CN111893114A

CN111893114A - Oligo DNA group of sgRNA of two site-directed knockout rice OsMAP65-3.2 genes

Info

Publication number: CN111893114A
Application number: CN202010745733.3A
Authority: CN
Inventors: 徐杰; 林小丽; 贺浩华; 姜志树; 吴慧; 马莹莹; 刘嘉龙; 朱昌兰; 边建民; 彭小松; 陈小荣; 蔡怡聪
Original assignee: Jiangxi Agricultural University
Current assignee: Jiangxi Agricultural University
Priority date: 2020-07-29
Filing date: 2020-07-29
Publication date: 2020-11-06

Abstract

The invention provides sgRNA for knocking out rice OsMAP65-3.2(LOC _ Os01g49200) gene. Designing a sgRNA sequence based on CRISPR/Cas9 aiming at a rice OsMAP65-3.2 gene, connecting a DNA fragment containing the sgRNA sequence to a vector carrying CRISPR/Cas9, transforming rice, and realizing the knockout of the rice OsMAP65-3.2 gene. Wherein, the nucleotide sequence of the sgRNA action site is shown as SEQ ID NO.1 and SEQ ID NO. 2. According to the invention, the rice endogenous gene OsMAP65-3.2 is edited by a CRISPR-CAS9 technology, and an OsMAP65-3.2 knockout mutant is obtained. The sgRNA prepared by the method can efficiently, quickly and accurately target the OsMAP65-3.2 gene of rice, and has certain significance in basic research (mitosis of rice) and production practice (high-yield breeding and stress-resistant breeding of rice).

Description

Oligo DNA group of sgRNA of two site-directed knockout rice OsMAP65-3.2 genes

Technical Field

The invention belongs to the field of plant genetic engineering. Specifically, the invention relates to two oligo DNA groups for site-directed knockout of sgRNA of rice OsMAP65-3.2 gene based on CRISPR-CAS9 technology and application thereof.

Background

In plant cells, cytokinesis is caused by a membrane-forming body comprising two sets of opposing microtubule frameworks, the positive ends of which face each other at or near the site of cell division. At the later stage and the final stage of the division, a membrane-forming body microtubule array is derived from the spindle-shaped middle microtubules, the dynamic property is high, and the protein in the MAP family forms a dimer which is crosslinked with the microtubules. MAP65 family proteins comprise an N-terminal dimer domain and a C-terminal microtubule interaction domain. Compared with other MAP65 subtypes, MAP65-3 contains a unique C-terminal microtubule binding site, has special effects in the cross-linking of antiparallel microtubules to the positive end of a membrane forming body, and the function of MAP65-3 is also dependent on the C-terminal domain. MAP65-3 plays an important role in the arrangement of microtubules in early and late mitosis in all plant organs, and also plays a key role in participating in antiparallel microtubules. MAP65-3 is co-regulated with mitosis-specific genes, i.e. arabidopsis thaliana homologues genes encoding spindle assembly point proteins and cytokinesis-related genes encoding synthetin, microtubule-associated proteins, etc. Among them, MAP65-3 was specifically expressed in tissues rich in dividing cells, such as root and shoot apical meristems, embryos and organ primordia. The loss of MAP65-3 can prevent the microtubules of the membrane from complete cytokinesis to form cell wall stumps, and can also influence cell division and plant growth to cause the defects of root growth in seedling stage and bud growth in mature stage, which are represented as short roots and small buds.

Functional studies of plant microtubules and microtubule-associated proteins have been mostly performed in dicotyledonous plant systems, such as Arabidopsis and tobacco. Although most of the known microtubule interacting factors have obvious homologous genes in rice, some arabidopsis homologous genes have not been found in rice, and only a few have rice genetic functions. However, proteomic attempts have seen promise in identifying proteins that interact with tubulin in rice, and following the initial description of monocot microtubules, rice genome sequencing has also driven the study of the gramineae microtubule cytoskeleton and its interacting proteins.

