CN111848813A

CN111848813A - IL7-Fc-GMCSF fusion protein and application thereof

Info

Publication number: CN111848813A
Application number: CN202010502780.5A
Authority: CN
Inventors: 郑飞剑; 吴丽萍; 查长春; 唐静秋; 朱锦秀; 张婧
Original assignee: Hundred English Bio Tech Ltd Of Taizhou City
Current assignee: Hundred English Bio Tech Ltd Of Taizhou City
Priority date: 2020-06-04
Filing date: 2020-06-04
Publication date: 2020-10-30

Abstract

The invention discloses an IL7-Fc-GMCSF fusion protein and application thereof, wherein the fusion protein is a dimeric protein and comprises a first polypeptide chain and a second polypeptide chain which are dimerized, the amino acid sequence of the first polypeptide chain is shown as SEQ ID NO.1, and the amino acid sequence of the second polypeptide chain is shown as SEQ ID NO. 2. The in vitro culture of peripheral blood lymphocytes was performed by the effect of IL7 and GMCSF on the stimulation of peripheral blood lymphocyte proliferation.

Description

IL7-Fc-GMCSF fusion protein and application thereof

Technical Field

The invention belongs to the field of biomedicine, and relates to an IL7-Fc-GMCSF fusion protein and application thereof.

Background

IL7(interleukin 7) is one of the members of the interleukin family, is a pluripotent cytokine, is mainly produced by thymic stromal cells, has a wide immune effect, and plays an important role in the growth, survival and differentiation of T cells. IL7 has the main functions of promoting the growth of B cell and T cell and resisting apoptosis, and is the factor for the growth of B cell and the survival, differentiation and proliferation of preB cell. Plays a key role in T cell development, proliferation and homeostatic regulation. The effector cells are mainly CD8+ subgroup. IL7 supports the homeostatic expansion and survival of memory CD8+ T cells and may also stimulate the lytic activity of peripheral blood mononuclear cells. Improving the immunity of the body has the promotion effect on the generation of DC and NK cells.

Granulocyte-macrophage colony factor (GMCSF) is a cytokine that promotes the differentiation of hematopoietic progenitor cells into granulocytes and macrophages, and can enhance the immune response of the body by regulating the number and function of Antigen Presenting Cells (APCs), especially dendritic cells. GMCSF enhances the immune response of the body by enhancing specific antibody responses and promoting T cell proliferation. The rhGM-CSF has wide physiological action, on one hand, it can stimulate the hematopoietic function of bone marrow, stimulate the proliferation of granulocyte, dendritic cell, monocyte and T cell, and can promote the maturation of monocyte and granulocyte, on the other hand, it can promote monocyte macrophage and neutrophil to release a large amount of cell factors to participate in the immune regulation of organism, and promote the expression of adhesion factor of neutrophil. Therefore, rhGM-CSF can enhance the antigen-presenting function of DC cells by stimulating the proliferation of DC cells, promote the combination of the cells and lymphocytes, promote the proliferation and differentiation of the lymphocytes, and further promote the generation of immune response; meanwhile, the proliferation of T cells can be directly stimulated, and the generation of immune response is promoted.

The Fc end of the antibody has high stability and long-acting property, and can effectively ensure the activity of the fusion protein and increase the effectiveness of the fusion protein.

At present, no related report of IL7-Fc-GMCSF fusion protein and the expression of IL7-Fc-GMCSF fusion protein by utilizing a Knob-in-hole mode is found.

Disclosure of Invention

Therefore, the invention provides an IL7-Fc-GMCSF fusion protein and application thereof.

The invention adopts the specific technical scheme that:

the first aspect of the invention provides an IL7-Fc-GMCSF fusion protein, which is a dimeric protein comprising a first polypeptide chain and a second polypeptide chain which are dimerized, wherein the amino acid sequence of the first polypeptide chain is shown as SEQ ID NO.1, and the amino acid sequence of the second polypeptide chain is shown as SEQ ID NO. 2.

The fusion protein is fused and connected with an IL7 protein fragment and a GMCSF protein fragment by an Fc protein fragment in a Knob-in-hole mode respectively.

The IL7 protein fragment is from the IL7 region of human; the Fc protein fragment is from the Fc protein fragment of human IgG; the GMCSF protein fragment is from the GMCSF region of human GMCSF.

