1560

aagagaggga acgggtgggt caagcccggt aaaggcagtg aaacggtggt gtaa 1614

<210> 2

<211> 1614

<212> DNA

<213> human (Homo sapiens)

<400> 2

atggcctggc ggggcgcagg gccgagcgtc ccgggggcgc ccgggggcgt cggtctcagt 60

ctggggttgc tcctgcagtt gctgctgctc ctggggccgg cgcggggctt cggggacgag 120

gaagagcggc gctgcgaccc catccgcatc tccatgtgcc agaacctcgg ctacaacgtg 180

accaagatgc ccaacctggt tgggcacgag ctgcagacgg acgccgagct gcagctgaca 240

actttcacac cgctcatcca gtacggctgc tccagccagc tgcagttctt cctttgttct 300

gtttatgtgc caatgtgcac agagaagatc aacatcccca ttggcccatg cggcggcatg 360

tgtctttcag tcaagagacg ctgtgaaccc gtcctgaagg aatttggatt tgcctggcca 420

gagagtctga actgcagcaa attcccacca cagaacgacc acaaccacat gtgcatggaa 480

gggccaggtg atgaagaggt gcccttacct cacaaaaccc ccatccagcc tggggaagag 540

tgtcactctg tgggaaccaa ttctgatcag tacatctggg tgaaaaggag cctgaactgt 600

gtgctcaagt gtggctatga tgctggctta tacagccgct cagccaagga gttcactgat 660

atctggatgg ctgtgtgggc cagcctgtgt ttcatctcca ctgccttcac agtactgacc 720

ttcctgatcg attcttctag gttttcctac cctgagcgcc ccatcatatt tctcagtatg 780

tgctataata tttatagcat tgcttatatt gtcaggctga ctgtaggccg ggaaaggata 840

tcctgtgatt ttgaagaggc agcagaacct gttctcatcc aagaaggact taagaacaca 900

ggatgtgcaa taattttctt gctgatgtac ttttttggaa tggccagctc catttggtgg 960

gttattctga cactcacttg gtttttggca gcaggactca aatggggtca tgaagccatt 1020

gaaatgcaca gctcttattt ccacattgca gcctgggcca tccccgcagt gaaaaccatt 1080

gtcatcttga ttatgagact ggtggatgca gatgaactga ctggcttgtg ctatgttgga 1140

aaccaaaatc tcgatgccct caccgggttc gtggtggctc ccctctttac ttatttggtc 1200

attggaactt tgttcattgc tgcaggtttg gtggccttgt tcaaaattcg gtcaaatctt 1260

caaaaggatg ggacaaagac agacaagtta gaaagactga tggtcaagat tggggtgttc 1320

tcagtactgt acacagttcc tgcaacgtgt gtgattgcct gttattttta tgaaatctcc 1380

aactgggcac tttttcggta ttctgcagat gattccaaca tggctgttga aatgttgaaa 1440

atttttatgt ctttgttggt gggcatcact tcaggcatgt ggatttggtc tgccaaaact 1500

cttcacacgt ggcagaagtg ttccaacaga ttggtgaatt ctggaaaggt aaagagagag 1560

aagagaggaa atggttgggt gaagcctgga aaaggcagtg agactgtggt ataa 1614

<210> 3

<211> 537

<212> PRT

<213> human (Homo sapiens)

