CN111849850A

CN111849850A - Helicobacter pylori mutant strain for stimulating immune response and construction method and application thereof

Info

Publication number: CN111849850A
Application number: CN202010775812.9A
Authority: CN
Inventors: 刘琼; 黄孝天; 李标先; 曾令兵
Original assignee: Nanchang University
Current assignee: Nanchang University
Priority date: 2020-08-05
Filing date: 2020-08-05
Publication date: 2020-10-30

Abstract

The invention provides a helicobacter pylori mutant strain for stimulating immune response and a construction method and application thereof, belonging to the technical field of biological engineering. The mutant strain provided by the invention does not contain a gene futB of glycosyltransferase in the synthesis process of an O antigen, simultaneously modifies a lipid A structure, knocks out related synthetic genes lpxE and lpxF, and the preservation number of the strain is CCTCC NO: m2020028. It can efficiently stimulate host to generate immune response and secrete outer membrane vesicles, so that the outer membrane vesicles of helicobacter pylori have the characteristic of high vaccine efficacy. Meanwhile, the method can effectively enable helicobacter pylori lipid A to be identified by TLR4 again, and enable the lipid A to have adjuvant activity, so that the antigen presentation service can be better served. The invention can be used for constructing a novel helicobacter pylori antigen presenting plasmid, and the antigen protein is presented to the periplasm of the bacteria or exposed to the surface of the outer membrane of the bacteria through different strategies, thereby improving the efficiency of recognizing the target antigen by a host to generate immune response.

Description

Helicobacter pylori mutant strain for stimulating immune response and construction method and application thereof

Technical Field

The invention belongs to the technical field of biological engineering, and particularly relates to a helicobacter pylori mutant strain for stimulating immune response, a construction method and application thereof.

Background

Helicobacter pylori (Hp) is a microaerophilic gram-negative bacterium that persists throughout the life in the human stomach and duodenum, causing mild chronic inflammation of the gastric mucosa, and even severe gastric and duodenal ulcers and stomach cancer. Helicobacter pylori infection is the most common bacterial infectious disease in humans, and more than half of the population is infected with helicobacter pylori worldwide. This infection is associated with many gastric diseases, such as chronic atrophic gastritis, peptic ulcer, gastric cancer or gastric cancer and mucosa-associated lymphoid tissue (MALT) lymphoma.

At this stage, the most commonly used method for the prevention and treatment of H.pylori infection is antibiotic therapy. Although antibiotic therapy has shown positive efficacy in some clinical trials, there are still significant limitations in the encounter of complex clinical conditions. Strategies for antibiotic treatment have shown certain drawbacks, such as: 1) the appearance of antibiotic-resistant strains can hinder antibiotic treatment, and in some regions, the occurrence of antibiotic resistance can reach more than 50%; 2) long-term administration of antibiotics can lead to toxic and side effects, such as abdominal pain, nausea, diarrhea, etc.; 3) in the process of drug therapy, patients need to take a large number of tablets, so that the continuous treatment is difficult; 4) the relapse is easy after the outcome of the antibiotic treatment and the cost generated by the treatment is high; 5) antibiotic therapy is often aimed at patients with clinical symptoms, while those with no clinical symptoms are also at risk of gastric ulcers and gastric cancer due to bacterial infections.

At present, the major helicobacter pylori vaccines include the first generation vaccine of whole bacteria inactivated vaccine, and subunit vaccine mainly based on immune antigen (the second generation vaccine, which is used for immunizing animals by using antigen protein and adjuvant to form subunit vaccine). Whole-bacterium inactivated vaccines, which encapsulate a wide variety of antigens, can elicit a highly effective immune response, but also exhibit several drawbacks, including: 1) residual formaldehyde for inactivation (formalin) can cause toxic and side effects of diarrhea and the like of an organism; 2) endotoxin (lipid a) contained in the inactivated vaccine does not cause immune response of a host due to its special structure, thereby reducing vaccine efficiency (described in detail later); 3) specific O antigen structure and host peptide segment (Le) in lipopolysaccharide^XAnd Le^Y) The structure is similar, and cross reaction can be generated, so that autoimmune reaction is triggered. These drawbacks greatly limit the practical clinical application of whole-bacterium inactivated vaccines. Therefore, the development of new vaccines is imminent. Meanwhile, the outer membrane vesicles of the bacteria are generated from the outer membrane of the bacteria spontaneously, have the outer membrane components of the bacteria and the vesicle structure, and endow the bacteria with good vaccine and antigen presentation vector potentials. However, the use of H.pylori outer membrane vesicles for vaccine development requires that the H.pylori outer membrane LPS can stimulate the host to generate immune response with high efficiency, and the problem still remains to be solved.

Disclosure of Invention

The invention aims to solve the technical problems, and provides a helicobacter pylori mutant bacterium for stimulating immune response, a construction method and application thereof, so that outer membrane vesicles produced by purification of the helicobacter pylori mutant bacterium can be used as a vaccine to further solve the problem of infection caused by helicobacter pylori.

One of the purposes of the invention is to provide a helicobacter pylori mutant strain for stimulating immune response, which does not contain a gene futB for encoding glycosyl transferase in the O antigen synthesis process, and simultaneously modifies lipid A structure and knocks out related synthetic genes lpxE and lpxF.

The mutant strain provided by the invention is obtained by knocking out a key gene for synthesizing a Lewis antigen and a key gene for synthesizing lipid A through genetic engineering modification, so that immune evasion and autoimmune reaction effects of a parent strain LPS on a host immune system are eliminated, and the helicobacter pylori outer membrane vesicle has the characteristic of high vaccine efficacy through the modification.

The method can also construct a novel helicobacter pylori antigen presenting plasmid on the basis of the mutant strain, and present antigen protein to the periplasm of the bacteria or expose the antigen protein to the surface of the outer membrane of the bacteria through different strategies, thereby improving the efficiency of recognizing the target antigen by a host to generate immune response.

Specifically, the above-mentioned mutant strains of the present invention are classified and named as: helicobacter pylori, which is named as: helicobacter pylori LQ001(Δ futB Δ lpxE Δ lpxF), with a collection number of CCTCC NO: m2020028, deposited in China center for type culture Collection, with the deposition address: wuhan university in China, the preservation time is 1 month and 9 days in 2020.

Specifically, the nucleotide sequence of the futB gene is shown as SEQ ID No.1, the nucleotide sequence of the lpxE gene is shown as SEQ ID No.2, and the nucleotide sequence of the lpxF gene is shown as SEQ ID No. 3.