Cytokinesis is an important link in the normal growth and development of higher plants and animals and in the continuation of offspring, occurring after meiosis or mitosis. Rice is one of the main food crops in China and also one of the organisms for carrying out cytokinesis. MAP65-3 is an important factor of cytokinesis, at present, 11 rice genes are identified as encoding MAP65 homologues, and OsMAP65-3.2 is one of key genes and participates in encoding MAP65-3 protein family. Therefore, the research on the action mechanism of the OsMAP65-3.2 in rice and the regulation mechanism of rice cytokinesis, and the important significance of knocking out the OsMAP65-3.2 to obtain a mutant and analyzing the function of the mutant is realized. The invention obtains transgenic plants by designing sgRNA to construct a gene editing vector, a transgenic technology and a CRISPR-CAS9 technology, obtains plants edited (knocked out) by OsMAP65-3.2 genes by sequencing analysis, and obtains the sequence editing condition.

Disclosure of Invention

The invention aims to provide a method for knocking out a rice gene OsMAP65-3.2, and provides two sgRNAs for knocking out rice OsMAP65-3.2 based on a CRISPR-CAS9 technology and a vector for knocking out a rice OsMAP65-3.2 gene.

A method for targeted knockout of rice OsMAP65-3.2 by using CRISPR/Cas9 technology, which is characterized by comprising the following steps:

a) the OsMAP65-3.2 gene coding region 14 th to 21 nucleic acid sequences were selected as target sequences for the CRISPR/Cas9 system (SEQ ID NO. 1): GACATGCGATTCGCTTCTAC, respectively; and selecting the 54 th to 60 th nucleic acid sequences of the coding region of the OsMAP65-3.2 gene as target sequences for the CRISPR/Cas9 system (SEQ ID No. 2): GGAAGGTCGACCAGGCGAAC are provided.

Four oligo DNAs were designed based on the target sequence:

OsMAP65-3.2-1-F1(SEQ ID NO.3)：tgttGACATGCGATTCGCTTCTAC

OsMAP65-3.2-1-R1(SEQ ID NO.4)：aaacGTTCGCCTGGTCGACCTTCC

OsMAP65-3.2-2-F1(SEQ ID NO.5)：gtgtGGAAGGTCGACCAGGCGAAC

OsMAP65-3.2-2-R1(SEQ ID NO.6)：aaacGTAGAAGCGAATCGCATGTC

b) mixing an oligo DNA group OsMAP65-3.2-1-F1 and OsMAP65-3.2-1-R1, mixing OsMAP65-3.2-2-F1 and OsMAP65-3.2-2-R1, annealing to form double chains, connecting with linearized PENTR4, and constructing plasmids pUbi-Cas9-OsMAP65-3.2-1 and pUbi-Cas9-OsMAP65-3.2-2 containing a rice OsMAP65-3.2 gene target sequence through Gateway recombination reaction;

c) infecting the callus of the rice by agrobacterium tumefaciens EHA105 respectively containing pUbi-Cas9-OsMAP65-3.2-1 and pUbi-Cas9-OsMAP65-3.2-2 plasmids, obtaining a transgenic rice plant through hygromycin screening and regeneration, and carrying out transgenic identification by using an HPT II gene specific primer;

d) amplifying sequences near a target sequence by using SQ-OsMAP65-3.2-1-F (SEQ ID NO.7), SQ-OsMAP65-3.2-1-R (SEQ ID NO.8), SQ-OsMAP65-3.2-2-F (SEQ ID NO.9) and SQ-OsMAP65-3.2-2-R (SEQ ID NO.10), sequencing amplified genome fragments, identifying the editing condition of OsMAP65-3.2 and screening knockout plants;

SQ-OsMAP65-3.2-1-F(SEQ ID NO.7)：GTTGGTCTCTCGCTGATTCAGATCG

SQ-OsMAP65-3.2-1-R(SEQ ID NO.8)：ATGATTACAGTCACAGATGGGCTC

SQ-OsMAP65-3.2-2-F(SEQ ID NO.9)：CAGTCTAATCAGAAAGCATGTGGAT

SQ-OsMAP65-3.2-2-R(SEQ ID NO.10)：CCCTTTCCATTGAGTTCCTCAACTA

after the gene editing vectors pUbi-Cas9-OsMAP65-3.2-1 and pUbi-Cas9-OsMAP65-3.2-2 transform rice, the rice OsMAP65-3.2 gene can be efficiently, quickly and specifically subjected to targeted editing and knockout, and the gene can be directly used as a research material to discuss the functions and action mechanisms of the OsMAP65-3.2 gene, so that a foundation is laid for better utilizing the OsMAP65-3.2 gene to perform genetic improvement in production practice.