<400> 3

Met Ala Trp Arg Gly Ala Gly Pro Ser Val Pro Gly Ala Pro Gly Gly

1 5 10 15

Val Gly Leu Ser Leu Gly Leu Leu Leu Gln Leu Leu Leu Leu Leu Gly

20 25 30

Pro Ala Arg Gly Phe Gly Asp Glu Glu Glu Arg Arg Cys Asp Pro Ile

35 40 45

Arg Ile Ser Met Cys Gln Asn Leu Gly Tyr Asn Val Thr Lys Met Pro

50 55 60

Asn Leu Val Gly His Glu Leu Gln Thr Asp Ala Glu Leu Gln Leu Thr

65 70 75 80

Thr Phe Thr Pro Leu Ile Gln Tyr Gly Cys Ser Ser Gln Leu Gln Phe

85 90 95

Phe Leu Cys Ser Val Tyr Val Pro Met Cys Thr Glu Lys Ile Asn Ile

100 105 110

Pro Ile Gly Pro Cys Gly Gly Met Cys Leu Ser Val Lys Arg Arg Cys

115 120 125

Glu Pro Val Leu Lys Glu Phe Gly Phe Ala Trp Pro Glu Ser Leu Asn

130 135 140

Cys Ser Lys Phe Pro Pro Gln Asn Asp His Asn His Met Cys Met Glu

145 150 155 160

Gly Pro Gly Asp Glu Glu Val Pro Leu Pro His Lys Thr Pro Ile Gln

165 170 175

Pro Gly Glu Glu Cys His Ser Val Gly Thr Asn Ser Asp Gln Tyr Ile

180 185 190

Trp Val Lys Arg Ser Leu Asn Cys Val Leu Lys Cys Gly Tyr Asp Ala

195 200 205

Gly Leu Tyr Ser Arg Ser Ala Lys Glu Phe Thr Asp Ile Trp Met Ala

210 215 220

Val Trp Ala Ser Leu Cys Phe Ile Ser Thr Ala Phe Thr Val Leu Thr

225 230 235 240

Phe Leu Ile Asp Ser Ser Arg Phe Ser Tyr Pro Glu Arg Pro Ile Ile

245 250 255

Phe Leu Ser Met Cys Tyr Asn Ile Tyr Ser Ile Ala Tyr Ile Val Arg

260 265 270

Leu Thr Val Gly Arg Glu Arg Ile Ser Cys Asp Phe Glu Glu Ala Ala

275 280 285

Glu Pro Val Leu Ile Gln Glu Gly Leu Lys Asn Thr Gly Cys Ala Ile

290 295 300

Ile Phe Leu Leu Met Tyr Phe Phe Gly Met Ala Ser Ser Ile Trp Trp

305 310 315 320

Val Ile Leu Thr Leu Thr Trp Phe Leu Ala Ala Gly Leu Lys Trp Gly

325 330 335

His Glu Ala Ile Glu Met His Ser Ser Tyr Phe His Ile Ala Ala Trp

340 345 350

Ala Ile Pro Ala Val Lys Thr Ile Val Ile Leu Ile Met Arg Leu Val

355 360 365

Asp Ala Asp Glu Leu Thr Gly Leu Cys Tyr Val Gly Asn Gln Asn Leu

370 375 380

Asp Ala Leu Thr Gly Phe Val Val Ala Pro Leu Phe Thr Tyr Leu Val

385 390 395 400

Ile Gly Thr Leu Phe Ile Ala Ala Gly Leu Val Ala Leu Phe Lys Ile

405 410 415

Arg Ser Asn Leu Gln Lys Asp Gly Thr Lys Thr Asp Lys Leu Glu Arg

420 425 430

Leu Met Val Lys Ile Gly Val Phe Ser Val Leu Tyr Thr Val Pro Ala

435 440 445

Thr Cys Val Ile Ala Cys Tyr Phe Tyr Glu Ile Ser Asn Trp Ala Leu

450 455 460

Phe Arg Tyr Ser Ala Asp Asp Ser Asn Met Ala Val Glu Met Leu Lys

465 470 475 480

Ile Phe Met Ser Leu Leu Val Gly Ile Thr Ser Gly Met Trp Ile Trp

485 490 495

Ser Ala Lys Thr Leu His Thr Trp Gln Lys Cys Ser Asn Arg Leu Val

500 505 510

Asn Ser Gly Lys Val Lys Arg Glu Lys Arg Gly Asn Gly Trp Val Lys

515 520 525

Pro Gly Lys Gly Ser Glu Thr Val Val

530 535

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> 1F

<400> 4

ttggcaaaga attgggattc 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> 1R

<400> 5

tgctcgagag atctacgggt 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> actin-F

<400> 6

ccttctacaa cgagctgcgc 20

<210> 7

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> actin-R

<400> 7

tacagggaca gcacggcc 18

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> hFZD4-F

<400> 8

cctgagcgcc ccatcatatt 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> hFZD4-R

<400> 9

gaacaggttc tgctgcctct 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> rhFZD4-F

<400> 10

actgggctgt gttatgtcgg 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> rhFZD4-R

<400> 11

gtttgtcggt tttcgtcccg 20

Claims

1. A recombinant nucleic acid, the nucleotide sequence of which is shown in SEQ ID No. 1.

2. A vector comprising the recombinant nucleic acid of claim 1.

3. The vector of claim 2, wherein the vector is selected from the group consisting of a plasmid or a viral vector.

4. The vector of claim 3, wherein the vector is selected from a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, or a combination thereof.

5. The vector of claim 4, wherein the vector is an AAV vector.

6. The vector of claim 5, wherein the serotype of the vector is selected from the group consisting of AAV2, AAV5, AAV7, AAV8, or a combination thereof.

7. The vector of any one of claims 2 to 4, wherein the vector is selected from a DNA viral vector or a retroviral vector.

8. A pharmaceutical formulation, comprising:

(a) The vector of any one of claims 2-7, and

(b) A pharmaceutically acceptable carrier and/or excipient.

9. The pharmaceutical formulation of claim 8, wherein the pharmaceutical formulation is in a dosage form selected from the group consisting of: lyophilized formulations, liquid formulations, and combinations thereof.

10. A pharmaceutical formulation according to any of claims 8 to 9, wherein the carrier is present in the pharmaceutical formulation in an amount of 1 x 10 ⁹ -1×10 ¹⁶ Individual virus/ml.

11. Pharmaceutical preparation according to any of claims 8 to 9, characterised in that the carrier content in the pharmaceutical preparation is 1 x 10 ¹¹ -1×10 ¹³ One virus/ml.

12. A pharmaceutical formulation according to any of claims 8 to 9, wherein the carrier is present in the pharmaceutical formulation in an amount of 2 x 10 ¹¹ -1×10 ¹² Individual virus/ml.

13. A method for preparing recombinant human frizzled receptor 4, comprising the steps of: culturing a host cell comprising the vector of any one of claims 2-7, or having integrated into its chromosome an exogenous recombinant nucleic acid according to claim 1, thereby producing recombinant human frizzled receptor 4.

14. The method of claim 13, wherein the host cell is selected from 293T cells, photoreceptor cells, other visual cells, optic nerve cells, or a combination thereof.

15. The method of claim 14, wherein the photoreceptor cells are cone cells and/or rod cells and the other visual cells are binodal cells.