Another object of the present invention is to provide a method for constructing the above helicobacter pylori mutant bacteria, which comprises the following steps:

1) knocking out gene futB of glycosyltransferase in the synthesis process of helicobacter pylori coding O antigen from a helicobacter pylori 26695 strain genome by a homologous recombination method to obtain a futB mutant strain which can not normally synthesize Lewis antigen;

2) through homologous recombination, the structure of helicobacter pylori lipopolysaccharide lipid A is modified, and related synthetic genes lpxE and lpxF are knocked out from the genome of a helicobacter pylori 26695 strain to obtain a helicobacter pylori mutant strain for synthesizing the structure of the monophosphoryl lactone A.

The method for homologous recombination of the steps 1) and 2) comprises the following steps:

1) constructing homologous recombinant plasmids PI11570-futB, PI11570-lpxE and PI 11570-lpxF;

2) preparing a strain of helicobacter pylori 26695 competent;

3) transforming the homologous recombinant plasmid obtained in the step 1) into a helicobacter pylori 26695 strain competence in an electrotransfer mode, transferring an electrotransfer cup into an electrotransfer instrument, and electrically shocking for 4 milliseconds at 2500V;

4) transferring the liquid in the electric transfer cup to a helicobacter pylori solid culture medium without antibiotics, culturing for 48 hours in a micro-aerobic environment, subculturing to a culture medium containing corresponding antibiotics for 48 hours, and transferring to a resistance culture medium for culturing for 48 hours to obtain a generated monoclonal bacterium which is a bacterium successfully transferred by electricity;

5) mutant strains without futB, lpxE and lpxF were obtained by PCR screening and were designated as Δ futB Δ lpxE Δ lpxF.

The preparation method of the helicobacter pylori 26695 competence comprises the following steps:

1) culturing helicobacter pylori 26695 strain for 36-48h to logarithmic phase, collecting electric transfer liquid 3ml pre-cooled on ice in a culture dish, collecting thallus 1ml in a clean 1.5ml centrifuge tube to adjust the concentration of the thallus to 5 x 10⁹CFU/ml；

2) Centrifuging at 4 ℃ at 6000rpm for 5min, and repeatedly washing for three times;

3) the supernatant was discarded and the cells were resuspended in 1ml of a precooled electrotransfer solution to adjust the cell concentration to 5 x 10⁸CFU/ml, i.e., prepared competent ready for use.

The construction methods of the homologous recombinant plasmids PI11570-futB, PI11570-lpxE and PI11570-lpxF are respectively referred to as follows:

1) constructing a homologous recombinant plasmid PI11570-futB containing upstream and downstream homologous arms of the futB gene:

according to the Genbank publication, the strain is derived from Helicobacter pylori 26695, the whole genome sequence is shown as the sequence number: GCA _000008525.1, designing left and right homologous arms of futB gene, and designing the following primers by using vector NTI software:

futB left-up：5’GCTGCAGC TTTAGCCATTGCGGGTTTG 3’

futB left-down:5’CGGAATTCCG ggtcatgaccccatttatgaatg 3’

futB right-up:5’CGGGATCCCG gatgtggcgtagtctcagg 3’

futB right-down:5’CCATCGATGG gtgccaccggcatcaatac 3’；

extracting the genomic DNA of the helicobacter pylori 26695 strain in logarithmic growth phase as a template, amplifying by using left and right homologous arm primers to obtain amplification products of the left and right homologous arms, recovering the products, and performing enzyme digestion by using enzyme digestion sites on the primers respectively, namely performing enzyme digestion on the left homologous arm by using EcoR I and Pst I, and performing enzyme digestion on the right homologous arm by using Cla I and BamH I to obtain products after the enzyme digestion of the left and right homologous arms; and then carrying out enzyme digestion on the vector plasmids respectively, connecting the obtained vector enzyme digestion products with the left and right homologous arms respectively under the action of T4 ligase, and transforming the product into an escherichia coli strain TOP10 to obtain the recombinant plasmid PI 11570-futB.

2) Construction of homologous recombinant plasmid PI11570-lpxE containing upstream and downstream homology arms of lpxE gene:

according to the Genbank publication, the strain is derived from Helicobacter pylori 26695, the whole genome sequence is shown as the sequence number: GCA _000008525.1, designing left and right homologous arms of the lpxE gene, and designing the following primers by using VecterNTI software:

lpxE left-up：5’GCTGCAGC GGCGTGATGAAATCCTACAAC 3’

lpxE left-down:5’CGGAATTCCG cgctaatgaaatagaaagcaacgg 3’

lpxE right-up:5’CGGGATCCCG taacgcctatgacaacacc 3’

lpxE right-down:5’CCATCGATGG cctaccgcatctctttggatg 3’；

extracting the genomic DNA of the helicobacter pylori 26695 strain in logarithmic growth phase as a template, amplifying by using left and right homologous arm primers to obtain amplification products of the left and right homologous arms, recovering the products, and performing enzyme digestion by using enzyme digestion sites on the primers respectively, namely performing enzyme digestion on the left homologous arm by using EcoR I and Pst I, and performing enzyme digestion on the right homologous arm by using Cla I and BamH I to obtain products after the enzyme digestion of the left and right homologous arms; and then respectively carrying out enzyme digestion on the vector plasmids, respectively connecting the obtained vector enzyme digestion products with the left and right homologous arms under the action of T4 ligase, and transforming the product into an escherichia coli strain TOP10 to obtain a recombinant plasmid PI 11570-lpxE.

3) Construction of homologous recombinant plasmid PI11570-lpxF containing upstream and downstream homology arms of lpxF gene:

according to the Genbank publication, the strain is derived from Helicobacter pylori 26695, the whole genome sequence is shown as the sequence number: GCA _000008525.1, designing left and right homologous arms of the lpxF gene, and designing the following primers by using vector NTI software:

lpxF left-up：5’GCTGCAGC ttaaagcatgagatgaccgctg 3’

lpxF left-down:5’CGGAATTCCG gtttgaagcgagaactcataaccc 3’

lpxF right-up:5’CGGGATCCCG gtctaatttagcgatcgcttcac 3’

lpxF right-down:5’CCATCGATGG cgcatttttctaggatcgtgtc 3’；

extracting the genomic DNA of the helicobacter pylori 26695 strain in logarithmic growth phase as a template, amplifying by using left and right homologous arm primers to obtain amplification products of the left and right homologous arms, recovering the products, and performing enzyme digestion by using enzyme digestion sites on the primers respectively, namely performing enzyme digestion on the left homologous arm by using EcoR I and Pst I, and performing enzyme digestion on the right homologous arm by using Cla I and BamH I to obtain products after the enzyme digestion of the left and right homologous arms; and then respectively carrying out enzyme digestion on the vector plasmids, respectively connecting the obtained vector enzyme digestion products with the left and right homologous arms under the action of T4 ligase, and transforming the product into an escherichia coli strain TOP10 to obtain a recombinant plasmid PI 11570-lpxF.