Drawings

FIG. 1 shows the structure of OsMAP65-3.2 gene editing vector pUbi-Cas9-OsMAP 65-3.2-1.

FIG. 2 shows the structure of OsMAP65-3.2 gene editing vector pUbi-Cas9-OsMAP 65-3.2-2.

FIG. 3pUbi-Cas9-OsMAP65-3.2-1 transgene identification map.

FIG. 4pUbi-Cas9-OsMAP65-3.2-2 transgene identification map.

FIG. 5 PCR products from the region near the target site of OsMAP65-3.2-1 transgenic positive plant.

FIG. 6 PCR products from the region near the target site of OsMAP65-3.2-2 transgenic positive plant.

FIG. 7 Gene editing of transgenic line No. 1OsMAP 65-3.2-1.

FIG. 8 Gene editing of transgenic line No.8 OsMAP 65-3.2-1.

FIG. 9 Gene editing of transgenic line No.9 OsMAP 65-3.2-1.

FIG. 10 Gene editing of transgenic line No.3, OsMAP 65-3.2-2.

FIG. 11 Gene editing of transgenic line No.7 OsMAP 65-3.2-2.

Detailed Description

The invention is further described with reference to specific embodiments. These descriptions are not intended to limit the present invention further, and the technical means used in the following examples are conventional means well known to those skilled in the art, unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 design and Synthesis of rice OsMAP65-3.2 Gene sgRNA sequence

The coding region sequence of the rice OsMAP65-3.2 gene is shown in SEQ ID NO. 11.

e) The CRISPR/Cas9 editing target sequences of the present example are all 20bp in length, one of them is located at bases 74 to 80 of the first exon of the OsMAP65-3.2 coding region, and the editing target sequence is SEQ ID No. 1: GCGAGACGACGGTCCACGTC, and the other located in the 156 th to 163 th nucleic acid sequences of the coding region of the OsMAP65-3.2 gene, the edited target sequence being (SEQ ID NO. 2): GGAGCTGAAGTCCCTTGAAA are provided. Namely, the sgRNA sequence is specific on the rice genome and has extremely low off-target probability.

Four oligo DNAs were synthesized from the target sequence:

OsMAP65-3.2-1-F1(SEQ ID NO.3)：tgttGCGAGACGACGGTCCACGTC

OsMAP65-3.2-1-R1(SEQ ID NO.4)：aaacGACGTGGACCGTCGTCTCGC

OsMAP65-3.2-2-F1(SEQ ID NO.5)：gtgtGGAGCTGAAGTCCCTTGAAA

OsMAP65-3.2-2-R1(SEQ ID NO.6)：aaacTTTCAAGGGACTTCAGCTCC

example 2 construction of OsMAP65-3.2 editing vector pUbi-Cas9-OsMAP65-3.2-1, pUbi-Cas9-OsMAP65-3.2-2

Adding water into the synthesized OsMAP65-3.2-1-F1, OsMAP65-3.2-1-R1, OsMAP65-3.2-2-F1 and OsMAP65-3.2-2-R1 for dissolving to 10 mu M, putting the mixture into a PCR instrument for annealing to form a short double chain with a connector, carrying out linearization on a PENTR-gRNA4 vector of the OsMAP65-3.2-1 by BtgZ I and PENTR-gRNA4 vector of the OsMAP65-3.2-2 by Bsa I, transforming a ligation product into escherichia coli by a heat shock method after recombination, selecting a single colony to an LB liquid culture medium for culturing for 12 hours, carrying out enzyme digestion detection and PCR detection after extracting plasmids, carrying out recombination on the escherichia coli and pUbi-9, and sequencing; the other is the same. Selecting bacteria with correct sequencing to extract plasmid DNA, and obtaining editing vectors pUbi-Cas9-OsMAP65-3.2-1 and pUbi-Cas9-OsMAP65-3.2-2 containing rice OsMAP65-3.2 gene target sequences, wherein vector diagrams are shown in figure 1 and figure 2.