The second aspect of the invention provides a gene for coding the fusion protein, and the nucleotide sequence of the gene is shown as SEQ ID NO.3 and SEQ ID NO. 4.

In the third aspect of the invention, an expression vector containing IL7-Fc-GMCSF fusion protein is provided, the IL7-Fc-GMCSF fusion protein is inserted into the expression vector, and the expression vector is preferably pCDNA3.4 vector.

The third aspect of the present invention provides a method for preparing the above IL7-Fc-GMCSF fusion protein, comprising the following steps:

(1) the pCDNA3.4 vector was processed: digestion with NotI/XbaI

(2) Constructing IL7-Fc-Flag and GMCSF-Fc-His fusion protein gene fragments, carrying out PCR amplification by taking segmented primers synthesized by whole genes as templates, recovering PCR products, and cloning to a treated pCDNA3.4 vector NotI/XbaI enzyme cutting site to obtain an expression vector containing IL7-Fc-Flag and GMCSF-Fc-His fusion protein;

(3) transforming an expression vector containing IL7-Fc-Flag and GMCSF-Fc-His fusion protein into host bacteria for amplification culture to obtain a low endotoxin plasmid;

(4) cell culture: adopting HEK293 cells, and sequentially performing cell recovery, primary cell passage and secondary cell passage culture to obtain cell sap;

(5) transient transfection and expression: diluting the low endotoxin plasmid IL7-Fc-Flag and the plasmid GMCSF-Fc-His by using a culture solution, and uniformly mixing to obtain a solution I; diluting the transfection reagent by using a culture solution, and uniformly mixing to obtain a solution II; adding the solution II into the solution I, mixing uniformly, incubating for 15 minutes at 37 ℃, dropwise adding the mixed transfection solution into the cell sap while shaking, and placing the cell sap into a shaking table for culture;

(6) Culturing for one week, collecting supernatant, and centrifuging at 8000rpm for 5 min; and separating and purifying the expressed fusion protein.

Preferably, the plasmid host bacterium is selected from TOP 10.

Preferably, the expressed fusion protein is isolated and purified by Ni affinity column purification and Flag packing purification, and homodimers are removed to obtain the heterodimer structure of IL 7-Fc-GMCSF.

The fourth aspect of the invention provides the application of the IL7-Fc-GMCSF fusion protein in preparing a medicament for culturing immune cells for treatment.

The immune cell is preferably a peripheral blood lymphocyte.

In a fifth aspect of the present invention, there is provided a peripheral blood lymphocyte culture reagent comprising the IL7-Fc-GMCSF fusion protein according to claim 1.

Has the advantages that: the invention constructs human IL7-Fc-GMCSF fusion protein, and performs in-vitro culture of peripheral blood lymphocytes through the function of stimulating the proliferation of the peripheral blood lymphocytes by IL7 and GMCSF.

Drawings

FIG. 1 shows PCR fragments for cloning of interest;

FIG. 2 shows the positive PCR identification of recombinant plasmids;

lane M: DL5000DNA Marker, lanes 1-2: recombinant plasmid PCR.

FIG. 3 is a SDS-PAGE image of the fusion proteins;

lane 1: reduced sample (Reducing) lane 2: Non-Reducing samples (Non-Reducing)

Lane M: protein Marker (Fermentas, SM0661)

FIG. 4 is a SEC-HPLC detection chart of the fusion protein;

FIG. 5 shows a heterodimeric form of the IL7-Fc-GMCSF fusion protein.

Detailed Description

To explain technical contents, structural features, and objects and effects of the technical solutions in detail, the following detailed description is given with reference to the accompanying drawings in conjunction with the embodiments.

And (3) gene synthesis: respectively fusing and connecting the same Fc protein fragment with an IL7 protein fragment and a GMCSF protein fragment in a Knob-in-hole mode to obtain a dimer (shown in figure 5), namely an IL7-Fc-GMCSF fusion protein, wherein the IL7 protein fragment is from an IL7 region of a human; the Fc protein fragment is from the Fc protein fragment of human IgG; the GMCSF protein fragment is from the GMCSF region of human GMCSF. The fusion protein comprises a first polypeptide chain and a second polypeptide chain which are dimerized, wherein the amino acid sequence of the first polypeptide chain is shown as SEQ ID NO.1, and the amino acid sequence of the second polypeptide chain is shown as SEQ ID NO. 2. The nucleotide sequence of the gene of the fusion protein is shown as SEQ ID NO.3 and SEQ ID NO. 4.