Because the homologous recombination plasmid can not be replicated and survived in the helicobacter pylori, the homologous recombination plasmid containing the homologous fragment is transferred into the helicobacter pylori in an electrotransformation mode, and the homologous recombination action of the homologous fragment can replace the whole fragment of the deleted target gene in the left and right homologous arms with the homologous arms at the upper and lower streams of the target gene in a genome so as to knock out the gene. And finally, identifying the helicobacter pylori mutant H.pylori delta futB delta lpxE delta lpxF by using a PCR method.

LPS is one of the very important virulence factors of H.pylori, playing a very important role in its pathogenic process, including: 1) its lipid A structure is tetra-acyl lipid A lacks 4 ' phosphate group (4 ' -phosphate), and 1 ' phosphate group is acylated, so that the adjuvant function of the ra-acyl lipid A cannot be performed, and meanwhile, the lipid A structure is non-acylated and non-phosphorylated, compared with other gram-negative bacteria lipid A, the lipid A cannot be well combined by TLR4 to cause immune response, so that the ra-acyl lipid A is beneficial to escape the elimination of host immune response in the colonization process of helicobacter pylori; 2) the structure of the O antigen (O-polysaccharide antigen) in LPS has been identified to have a molecular simulation phenomenon, and the structure of the O antigen is similar to that of Lewis (le) in serum, so that helicobacter pylori can also have immune escape during long-term infection, or autoimmune diseases are generated on a host, and helicobacter pylori infection is not easy to be eliminated. When the helicobacter pylori O antigen is synthesized, the synthesis of polymeric N-acetyl-beta-lactosamine (LacNAc) into the Lewis antigen is mainly realized through two glycosyltransferases (FucT) FutA and FutB, and the deletion of the FutB gene can effectively block the helicobacter pylori Le^XAnd Le^YAnd (4) synthesizing the antigen. Meanwhile, 4 ' phosphate group enzyme (4 ' -phosphatase) LpxF is knocked out, so that 4 ' phosphate groups are reserved, and then a gene lpxE for regulating and controlling fatty acid chain synthesis is knocked out, so that the lipid A structure of the helicobacter pylori is the lipid A monophosphate with 6 fatty acid chains.

The invention also aims to provide the application of the helicobacter pylori mutant, and the mutant is used for purifying the outer membrane vesicles spontaneously generated by the mutant strain to prepare a vaccine for preventing and treating helicobacter pylori infection.

Compared with the prior art, the invention has the following beneficial effects:

1) according to the invention, the gene futB of glycosyltransferase in the synthesis process of the coded O antigen is knocked out, so that LeX antigen synthesized by helicobacter pylori is blocked, and immune evasion and autoimmune reaction caused by molecular simulation are eliminated;

2) according to the invention, the original tetra-acyl lipid A is converted into a mono-phosphoryl lipid A structure (MPL) with six fatty acid chains (fat acid chain) by modifying the helicobacter pylori lipid A structure and knocking out related synthetic genes (lpxE, lpxF). The structure not only can effectively enable helicobacter pylori lipid A to be identified by TLR4 again, but also can enable lipid A to have adjuvant activity, and can better serve antigen presentation.

Drawings

FIG. 1 shows the structure of modified lipid A by gene knockout, wherein the A picture is the thin film chromatography result of the lipid A structural gene knockout (lpxE, lpxF), and the B picture is the mass spectrometry result of lipid A obtained by knocking out lpxE and lpxF at the same time.

FIG. 2 shows the structure of LPS after knocking out lpxE and lpxF genes, in panel A, and the effect of knocking out futB gene on LeX antigen synthesis, in panel B.

Fig. 3 is a graph demonstrating, at the cellular level, the ability of outer membrane vesicles to be recognized by TLR4 following knockdown of the genes futB, lpxE, lpxF.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more clearly understood, the present invention is described in detail below with reference to the following embodiments, and it should be noted that the following embodiments are only for explaining and illustrating the present invention and are not intended to limit the present invention. The invention is not limited to the embodiments described above, but rather, may be modified within the scope of the invention.

Example 1

1. Delta futB primer design and PCR amplification

According to the reported sequence of the helicobacter pylori 26695 strain (with reference to GenBank sequence number as GCA _000008525.1), two pairs of fusion PCR primers are designed to respectively amplify an upstream homology arm and a downstream homology arm of a futB gene, the sizes of amplified fragments are 670bp and 600bp respectively, the primers are synthesized by Beijing Hua DageneCo, and the sequences of the primers are as follows:

futB left-up：5’GCTGCAGC TTTAGCCATTGCGGGTTTG 3’

futB left-down:5’CGGAATTCCG ggtcatgaccccatttatgaatg’

futB right-up:5’CGGGATCCCG gatgtggcgtagtctcagg 3’

futB right-down:5’CCATCGATGG gtgccaccggcatcaatac 3’

2. amplification of upstream and downstream homology arms of helicobacter pylori futB gene

Inoculating lyophilized helicobacter pylori 26695 strain to a Brucella broth plate, culturing overnight in microaerophilic environment, picking single colony on the next day, inoculating to Brucella broth liquid culture medium, culturing at 37 deg.C 180r/min for 24-32 hr, and extracting bacterial genome (extracting genome utilizes bacterial genome extraction kit for biothemistry, and extracting genome according to the operation procedure of the instruction).

The PCR amplification reaction was carried out in a 50. mu.L system as follows: template DNA 1. mu.L, 2 XHi-Fi DNase premix, 25. mu.L from Takara Shuzo (Dalian) Co., Ltd., upstream primer 1. mu.L, downstream primer 1. mu.L, ddH₂O 22μL。

The amplification conditions were: after denaturation at 94 ℃ for 5min, the cycle was carried out at 94 ℃ for 10sec, 55 ℃ for 15sec, and 72 ℃ for 10 sec. After 35 cycles, extension was carried out for 10min at 72 ℃. The amplified PCR product is analyzed by 1% agarose gel electrophoresis, and the sizes of the two amplified fragments are 670bp and 600bp respectively, which are equivalent to the expected sizes.