Example 3pUbi-Cas9-OsMAP65-3.2-1, pUbi-Cas9-OsMAP65-3.2-2 vector Agrobacterium transformation

The plasmid of PUbi-Cas9-OsMAP65-3.2-1 and PUbi-Cas9-OsMAP65-3.2-2 is transformed into agrobacterium by a freeze-thaw method, 10 mul of plasmid DNA is added into 200 mul of agrobacterium EHA105 competence, ice bath is carried out for 30min, liquid nitrogen is frozen for 3min, water bath at 37 ℃ is carried out for 5min, 1ml of YEB culture medium is added, and shaking culture is carried out for 3-4h at 28 ℃. The cells were centrifuged at 6000rpm at room temperature for 1min, the supernatant was discarded, 200. mu.l of YEB medium was added to resuspend the cells, and they were plated on YEB solid medium (+ rifampicin) and cultured at 28 ℃ for 3 days. Selecting single colony for identification.

Example 4 transformation of Rice

In the implementation, Nipponbare is used as a receptor for agrobacterium transformation. Selecting about 300 Nipponbare seeds, removing shells, soaking for 1 minute by using 75% ethanol, pouring off the 75% ethanol, sterilizing for 30 minutes by using a sodium hypochlorite solution, washing for 6 times by using sterile water, sucking water by using sterile gauze, then planting the seeds on an NB culture medium containing 2,4-D (2mg/L) for 2 weeks in a dark place at 26 ℃, and selecting the calli which grow vigorously to be used as a transformed receptor. The rice calli were infected with an engineered bacterial solution prepared from EHA105 strain containing the editing vectors (pUbi-Cas9-OsMAP65-3.2-1, pUbi-Cas9-OsMAP65-3.2-2), co-cultured in the dark at 25 ℃ for 3 days, and then cultured in a selection medium containing 50mg/L Hygromycin under light for about 14 days (light intensity 13200LX, temperature 32 ℃). Transferring the pre-differentiated callus to a differentiation medium, and culturing the pre-differentiated callus under the illumination condition (the illumination intensity is 13200LX, and the temperature is 32 ℃) for about one month to obtain a resistant transgenic plant. Using 1/2MS culture medium to take root and strengthen seedling to obtain T0 generation plant, transplanting into field to plant.

Example 5 analysis of OsMAP65-3.2 Gene editing

DNA is extracted from T0 generation plant leaves, primers HPT-F and HPT-R are designed according to hygromycin gene sequence, and positive transgenic plants are determined, and are shown in figure 3 and figure 4. Because the distance between the target sites of OsMAP65-3.2 gene knockout is short, only one pair of primers is designed to amplify a target fragment, primers SQ-OsMAP65-3.2-F and SQ-OsMAP65-3.2-R are used to amplify a positive transgenic plant (figure 3 and figure 4), a sequence near the target site of the OsMAP65-3.2-1 gene (figure 7-9 is a sequencing result of a partially edited plant) and a sequence near the target site of the OsMAP65-3.2-2 gene (figure 10-12 is a sequencing result of a partially edited plant) are analyzed by sequencing, and the statistics of the overall results are shown in Table 1 and Table 2. The hygromycin gene and the sequence amplification primer sequence near the target site are as follows:

SQ-OsMAP65-3.2-F(SEQ ID NO.7)：AGGTAAGCCCCCAACTCGCCTGCG

SQ-OsMAP65-3.2-R(SEQ ID NO.8)：GGGAAAGTGTTGGCAGAGCTTACA

HPT-F(SEQ ID NO.9)：ACGGTGTCGTCCATCACAGTTTGCC

HPT-R(SEQ ID NO.10)：TTCCGGAAGTGCTTGACATTGGGGA

TABLE 1 analysis of OsMAP65-3.2-1 Gene editing

TABLE 2 analysis of OsMAP65-3.2-2 Gene editing

While the invention has been described with reference to a preferred embodiment, it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention.