SEQ ID NO.1:

HumanIL7-(G4S)3-Fc(Knob)-Flag–Avitag

MHSSALLCCLVLLTGVRADCDIEGKDGKQYESVLMVSIDQLLDSMKEIGSNCLNNEFNFFKRHICDANKEGMFLFRAARKLRQFLKMNSTGDFDLHLLKVSEGTTILLNCTGQVKGRKPAALGEAQPTKSLEENKSLKEQKKLNDLCFLKRLLQEIKTCWNKILMGTKEHGGGGSGGGGSGGGGSEPKSADKTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTISKAKGQPREPQVYTLPPSREEMTKNQVSLWCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGKDYKDDDDKGLNDIFEAQKIEWHE

SEQ ID NO.2:

HumanGM-CSF-(G4S)3-Fc(Hole)-His-Avitag

MHSSALLCCLVLLTGVRAAPARSPSPSTQPWEHVNAIQEARRLLNLSRDTAAEMNETVEVISEMFDLQEPTCLQTRLELYKQGLRGSLTKLKGPLTMMASHYKQHCPPTPETSCATQIITFESFKENLKDFLLVIPFDCWEPVQEGGGGSGGGGSGGGGSEPKSADKTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTISKAKGQPREPQVYTLPPSREEMTKNQVSLSCAVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLVSKLTVDKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGKHHHHHHGLNDIFEAQKIEWHE

SEQ ID NO.3：

HumanIL7-(G4S)3-Fc(Knob)-Flag–Avitag

atgcacagctcagcactgctctgttgcctggtcctcctgactggggtgagggccgattgtgatattgaaggtaaagatggcaaacaatatgagagtgttctaatggtcagcatcgatcaattattggacagcatgaaagaaattggtagcaattgcctgaataatgaatttaacttttttaaaagacatatctgtgatgctaataaggaaggtatgtttttattccgtgctgctcgcaagttgaggcaatttcttaaaatgaatagcactggtgattttgatctccacttattaaaagtttcagaaggcacaacaatactgttgaactgcactggccaggttaaaggaagaaaaccagctgccctgggtgaagcccaaccaacaaagagtttggaagaaaataaatctttaaaggaacagaaaaaactgaatgacttgtgtttcctaaagagactattacaagagataaaaacttgttggaataaaattttgatgggcactaaagaacacggcggaggtggcagtggaggcggaggtagtggaggcggtgggtctgagcccaaatctgccgacaaaactcacacatgcccaccgtgcccagcacctgaactcctggggggaccgtcagtcttcctcttccccccaaaacccaaggacaccctcatgatctcccggacccccgaggtcacatgcgtggtggtggacgtgagccacgaagaccctgaggtcaagttcaactggtacgtggacggcgtggaggtgcataatgccaagacaaagccgcgggaggagcagtacaacagcacgtaccgtgtggtcagcgtcctcaccgtcctgcaccaggactggctgaatggcaaggagtacaagtgcaaggtctccaacaaagccctcccagcccccatcgagaaaaccatctccaaagccaaagggcagccccgagaaccacaggtgtacaccctgcccccatcccgggaggagatgaccaagaaccaggtcagcctgtggtgcctggtcaaaggcttctatcccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaagaccacgcctcccgtgctggactccgacggctccttcttcctctacagcaagctcaccgtggacaagagcaggtggcagcaggggaacgtcttctcatgctccgtgatgcatgaggctctgcacaaccactacacgcagaagagcctctccctgtctccgggtaaagactacaaggacgacgatgataagggcctgaacgacatcttcgaggcccagaagatcgagtggcacgagtga