3. Construction of PI11570-futB homologous recombination plasmid

And (3) respectively carrying out enzyme digestion on the homologous arm fragments obtained in the previous step by utilizing enzyme digestion sites on the primer primers, namely carrying out enzyme digestion on the left homologous arm by using EcoR I and Pst I, and carrying out enzyme digestion on the right homologous arm by using Cla I and BamH I to obtain products after the left and right homologous arms are subjected to enzyme digestion. The reaction system is as follows: 20 mu L of template, 4 mu L of buffer and 1 mu L of restriction enzyme; the reaction conditions are as follows: after the reaction is finished, cutting gel by agarose gel electrophoresis and recovering fragments for later use at 37 ℃ for 2 hours; and then carrying out enzyme digestion on the vector plasmid respectively, connecting the obtained vector enzyme digestion product with the left and right homologous arms respectively under the action of T4 ligase in the same reaction system, carrying out water bath at 16 ℃ overnight, and transforming into an escherichia coli strain TOP10 to obtain the recombinant plasmid PI 11570-futB. The identification results confirmed that the constructed suicide plasmid was correct.

4. Construction and identification of futB gene deletion mutant strain

First preparing helicobacter pylori electrotransformation competence, culturing helicobacter pylori 26695 strain for 36-48h to logarithmic phase, and collecting electrotransformation liquid 3 pre-cooled on iceml in a petri dish, 1ml of the cells were collected in a clean 1.5ml centrifuge tube to adjust the cell concentration to 5 x 10⁹CFU/ml. Centrifuging at 6000rpm and 4 ℃ for 5min, and repeatedly washing three times. The supernatant was discarded and the cells were resuspended in 1ml of a precooled electrotransfer solution to adjust the cell concentration to 5 x 10⁸CFU/ml, i.e., prepared competent ready for use. The constructed homologous recombinant plasmid PI11570-futB is transformed into the strain competence of the helicobacter pylori 26695 by an electrotransformation mode, an electric rotor is transferred into an electrotransfer instrument, and the electric shock is carried out for 4 milliseconds at 2500V. Transferring the liquid in the electric transfer cup to a helicobacter pylori solid culture medium without antibiotics, culturing for 48 hours in a micro-aerobic environment, subculturing for 48 hours on a culture medium containing corresponding antibiotics, transferring to a resistance culture medium, culturing for 48 hours, and selecting a single colony to perform PCR identification, wherein the generated single colony is a bacterium which is successfully electrically transferred.

And (3) PCR identification: extracting the genomic DNA of the futB mutant strain H.pyrori delta futB, amplifying the upstream and downstream homologous arm fragments by using primers futB-left up and futB-right down, judging whether the upstream and downstream homologous arm fragments lacking the futB gene with the size of about 1250bp can be amplified, if the corresponding fragments can be amplified, indicating that the result is consistent with the expectation, and preliminarily identifying the successful construction of the mutant strain.

Example 2

1. Delta lpxE primer design and PCR amplification

According to the reported sequence of helicobacter pylori 26695 strain (refer to GenBank sequence number as GCA _000008525.1), two pairs of fusion PCR primers are designed to respectively amplify the upstream homology arm and the downstream homology arm of the lpxE gene, the amplified fragments are respectively 600bp and 500bp, the primers are synthesized by Beijing Hua Dageneco, and the primer sequences are as follows:

lpxE left-up：5’GCTGCAGC GGCGTGATGAAATCCTACAAC 3’

lpxE left-down:5’CGGAATTCCG cgctaatgaaatagaaagcaacgg 3’

lpxE right-up:5’CGGGATCCCG taacgcctatgacaacacc 3’

lpxE right-down:5’CCATCGATGG cctaccgcatctctttggatg 3’。

2. amplification of upstream and downstream homology arms of the helicobacter pylori lpxE gene

The amplification conditions were: after denaturation at 94 ℃ for 5min, the cycle was carried out at 94 ℃ for 10sec, 55 ℃ for 15sec, and 72 ℃ for 10 sec. After 35 cycles, extension was carried out for 10min at 72 ℃. The amplified PCR product is analyzed by 1% agarose gel electrophoresis, and the sizes of the two amplified fragments are respectively 600bp and 500bp, which are equivalent to the expected sizes.

3. Construction of PI11570-lpxE homologous recombination plasmid

And (3) respectively carrying out enzyme digestion on the homologous arm fragments obtained in the previous step by utilizing enzyme digestion sites on the primer primers, namely carrying out enzyme digestion on the left homologous arm by using EcoR I and Pst I, and carrying out enzyme digestion on the right homologous arm by using Cla I and BamH I to obtain products after the left and right homologous arms are subjected to enzyme digestion. The reaction system is as follows: 20 mu L of template, 4 mu L of buffer and 1 mu L of restriction enzyme; the reaction conditions are as follows: after the reaction is finished, cutting gel by agarose gel electrophoresis and recovering fragments for later use at 37 ℃ for 2 hours; and then carrying out enzyme digestion on the vector plasmids respectively, connecting the obtained vector enzyme digestion products with the left and right homologous arms respectively under the action of T4 ligase in the same reaction system, carrying out water bath overnight at 16 ℃, and transforming into an escherichia coli strain TOP10 to obtain the recombinant plasmid PI 11570-lpxE. The identification results confirmed that the constructed suicide plasmid was correct.

4. Construction and identification of deletion mutant of H.pyri.DELTA.futB.DELTA.lpxE gene

Preparing helicobacter pylori electrotransformation competence, culturing H.pyleri delta futB mutant strain for 36-48h to logarithmic phase, and collecting 3ml electrotransfer liquid precooled on iceIn a petri dish, 1ml of the cells were collected in a clean 1.5ml centrifuge tube to adjust the cell concentration to 5 x 10⁹CFU/ml. Centrifuging at 6000rpm and 4 ℃ for 5min, and repeatedly washing three times. The supernatant was discarded and the cells were resuspended in 1ml of a precooled electrotransfer solution to adjust the cell concentration to 5 x 10⁸CFU/ml, i.e., prepared competent ready for use. The constructed homologous recombinant plasmid PI11570-lpxE is transformed into H.pyriri delta futB mutant competence by means of electrotransformation, an electrotransfer cup is transferred into an electrotransfer, and the electric shock is carried out for 4 milliseconds at 2500V. Transferring the liquid in the electric transfer cup to a helicobacter pylori solid culture medium without antibiotics, culturing for 48 hours in a micro-aerobic environment, subculturing for 48 hours on a culture medium containing corresponding antibiotics, transferring to a resistance culture medium, culturing for 48 hours, and selecting a single colony to perform PCR identification, wherein the generated single colony is a bacterium which is successfully electrically transferred.