Sequence listing

<110> university of agriculture in Jiangxi

<120> oligo DNA group of sgRNA of two site-directed knockout rice OsMAP65-3.2 genes

<160>11

<170>SIPOSequenceListing 1.0

<210>1

<211>20

<212>DNA

<213>Oryza sativa

<400>1

gacatgcgat tcgcttctac 20

<210>2

<211>20

<212>DNA

<213>Oryza sativa

<400>2

ggagctgaag tcccttgaaa 20

<210>3

<211>24

<212>DNA

<213> Artificial sequence

<400>3

tgttgcgaga cgacggtcca cgtc 24

<210>4

<211>24

<212>DNA

<213> Artificial sequence

<400>4

aaacgttcgc ctggtcgacc ttcc 24

<210>5

<211>24

<212>DNA

<213> Artificial sequence

<400>5

gtgtggaagg tcgaccaggc gaac 24

<210>6

<211>24

<212>DNA

<213> Artificial sequence

<400>6

aaactttcaa gggacttcag ctcc 24

<210>7

<211>24

<212>DNA

<213> Artificial sequence

<400>7

aggtaagccc ccaactcgcc tgcg 24

<210>8

<211>24

<212>DNA

<213> Artificial sequence

<400>8

gggaaagtgt tggcagagct taca 24

<210>9

<211>25

<212>DNA

<213> Artificial sequence

<400>9

acggtgtcgt ccatcacagt ttgcc 25

<210>10

<211>25

<212>DNA

<213> Artificial sequence

<400>10

ttccggaagt gcttgacatt gggga 25

<210>11

<211>2070

<212>DNA

<213>Oryza sativa

<400>11

atgagtagcg cggtgaagga ccagcttcac cagatgtcga cgacatgcga ttcgcttcta 60

ctggagctca atgtgatttg ggatgaggtc ggtgagcccg acacgacgag ggacaggatg 120

ctgctggagc tcgagcagga gtgcctggag gtctacaggc ggaaggtcga ccaggcgaac 180

cggagccgcg cccagctgcg gaaggccatc gccgagggcg aggcagagct cgccggcatc 240

tgctcagcca tgggcgagcc gcccgtgcac gttagacagt caaatcagaa gcttcatggc 300

ttaagagagg agttgaatgc aattgttccg tatttggaag aaatgaaaaa gaaaaaggtc 360

gaacgatgga accagtttgt tcatgtcata gagcagatta agaaaatttc gtctgaaata 420

aggccagccg attttgttcc ctttaaagtt ccggttgatc agtctgacct gtcattaaga 480

aagcttgatg agttgacgaa ggacctggaa tcccttcaga aggagaagag cgatcggcta 540

aagcaagtga tagaacattt gaattctttg cattccttat gtgaggtgct tggcatagat 600

ttcaagcaaa cagtatatga ggtgcaccct agcttggacg aagctgaagg atcaaagaac 660

ctgagcaaca ctacaattga gaggcttgct gctgccgcaa acagactgcg tgaaatgaag 720

atccaaagga tgcaaaagct tcaagatttt gcttctagca tgctcgagct atggaatctc 780

atggatactc cacttgaaga gcagcagatg tttcagaata taacatgcaa tattgctgct 840

tcagaacaag agataactga accaaacacc ctctccacag atttcctgaa ttatgtcgaa 900

tctgaggtgt taaggcttga acaactgaaa gcaagtaaga tgaaagatct tgttttaaaa 960

aagaaagcag aactagaaga gcatagaaga cgtgctcatc ttgttggcga ggaaggttat 1020

gcagaggagt ttagcattga agctattgaa gctggagcta ttgatccctc actagtactt 1080

gaacaaattg aagctcacat tgcaacagtg aaagaggaag cttttagccg gaaggatatt 1140

cttgagaaag ttgaaagatg gcaaaatgct tgtgaagagg aagcctggct ggaagattac 1200

aacaaagatg ataatcgtta caatgctggg aggggagcac atctaacact aaagagggct 1260