SEQ ID NO.4

HumanGM-CSF-(G4S)3-Fc(Hole)-His-Avitag

atgcacagctcagcactgctctgttgcctggtcctcctgactggggtgagggccgcacccgcccgctcgcccagccccagcacgcagccctgggagcatgtgaatgccatccaggaggcccggcgtctcctgaacctgagtagagacactgctgctgagatgaatgaaacagtagaagtcatctcagaaatgtttgacctccaggagccgacctgcctacagacccgcctggagctgtacaagcagggcctgcggggcagcctcaccaagctcaagggccccttgaccatgatggccagccactacaagcagcactgccctccaaccccggaaacttcctgtgcaacccagattatcacctttgaaagtttcaaagagaacctgaaggactttctgcttgtcatcccctttgactgctgggagccagtccaggagggcggaggtggcagtggaggcggaggtagtggaggcggtgggtctgagcccaaatctgccgacaaaactcacacatgcccaccgtgcccagcacctgaactcctggggggaccgtcagtcttcctcttccccccaaaacccaaggacaccctcatgatctcccggacccccgaggtcacatgcgtggtggtggacgtgagccacgaagaccctgaggtcaagttcaactggtacgtggacggcgtggaggtgcataatgccaagacaaagccgcgggaggagcagtacaacagcacgtaccgtgtggtcagcgtcctcaccgtcctgcaccaggactggctgaatggcaaggagtacaagtgcaaggtctccaacaaagccctcccagcccccatcgagaaaaccatctccaaagccaaagggcagccccgagaaccacaggtgtacaccctgcccccatcccgggaggagatgaccaagaaccaggtcagcctgagctgcgccgtcaaaggcttctatcccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaagaccacgcctcccgtgctggactccgacggctccttcttcctcgtgagcaagctcaccgtggacaagagcaggtggcagcaggggaacgtcttctcatgctccgtgatgcatgaggctctgcacaaccactacacgcagaagagcctctccctgtctccgggtaaacaccatcaccatcatcacggcctgaacgacatcttcgaggcccagaagatcgagtggcacgagtga

Example 1

Experimental materials: primers (TSINGKE), pCDNA3.4 vector plasmid (Biointron), high fidelity PCR polymerase (Biointron), recombinase (Biointron), gel recovery kit (Biointron), dNTP (biologics), restriction endonuclease (NEB).

The experimental method comprises the following steps:

1, primer design:

2 PCR obtaining clone target sequence

The obtained cloned fragment of interest (FIG. 1)

Linear enzyme digestion of vector

pCDNA3.4	6ul(1.5ug)
		10×buffer	10μl
NotI	2μl
		XbaI	2μl
ddH2O	30μl
		In total	50μl

The pcDNA3.4 plasmid was digested with NotI/XbaI. An enzyme digestion reaction system: vector 6. mu.L, 10 XBuffer 10. mu.L, NotI 2. mu.L, XbaI 2. mu.L, ddH2O 30. mu.L the above system was placed in a water bath at 37 ℃ for 2h, and then the restriction enzyme was inactivated at 65 ℃ for 15 min. And (5) recovering the enzyme digestion product glue.

3, recombination reaction system:

4 colony screening experiment

1) Single colonies were picked from overnight plates.

2) Colony PCR was performed with CMV _ F (CGCAAATGGGCGGTAGGCGTG) and BI-Seq _ R primer (AGCGTAAAAGGAGCAACATAGT).

3) The resulting product was subjected to 1.2% agarose electrophoresis to identify positive clones (FIG. 2). Lanes 1-4 show that the amplified specific DNA molecular fragment with the size of about 1300bp is consistent with the size of the B270401-1 fragment, which indicates that the B270401-1 fragment is successfully inserted into the pcDNA3.4 plasmid; lanes 5-8 show that the amplified specific DNA molecular fragment of about 1300bp is identical to the B270401-2 fragment in size, indicating that the B270401-2 fragment is successfully inserted into the pcDNA3.4 plasmid.

4) 4 positive bacteria were selected and sequenced with CMV-F/BI-Seq-R.

5) Selecting positive bacteria liquid of correct clone for sequencing, extracting low endotoxin plasmid after amplification culture, sequencing and verifying

EXAMPLE 2 protein expression

The name of the experiment: cell culture and expression

Experimental materials: shaking table, centrifuge, water bath, 293CD05 Medium culture solution, transfection reagent (PEI), pipette of various specifications, shake flask of various specifications.

The experimental method comprises the following steps:

1 cell culture HEK293 cells

2 transient transfection and expression

Solution 1: diluting plasmid with culture solution, mixing

Solution 2: diluting the transfection reagent with the culture medium, and mixing

Adding the solution 2 into the solution 1, mixing uniformly, incubating for 15 minutes at 37 ℃, then adding the mixed transfection solution into the cell fluid dropwise while shaking, and placing the cell fluid into a shaking table for culturing.

One week of culture expression, supernatant was collected and centrifuged at 8000rpm for 5 min.