And (3) PCR identification: extracting lpxE mutant strain H.pyhori delta futB delta lpxE genome DNA, amplifying upstream and downstream homologous arm fragments by using primers lpxE-leftup and lpxE-rightdown, judging whether the upstream and downstream homologous arm fragments lacking lpxE gene with the size of about 1150bp can be amplified, if corresponding fragments can be amplified, indicating that the result is consistent with the expectation, and preliminarily identifying the successful construction of the mutant strain.

Example 3

1. Delta lpxF primer design and PCR amplification

According to the reported sequence of helicobacter pylori 26695 strain (refer to GenBank sequence number as GCA _000008525.1), two pairs of fusion PCR primers are designed to respectively amplify upstream homology arm and downstream homology arm of lpxE gene, the amplified fragment sizes are 700bp and 600bp respectively, the primers are synthesized by Beijing Hua Dageneco, and the primer sequences are as follows:

lpxF left-up：5’GCTGCAGC ttaaagcatgagatgaccgctg 3’

lpxF left-down:5’CGGAATTCCG gtttgaagcgagaactcataaccc’

lpxF right-up:5’CGGGATCCCG gtctaatttagcgatcgcttcac 3’

lpxF right-down:5’CCATCGATGG cgcatttttctaggatcgtgtc 3’。

2. amplification of upstream and downstream homology arms of the helicobacter pylori lpxF gene

The amplification conditions were: after denaturation at 94 ℃ for 5min, the cycle was carried out at 94 ℃ for 10sec, 55 ℃ for 15sec, and 72 ℃ for 10 sec. After 35 cycles, extension was carried out for 10min at 72 ℃. The amplified PCR product is analyzed by 1% agarose gel electrophoresis, and the sizes of the two amplified fragments are 700bp and 600bp respectively, which are equivalent to the expected sizes.

3. Construction of PI11570-lpxF homologous recombination plasmid

And (3) respectively carrying out enzyme digestion on the homologous arm fragments obtained in the previous step by utilizing enzyme digestion sites on the primer primers, namely carrying out enzyme digestion on the left homologous arm by using EcoR I and Pst I, and carrying out enzyme digestion on the right homologous arm by using Cla I and BamH I to obtain products after the left and right homologous arms are subjected to enzyme digestion. The reaction system is as follows: 20 mu L of template, 4 mu L of buffer and 1 mu L of restriction enzyme; the reaction conditions are as follows: after the reaction is finished, cutting gel by agarose gel electrophoresis and recovering fragments for later use at 37 ℃ for 2 hours; and then carrying out enzyme digestion on the vector plasmids respectively, connecting the obtained vector enzyme digestion products with the left and right homologous arms respectively under the action of T4 ligase in the same reaction system, carrying out water bath overnight at 16 ℃, and transforming into an escherichia coli strain TOP10 to obtain the recombinant plasmid PI 11570-lpxF. The identification results confirmed that the constructed suicide plasmid was correct.

4. Construction and identification of deletion mutant of H.pyrori. delta. futB. delta. lpxE. delta. lpxF Gene

Preparing helicobacter pylori electrotransformation competence, culturing H.pylori delta futB delta lpxE mutant strain for 36-48h to logarithmic phase, pre-cooling on ice3ml of the electrotransfer solution was placed in a petri dish, and 1ml of the cells were collected in a clean 1.5ml centrifuge tube to adjust the cell concentration to 5 x 10⁹CFU/ml. Centrifuging at 6000rpm and 4 ℃ for 5min, and repeatedly washing three times. The supernatant was discarded and the cells were resuspended in 1ml of a precooled electrotransfer solution to adjust the cell concentration to 5 x 10⁸CFU/ml, i.e., prepared competent ready for use. The constructed homologous recombinant plasmid PI11570-lpxF is transformed into H.pyri.DELTA.futB.DELTA.lpxE mutant strain competence by means of electrotransformation, and the electric rotor is transferred into an electrotransfer and shocked at 2500V for 4 milliseconds. Transferring the liquid in the electric transfer cup to a helicobacter pylori solid culture medium without antibiotics, culturing for 48 hours in a micro-aerobic environment, subculturing for 48 hours on a culture medium containing corresponding antibiotics, transferring to a resistance culture medium, culturing for 48 hours, and selecting a single colony to perform PCR identification, wherein the generated single colony is a bacterium which is successfully electrically transferred.

And (3) PCR identification: extracting genomic DNA of an lpxF mutant strain H.pyori delta futB delta lpxE delta lpxF, amplifying upstream and downstream homologous arm fragments by using primers lpxF-leftup and lpxF-rightdown, judging whether the upstream and downstream homologous arm fragments which lack the lpxF gene and have the size of about 1300bp can be amplified, if the corresponding fragments can be amplified, indicating that the result is consistent with the expectation, and preliminarily identifying the success of mutant strain construction.