gaaaaggctc gtactttggt caacaagatt cctggaatgg tagatgtttt gagaacaaaa 1320

attgctgcat ggaaaaatga acgaggaaag gaggatttca catatgatgg tgttagcctt 1380

tcgtcaatgc ttgatgaata tatgttcgtt cgtcaggaga aagagcaaga gaagaagaga 1440

caaagggatc agaagaagct ccaggatcag ctcaaagcgg agcaggaagc tttgtacgga 1500

tcaaaaccca gtccatccaa gcccctaagt acaaagaagg cacctaggca ctctatgggt 1560

ggtgcaaacc gaaggctatc tcttggtgga gccaccatgc aacccccgaa gactgatata 1620

ctgcattcaa agtctgttcg tgctgccaag aaaactgaag aaatcggcac tttgtcccct 1680

agtagtagag gtttggacat tgccggattg cctatcaaga agttgtcttt caatgccagt 1740

actctacgtg agacggagac acctcgtaaa ccttttgctc agatcacacc aggaaacagt 1800

gtctcgtcga cgcctgtgcg ccctatcacc aataacactg aggatgatga gaacaggact 1860

ccgaagacat ttacagcact gaatcccaag actccgatga ctgttacggc tccaatgcag 1920

atggcaatga ctccctctct ggccaacaag gtttcagcaa ctccagtttc ccttgtttac 1980

gacaagccag aggtaacatt gcaggaggac atcgactact cctttgaaga aaggcggctc 2040

gccatctatc tggccaggca aatggtttaa 2070

Claims

1. The oligo DNA group of sgRNA of two fixed-point knockout rice OsMAP65-3.2 genes is characterized in that: two sgRNA target sites comprising OsMAP65-3.2 gene, the DNA sequences of which are shown as SEQ ID NO.1 and SEQ ID NO.2, one oligo DNA group is OsMAP65-3.2-1-F1 and OsMAP65-3.2-1-R1, the other oligo DNA group is OsMAP65-3.2-2-F1 and OsMAP65-3.2-2-R1, the nucleotide sequence of OsMAP65-3.2-1-F1 is shown as SEQ ID NO.3, the nucleotide sequence of OsMAP65-3.2-1-R1 is shown as SEQ ID NO.4, the nucleotide sequence of OsMAP65-3.2-2-F1 is shown as SEQ ID NO.5, and the nucleotide sequence of OsMAP65-3.2-2-R1 is shown as SEQ ID NO. 6.

2. The use of the oligo DNA set of sgRNA of two site-directed knockout rice OsMAP65-3.2 genes according to claim 1 in rice OsMAP65-3.2 gene editing breeding.

3. A carrier for site-directed knockout of sgRNA of rice OsMAP65-3.2 gene, it is characterized in that the vector is pUbi-Cas9-OsMAP65-3.2-1 and pUbi-Cas9-OsMAP65-3.2-2, forms double chains by annealing of oligo DNA group OsMAP65-3.2-1-F1 and OsMAP65-3.2-1-R1, OsMAP65-3.2-2-F1 and OsMAP65-3.2-2-R1, connects with linearized PENTR4, obtained through Gateway recombination reaction, the nucleotide sequence of OsMAP65-3.2-1-F1 is shown as SEQ ID NO.3, the nucleotide sequence of OsMAP65-3.2-1-R1 is shown as SEQ ID NO.4, the nucleotide sequence of OsMAP65-3.2-2-F1 is shown as SEQ ID NO.5, and the nucleotide sequence of OsMAP65-3.2-2-R1 is shown as SEQ ID NO. 6.

4. A primer group for identifying the sgRNA target region editing condition of an OsMAP65-3.2 gene, which is characterized in that: the DNA sequence of the primer group is shown as SEQ ID NO.7 and SEQ ID NO. 8.