Example 3

3.1 protein purification

The name of the experiment: cell culture supernatant purification

Experimental materials: peristaltic pump, stirrer, glass purification column, 1XPBS, imidazole, glycine, Ni Smart Beads6FF, Flag packing and centrifuge tubes with various specifications

3.1.1 Experimental methods: purification with Ni affinity chromatography column

1) Column assembling: after the filler is mixed evenly, the filler suspension is sucked by a pipette and added into a chromatographic column. And connecting the pump, the connecting pipeline and the chromatographic column to obtain a column label.

2) The column was equilibrated with 1XPBS solution.

3) And (4) balancing and then loading.

4) After loading, the sample was washed with 1XPBS solution and then with 2.5mM imidazole.

5) After the washing, 2.5mM imidazole was washed off, eluted with 250mM imidazole, and collected in tubes at about 500ul per tube. The 10 tubes were collected together and the absorbance values at 280nm were read using a NanoDrop instrument.

6) Mixing protein: protein concentrations were mixed into appropriate centrifuge tubes and pre-dialysis volume concentration recordings were made.

7) Protein dialysis: and sucking the mixed protein into a dialysis bag, tightening the dialysis bag, marking, and putting the dialysis bag into a 1L beaker containing 1XPBS solution and putting the beaker on a stirrer to assist dialysis.

8) After dialysis, the protein was removed with a disposable sterile syringe and sampled for quality control. 3.1.2 Experimental methods: flag packing purification

2) The column was equilibrated with 1XPBS solution.

3) And (4) balancing and then loading.

4) After the sample loading is finished, impurities are washed by 1XPBS solution.

5) After the impurity washing is finished, the 1XPBS solution is cleaned, is eluted by glycine eluent and is collected in different tubes, and each tube is about 500 ul. The 5 tubes were collected together and the absorbance values at 280nm were read using a NanoDrop instrument.

8) After dialysis, the protein was removed with a disposable sterile syringe and sampled for quality control.

3.2 purity testing

SDS-PAGE detection

Experimental materials: electrophoresis apparatus, vertical electrophoresis tank, constant temperature metal bath, 30% acrylamide, 1.5M Tris-HCl, 1M Tris-HCl, 10% SDS, 2 xSDS-PAGELOADING Buffer, 10% AP, 5 xSDS-PAGE electrophoresis Buffer, decolorizing solution, staining solution

The experimental method comprises the following steps:

1) sample processing

Treatment of a reduced sample: the reduced loading buffer was added to 3.0ug of protein and treated at 99 ℃ for 10 min. Non-reduction sample treatment: the non-reducing loading buffer was loaded with 3.0ug of protein.

2) Electrophoresis

The voltage is firstly 80V for 15min and then 170V for 40 min.

3) Dyeing and decolorizing of gels

Putting the gel into the staining solution, boiling in boiling water for 15min, and shaking with a shaker at 60rpm for 1 h. Boiling the destaining solution in boiling water for 15min, shaking for 1h with a 60rpm shaking table, replacing the destaining solution, shaking for 2h with a 60rpm shaking table, and taking a picture for storage.

The experimental results are as follows: see FIG. 3

Therefore, the following steps are carried out: the protein has theoretical reducing molecular weight of 47Kda and 44Kda, actual reducing molecular weight of 60Kda and 55Kda, and purity > 95%.

3.3 SEC-HPLC detection

Experimental apparatus and materials: high performance liquid chromatograph, gel chromatographic column, deionized water, and mobile phase (Na)₂HPO₄.12H₂0、NaH₂PO₄.2H₂O、NaCl)

The experimental method comprises the following steps:

SEC experiments were performed using a high performance liquid chromatograph LC-20AT and a gel chromatography column, under the following experimental conditions:

parameter(s)	Numerical value
		Flow rate of flow	1ml/min
Concentration of sample	0.6mg/ml
		Sample volume	20μl
Column temperature
		35℃
Detection wavelength			214nm，280nm
	Time of acquisition	15min

The water was replaced with the mobile phase and the flow rate was slowly increased to 1.000ml/min until the baseline leveled off. Taking 50ul of protein into a sample introduction bottle with a corresponding number, placing the sample introduction bottle in a corresponding position of the instrument, wherein the sample introduction time is 15min, analyzing and processing data, storing, replacing the mobile phase with deionized water, and washing for 1.5 h.

The experimental results are as follows: see fig. 4.

As can be seen from fig. 4: the purity at 214nm was 90.1% and at 280nm 89.9%.