Example 4

1. Purification of lipid A (lipid A) of H.pylori. DELTA. futB. DELTA. lpxE. DELTA. lpxF mutant strains

Overnight cultures of the bacteria to be detected were incubated at a 1: 100 was added to fresh 200ml of Brookfield broth and microaerobically incubated at 37 ℃ for 180 revolutions to an OD600 of between 0.8 and 0.9. The cells were collected by centrifugation at 4 ℃ for 10min, washed once with PBS buffer, and the bacterial pellet resuspended in 20ml PBS followed by addition of chloroform methanol in a final ratio of chloroform: methanol: PBS ═ 1:2:0.8(v/v) to form a single phase Bligh/Dyer mix. The bacterial suspension was shaken at room temperature for 1 hour and then centrifuged at 2500g for 20 minutes to remove the phospholipid (phospholipid) containing upper layer, leaving a precipitate which was then resuspended in 40ml of monophasic Bligh/Dyer, transferred to a 50ml of a tightly covered Pyrex tube, centrifuged to remove the supernatant, left the precipitate, air dried, and then suspended in 25ml of 50mM sodium acetate pH 4.5 (both concussive and ultrasonic soluble in the solution), adjusted to pH 4.5 with acetic acid if necessary, then boiled in a water bath for 30 minutes to release lipid A, after cooling by concussion, the solution was transferred to a chloroform resistant centrifuge tube, chloroform and methanol were added to a volume ratio of chloroform: methanol: aqueous sodium acetate: 2:1.8 to form a biphasic Bligh/Dyer mix, shaken vigorously to extract lipid A, then centrifuged at 2,500 ℃ for 20min to form 2,500x g20 ℃ to form a biphasic glass vial (with a round glass vial for harvesting), the same chloroform was added to the solution to form a biphasic Bligh/Dyer mix (2:2:1.8, chloroform: methanol: PBS) again, which was then centrifuged, the lower phase was carefully removed and added to the same round glass bottle, the chloroform was removed by rotary evaporation, the sample was dissolved in chloroform: methanol (2:1, v/v), transferred to a small glass bottle, dried again, capped and stored at-80 ℃ or used for analysis.

2. Thin layer chromatography analysis of lipid A of H.pylori. delta. futB. delta. lpxE. delta. lpxF mutant strains

Dissolving a lipid A sample in trichloromethane/methanol (2:1, volume ratio), spotting the sample on a silica gel 60TLC plate, carrying out chromatography in a chloroform/methanol/glacial acetic acid/water (25: 15: 2:1, volume ratio) developing agent, after the chromatography is finished, uniformly spraying an ethanol/sulfuric acid (1: 9, volume ratio) developing solution on a shift for carbonization after the residual developing agent on the silica gel plate is completely volatilized, and finally, heating the silica gel plate to 180 ℃ for color development after the developing solution is completely volatilized, wherein the result is shown in figure 1A, and the thin film chromatography result shows that lipid A structural gene knockout (lpxE, lpxF) is successful.

3. MALDI-TOF MS analysis of lipid A of H.pylori. DELTA. futB. DELTA. lpxE. DELTA. lpxF mutant strains

The purified lipid A was dissolved in 100. mu.L of chloroform/methane (2:1, v/v) solution and spotted on a Matrix Assisted Laser Desorption Ionization (MALDI) sample platform, and 1. mu.L of norrharmann MALDI mixture was spotted at a concentration of 100mg/mL followed by sample analysis using a Bruker autoflex speed MALDI-TOF/TOF mass spectrometer (Bruker Daltonics Inc., Billerica, MA, USA), with the final results shown in FIG. 1B, and mass spectrometry indicated that the structure of lipid A obtained after simultaneous knock-out of lpxE and lpxF was consistent with expectations.

Example 5

1. Purification of lipopolysaccharide from mutant H.pylori. DELTA. futB. DELTA. lpxE. DELTA. lpxF strains

The dry cells (500mg) were collected and resuspended in 15mL of 10mM Tris-Cl buffer (pH8.0) containing 2% SDS, 4% 2-mercaptoethanol, 2mM MgCl₂And filled into a centrifuge tube. The suspension was placed in a water bath at 65 ℃ until the bacteria were dissolved. Mu.g proteinase K was then added and the sample was placed in a water bath at 65 ℃ for one hour, after which the sample was placed overnight at 37 ℃. Every other day, 2mL of 3M sodium acetate was added and mixed well with the bacterial suspension, then 40mL of pre-cooled ethanol was added and the sample was left at-20 ℃ overnight to form a precipitate. On alternate days, the sample was centrifuged at 4000 Xg for 15min, the upper suspension was slowly discarded, the lower pellet was resuspended in 9mL of distilled water, 1mL of 3M sodium acetate was added and vortexed, then 20mL of pre-cooled ethanol was added and vortexed again and the sample was placed at-20 ℃ overnight. The supernatant was again centrifuged every other day to discard it, 9mL of 10mM Tris-Cl (pH7.4) was added to resuspend the pellet, and 50. mu.g of DNase I and 12.5. mu.g of RNase were added. The sample was left at 37 ℃ for 4 hours, and the remaining nucleic acid was digested. And ethanol precipitation is carried out again, the mixed sample is placed in a water bath at 65 ℃ for 30 minutes, equal volume of 90% phenol is added, and the mixture is placed at 65 ℃ for 15 minutes. Immediately after the time, the samples were placed at 4 ℃ for rapid cooling and centrifuged at 6000 Xg for 15min at random. Collecting the upper water layer in a new tube, adding water with the same volume into the lower phenol layer again, placing at 65 ℃ for 15min, cooling in an ice-water mixture environment, centrifuging, adding the upper water layer into the water layer collected for the first time, dialyzing the water layer to remove residual phenol, drying the sample to obtain the lipopolysaccharide, and dissolving with distilled water for later use.

2. Verification of Lewis antigens in lipopolysaccharide of H.pylori. DELTA. futB. DELTA. lpxE. DELTA. lpxF mutant strains

Separating the mutant lipopolysaccharide sample by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis), and after electrophoresis is finished, transferring an LPS (low pressure polystyrene) strip onto a nitrocellulose membrane (nitrocellulose membrane) by a transfer printer. After the film is completely rotated, the film is rotated,blocking with Tris buffer containing 5% skimmed milk for 2 hours, adding rabbit antiserum (1: 100 dilution) specific for human serum Lewis antigen, and incubating at room temperature for 2 hours. After the incubation was complete, the goat anti-rabbit IgG secondary antibody labeled with alkaline phosphatase was mixed at a ratio of 1: incubation was performed at 10000 fold dilution and after two hours three times washing with TBS buffer. The immunoblotting strips were developed by adding BCIP developing solution. The reaction was terminated by washing the membrane in ultrapure water. Wherein the strain helicobacter pylori 26695 is used as positive control, and Escherichia coli is used as negative control. The final results are shown in FIG. 2, in which A shows that the structure of LPS is changed after knocking out genes lpxE and lpxF, and B shows that knocking out genes futB to Le^XThe antigen synthesis has blocking effect.

Example 6

1. Purification of outer membrane vesicles from mutant strains of H.pylori. DELTA. futB. DELTA. lpxE. DELTA. lpxF

First, a single colony was picked and the bacteria were cultured, overnight with 1: 100 in a volume of 2L liquid Brucella broth, culturing at 37 deg.C for 24-32 hr to OD 1, centrifuging at 4 deg.C and 10,000 × g, and removing thallus. The collected supernatant was filtered through a 0.45 μm filter to remove the remaining cells, and then the outer membrane vesicles in the supernatant were collected by ultracentrifugation (centrifugation conditions 2h,40,000 Xg, 4 ℃). The collected outer membrane vesicles were resuspended with DPBS and filtered again with 0.45 μm filter. The initially obtained outer membrane vesicles also need to be purified by density gradient centrifugation. Using 10mM HEPES buffer solution containing 0.85% NaCl as diluent, preparing density gradient centrifugation buffer solution into discontinuous density gradient centrifugation device from top to bottom according to the concentration of 20-45% by taking each layer as 2ml, and taking centrifugation at 4 ℃ overnight by adding the outer membrane vesicles collected in the last step on the uppermost layer of the density gradient centrifugation device, wherein the centrifugation conditions are 200,000 Xg. The density gradient layer containing a large amount of outer membrane vesicles was collected by ultracentrifugation (40,000 Xg, 4 ℃,1 hour), washed once with DPBS to remove impurities therefrom, and stored in a refrigerator at-80 ℃ for later use.

2. Outer membrane vesicles from mutant H.pylori. DELTA. futB. DELTA. lpxE. DELTA. lpxF strains stimulate the ability of TLR4 to respond

HEK-293 cell line stably expressing human-derived TLR4 was purchased from cell banks of Chinese academy of sciences (Shanghai, China), and cultured at 37 deg.C with 5% CO₂The medium was DMEM (Gibco BRL, USA) and 10% FBS (Hyclone Logan, UT, USA), and after the cells were cultured, the ratio was 10⁵The amount per well was divided into 96-well plates, which were stimulated after 18 hours by adding outer membrane vesicles of different solubilities to the plates (10, 10)²,10³and 10⁴μ g/ml), 24 hours later, cell culture supernatants were collected, centrifuged to remove cell debris, and assayed for cytokine expression levels. TLR4 levels were all purchased for R&The steps of the ELISA kit of DSystems, Inc. are carried out strictly according to the instructions, the detected TLR4 level is shown in figure 3, the cell level verifies the capacity of outer membrane vesicles recognized by TLR4 after knocking out genes futB, lpxE and lpxF, and the result shows that knocking out lpxE and lpxF simultaneously can stimulate the outer membrane vesicles to be recognized by TLR4 more effectively.

Sequence listing

<110> university of Nanchang

<120> helicobacter pylori mutant strain for stimulating immune response, construction method and application