3.4 endotoxin detection

Experimental materials: vortex oscillator, electric heating constant temperature incubator, endotoxin work standard, limulus reagent, and endotoxin test water (Andos)

The experimental method comprises the following steps:

1) preparing a positive control solution of a sample: mixing 2 times of test solution concentration solution with endotoxin standard (0.12EU/ml) at a ratio of 1:1

2) Preparing a test solution:

preparing a test solution: sample dilution factor: MVD ═ C.L/λ ═ (0.6mg/ml ═ 1EU/mg) ÷ 0.03EU/ml ═ 20

Injecting: MVD: maximum effective dilution multiple of test sample

L: test article bacterial endotoxin limit (1EU/mg)

C, concentration of the sample

λ: limulus reagent labeling sensitivity (0.03EU/ml)

110ul of test solution sample volume 0.6mg/ml 20 x 110ul 3.3ug

Limulus reagent (0.03EU/ml)	Water for endotoxin test	Sample (I)
			Negative control tube	200ul	Is free of
Positive control tube	100ul	100ul endotoxin standard (0.06EU/ml)
			Positive control tube for sample	100ul	100ul of positive control solution
Test tube	100ul	100ul of test solution

Sealing the tube, shaking gently, vertically placing into a 37 deg.C constant temperature incubator, incubating for 60min

The experimental results are as follows: the limulus reagent state was clear and transparent without coagulation, and the endotoxin detection result was <1 EU/mg.

Example 4 cell assay

And (3) experimental verification: verification of the proliferative Effect of the human IL7-Fc-GMCSF fusion protein on peripheral blood lymphocytes.

1 detection device and reagent

Peripheral cells of lymph blood, IL7-Fc-GMCSF fusion protein, PBS, MTT, enzyme labeling instrument, cell culture box, etc.

2 method of experiment

2.1 obtaining PBMC cells

2.2 cells were washed three times with basal Medium (10% FBS RPMI 1640P/L)

2.3 resuspending the cells in a basal medium to obtain a cell suspension with a density of 4X105 cells/ml

2.4 addition of 50ul cell suspension (Pre-PHA) (i.e., 20000/well) to 96-well plates containing IL7-Fc-GMCSF fusion protein

Culturing at 2.537 deg.C in 5% CO2 incubator for 72h, adding 20ul MTT 5mg/ml into each well, and reacting in incubator for 4-5h

2.6 take out 96-well plate, add DMSO (100 ul/well), incubate 15min after reaction, read at 570nm with microplate reader.

3 results of the experiment

MTT test results:

the detection result of MTT experiment shows that the GMCSF-Fc-IL7 fusion protein has the function of stimulating PBMC proliferation.

Although the embodiments have been described, once the basic inventive concept is obtained, other variations and modifications of these embodiments can be made by those skilled in the art, so that the above embodiments are only examples of the present invention, and not intended to limit the scope of the present invention, and all equivalent structures or equivalent processes using the contents of the present specification and drawings, or any other related technical fields, which are directly or indirectly applied thereto, are included in the scope of the present invention.

Sequence listing

<110> Baiying Biotechnology Ltd, Taizhou

<120> IL7-Fc-GMCSF fusion protein and application thereof

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>440

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Met His Ser Ser Ala Leu Leu Cys Cys Leu Val Leu Leu Thr Gly Val