<141>2020-08-05

<160>3

<170>SIPOSequenceListing 1.0

<210>1

<211>1302

<212>DNA

<213>Helicobacter pylori

<400>1

atgtttcagc ccctattaga cgcttatata gacagcaccc aaatagaaga gacaacccat 60

aagcccccat taaatatagc cctagccaat tggtggcctt tggataaaag agaaagcaaa 120

gggtttaggc gttttatctt gtatttcatc ctaagccaac gctatacaat cactttacac 180

caaaacccta aaaaacatgc agacatcgtc tttggcagtc ctattggatc agccagaaaa 240

atcctatcct atcaaaacac taaaagagtg ttttacaccg gtgaaaatga agtccctaat 300

ttcaacctct ttgattacgc cataggcttt gacgaattgg attttaacaa tcgttatttg 360

agaatgcctt tatattatga taaactacac cataaagcag agagcgtgaa tgacaccact 420

tcgccctaca agattaaaga caacagcctt tatactttaa aagaaccctc ccatcatttt 480

aaagaaaacc accctaattt atgcgcagta gtgaataatg agatcgatcc tttgaaaaga 540

gggtttgcta gttttgtcgc aagcaaccct aacgctccta aaaggaacgc tttctatgac 600

gctctaaatt ccatagagcc agttactggg ggagggagcg tgaaaaacac tttaggctat 660

aatgtcaaaa acaagagcga gtttttaagc caatacaaat tcaacctgtg ttttgaaaac 720

actcaaggct atggctatgt taccgaaaaa atcattgacg cttattttag ccacaccatt 780

cccatttatt gggggagtcc tagcgtggca caagatttta accctaaaag ttttgtgaat 840

gtgcatgatt ttaaaaactt tgatgaagcg atagattata tcaaatactt gcacacgcac 900

ccaaacgctt atttagacat gctctatgaa aaccctttaa acactattga tgggaaagct 960

tacttttacc aaaatttgag ttttaaaaaa atcctagatt tttttaaaac gattttagaa 1020

aacgacacga tttatcacaa taaccctttt gttttctatc gtgatttgaa tgagccgtta 1080

gcgactattg atgatttgag ggttaattat gatgatttga gggttaatta tgatgatttg 1140

agggttaatt atgatgattt gagggttaat tatgaccggc ttttacaaaa cgcttcacct 1200

ttattagaac tctctcaaaa caccactttt aaaatctatc gcaaaattta tcaaaaatcc 1260

ttacctttgt tgcgtgccat aaggagatgg gttaaaaaat aa 1302

<210>2

<211>576

<212>DNA

<213>Helicobacter pylori

<400>2

ttttaagaaa aacaacaaaa aggctagtag ctctaataat gatgaaaata gacccgctac 60

gcctaaacaa attagctttg ctgagatatt agctaaaaag cataatgtca agctccccaa 120

aggatttaaa tatagtatga aagtgtgtgg ggattttatc aatgagtatc ataagaagta 180

gtaagtgaaa ttttgctaaa ctagaaccta attaaaacta atgagggagt ttagcatgct 240

ttatattcca cccacttcaa aagaagtcta tgttagctct attgtggctt taaatatcca 300

tagcccacaa ggcacaggag attggcatag tagctatgct ttaatggaga atgcgtttga 360

tgatataggg gtttatatct atggtgaaaa acaagctcat aatactaata aactactagg 420

caatctaggc attatagatg gcacagcaag gctcaataaa atgggctatt accctaaaca 480

tactcccact tatattgcag agcatccaag agcttgtgta gattgtctct atgtttctgt 540

attgcaaact ggaaagctag gggttgttat gctaga 576

<210>3

<211>822

<212>DNA

<213>Helicobacter pylori

<400>3

ttgcgtgttt ttatcatttc tttaaatcaa aaagtgtgcg ataaatttgg tttggttttt 60

agagacacca caactttact caataatatc aacgccaccc accaccaagc gcaaattttt 120

gatgcgattt attccaagac ttttgaaggc gggttgcacc ccctagttaa aaagcattta 180

cacccttatt tcatcacgca aaatatcaaa gacatgggga ttgcaaccag tctcatcagt 240

gaggtttcta agttttatta cgctttaaaa taccatgcga aatttatgag cttgggggag 300

cttgggtgct atgcgagcca ttattcgttg tggcaaaaat gcatagagct caatgaagcg 360

atctgtattt tagaagacga tataaccttg aaagaggatt ttaaagaggg cttggatttt 420

ttagaaaaac acatccaaga gttaggctat gcgcgtttga tgcatttatt gtatgatgcc 480

agcgtgaaaa gtgagccttt aaaccataaa aaccaagaga tacaagagcg tgtggggatc 540

attaaagctt atagccatgg ggtggggacg caaggctatg tgatcacgcc caagattgcc 600

aaagtttttt tgaaacacag ccgaaaatgg gttgttcctg tggatacgat aatggacgct 660

acttttatcc atggcgtgaa aaatctggtg ttacaacctt ttgtgatcgc tgatgatgag 720

caaatctcta cgatagcgcg aaaagaagaa ccctatagcc ctaaaatcgc tctaatgaga 780

gaactccatt ttaaattttt gaaatggtgg cagtttgtat aa 822

Claims

1. A helicobacter pylori mutant strain for stimulating immune response is characterized in that the mutant strain does not contain a gene futB for encoding glycosyl transferase in the O antigen synthesis process, and simultaneously, a lipid A structure is modified to knock out related synthetic genes lpxE and lpxF.

2. The mutant helicobacter pylori that stimulates an immune response according to claim 1, wherein the classification of the mutant strain is designated as: helicobacter pylori, which is named as: helicobacter pylori LQ001(Δ futB Δ lpxE Δ lpxF), with a collection number of CCTCC NO: m2020028, deposited in the China center for type culture Collection, with the address of the Collection center: wuhan university in China, the preservation time is 1 month and 9 days in 2020.

3. The mutant helicobacter pylori that stimulates an immune response according to claim 1, wherein the nucleotide sequence of the futB gene is shown as SEQ ID No.1, the nucleotide sequence of the lpxE gene is shown as SEQ ID No.2, and the nucleotide sequence of the lpxF gene is shown as SEQ ID No. 3.

4. The construction method of the helicobacter pylori mutant strain for stimulating immune response is characterized by comprising the following steps:

1) knocking out gene futB of glycosyl transferase in the synthesis process of helicobacter pylori coding O antigen by a homologous recombination method;

2) the structure of lipid A is modified, and related synthetic genes lpxE and lpxF are knocked out by a homologous recombination method.

5. The construction method according to claim 4, wherein the homologous recombination method shown in the steps 1) and 2) comprises the following steps:

2) preparing a strain of helicobacter pylori 26695 competent;

6. The method for constructing according to claim 5, wherein the helicobacter pylori 26695 competence preparation method in step 2) comprises the following steps:

1) culturing H.pyriri 26695 for 36-48h to logarithmic phase, placing 3ml of electric transfer liquid pre-cooled on ice into a culture dish, collecting 1ml of thallus in a clean 1.5ml centrifuge tube to make the thallusThe concentration was adjusted to 5 x 10⁹CFU/ml；

2) Centrifuging at 6000rpm at 4 deg.C for 5min, and washing repeatedly for three times;

7. The construction method according to claim 5, wherein the homologous recombinant plasmid PI11570-futB is constructed by the following steps:

1) designing a primer:

futB left-up：5’GCTGCAGC TTTAGCCATTGCGGGTTTG 3’

futB left-down:5’CGGAATTCCG ggtcatgaccccatttatgaatg 3’

futB right-up:5’CGGGATCCCG gatgtggcgtagtctcagg 3’

futB right-down:5’CCATCGATGG gtgccaccggcatcaatac 3’；

2) extracting the genomic DNA of the helicobacter pylori 26695 strain in logarithmic growth phase as a template, amplifying by using left and right homologous arm primers to obtain amplification products of the left and right homologous arms, recovering the products, and performing enzyme digestion by using enzyme digestion sites on the primers respectively, namely performing enzyme digestion on the left homologous arm by using EcoR I and Pst I, and performing enzyme digestion on the right homologous arm by using Cla I and BamH I to obtain products after the enzyme digestion of the left and right homologous arms;

3) and then carrying out enzyme digestion on the vector plasmids respectively, connecting the obtained vector enzyme digestion products with the left and right homologous arms respectively under the action of T4 ligase, and transforming the product into an escherichia coli strain TOP10 to obtain the recombinant plasmid PI 11570-futB.

8. The method for constructing the recombinant plasmid of claim 5, wherein the homologous recombinant plasmid PI11570-lpxE is constructed by the following steps:

1) designing a primer:

lpxE left-up：5’GCTGCAGC GGCGTGATGAAATCCTACAAC 3’

lpxE left-down:5’CGGAATTCCG cgctaatgaaatagaaagcaacgg 3’

lpxE right-up:5’CGGGATCCCG taacgcctatgacaacacc 3’

lpxE right-down:5’CCATCGATGG cctaccgcatctctttggatg 3’；

3) and then respectively carrying out enzyme digestion on the vector plasmids, respectively connecting the obtained vector enzyme digestion products with the left and right homologous arms under the action of T4 ligase, and transforming the product into an escherichia coli strain TOP10 to obtain a recombinant plasmid PI 11570-lpxE.

9. The method for constructing the recombinant plasmid of claim 5, wherein the homologous recombinant plasmid PI11570-lpxF is constructed by the following steps:

1) designing a primer:

lpxF left-up：5’GCTGCAGC ttaaagcatgagatgaccgctg 3’

lpxF left-down:5’CGGAATTCCG gtttgaagcgagaactcataaccc 3’

lpxF right-up:5’CGGGATCCCG gtctaatttagcgatcgcttcac 3’

lpxF right-down:5’CCATCGATGG cgcatttttctaggatcgtgtc 3’；

3) and then respectively carrying out enzyme digestion on the vector plasmids, respectively connecting the obtained vector enzyme digestion products with the left and right homologous arms under the action of T4 ligase, and transforming the product into an escherichia coli strain TOP10 to obtain a recombinant plasmid PI 11570-lpxF.

10. Use of the mutant h.pylori bacteria for stimulating an immune response according to any one of claims 1 to 3, wherein the use comprises purifying the outer membrane vesicles produced thereby to produce a vaccine for controlling h.pylori infection.