1 5 10 15

Arg Ala Asp Cys Asp Ile Glu Gly Lys Asp Gly Lys Gln Tyr Glu Ser

20 25 30

Val Leu Met Val Ser Ile Asp Gln Leu Leu Asp Ser Met Lys Glu Ile

35 40 45

Gly Ser Asn Cys Leu Asn Asn Glu Phe Asn Phe Phe Lys Arg His Ile

50 55 60

Cys Asp Ala Asn Lys Glu Gly Met Phe Leu Phe Arg Ala Ala Arg Lys

65 70 75 80

Leu Arg Gln Phe Leu Lys Met Asn Ser Thr Gly Asp Phe Asp Leu His

85 90 95

Leu Leu Lys Val Ser Glu Gly Thr Thr Ile Leu Leu Asn Cys Thr Gly

100 105 110

Gln Val Lys Gly Arg Lys Pro Ala Ala Leu Gly Glu Ala Gln Pro Thr

115 120 125

Lys Ser Leu Glu Glu Asn Lys Ser Leu Lys Glu Gln Lys Lys Leu Asn

130 135 140

Asp Leu Cys Phe Leu Lys Arg Leu Leu Gln Glu Ile Lys Thr Cys Trp

145 150 155 160

Asn Lys Ile Leu Met Gly Thr Lys Glu His Gly Gly Gly Gly Ser Gly

165 170 175

Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Pro Lys Ser Ala Asp Lys

180 185 190

Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro

195 200 205

Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser

210 215 220

Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp

225 230 235 240

Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn

245 250 255

Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val

260 265 270

Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu

275 280 285

Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys

290 295 300

Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr

305 310 315 320

Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Trp

325 330 335

Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu

340 345 350

Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu

355 360 365

Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys

370 375 380

Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu

385 390 395 400

Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly

405 410 415

Lys Asp Tyr Lys Asp Asp Asp Asp Lys Gly Leu Asn Asp Ile Phe Glu

420 425 430

Ala Gln Lys Ile Glu Trp His Glu

435440

<210>2

<211>413

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>2

Met His Ser Ser Ala Leu Leu Cys Cys Leu Val Leu Leu Thr Gly Val

1 5 10 15

Arg Ala Ala Pro Ala Arg Ser Pro Ser Pro Ser Thr Gln Pro Trp Glu

20 25 30

His Val Asn Ala Ile Gln Glu Ala Arg Arg Leu Leu Asn Leu Ser Arg

35 40 45

Asp Thr Ala Ala Glu Met Asn Glu Thr Val Glu Val Ile Ser Glu Met

50 55 60

Phe Asp Leu Gln Glu Pro Thr Cys Leu Gln Thr Arg Leu Glu Leu Tyr

65 70 75 80

Lys Gln Gly Leu Arg Gly Ser Leu Thr Lys Leu Lys Gly Pro Leu Thr

85 90 95

Met Met Ala Ser His Tyr Lys Gln His Cys Pro Pro Thr Pro Glu Thr

100 105 110

Ser Cys Ala Thr Gln Ile Ile Thr Phe Glu Ser Phe Lys Glu Asn Leu

115 120 125

Lys Asp Phe Leu Leu Val Ile Pro Phe AspCys Trp Glu Pro Val Gln

130 135 140

Glu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

145 150 155 160

Glu Pro Lys Ser Ala Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala

165 170 175

Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro

180 185 190

Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val

195 200 205

Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val

210 215 220

Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln

225 230 235 240

Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln

245 250 255

Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala

260 265 270

Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro

275 280 285

Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser ArgGlu Glu Met Thr

290 295 300

Lys Asn Gln Val Ser Leu Ser Cys Ala Val Lys Gly Phe Tyr Pro Ser

305 310 315 320

Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr

325 330 335

Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Val

340 345 350

Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe

355 360 365

Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys

370 375 380

Ser Leu Ser Leu Ser Pro Gly Lys His His His His His His Gly Leu

385 390 395 400

Asn Asp Ile Phe Glu Ala Gln Lys Ile Glu Trp His Glu

405 410

<210>3

<211>1323

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

atgcacagct cagcactgct ctgttgcctg gtcctcctga ctggggtgag ggccgattgt 60

gatattgaag gtaaagatgg caaacaatat gagagtgttc taatggtcagcatcgatcaa 120

ttattggaca gcatgaaaga aattggtagc aattgcctga ataatgaatt taactttttt 180

aaaagacata tctgtgatgc taataaggaa ggtatgtttt tattccgtgc tgctcgcaag 240

ttgaggcaat ttcttaaaat gaatagcact ggtgattttg atctccactt attaaaagtt 300

tcagaaggca caacaatact gttgaactgc actggccagg ttaaaggaag aaaaccagct 360

gccctgggtg aagcccaacc aacaaagagt ttggaagaaa ataaatcttt aaaggaacag 420

aaaaaactga atgacttgtg tttcctaaag agactattac aagagataaa aacttgttgg 480

aataaaattt tgatgggcac taaagaacac ggcggaggtg gcagtggagg cggaggtagt 540

ggaggcggtg ggtctgagcc caaatctgcc gacaaaactc acacatgccc accgtgccca 600

gcacctgaac tcctgggggg accgtcagtc ttcctcttcc ccccaaaacc caaggacacc 660

ctcatgatct cccggacccc cgaggtcaca tgcgtggtgg tggacgtgag ccacgaagac 720

cctgaggtca agttcaactg gtacgtggac ggcgtggagg tgcataatgc caagacaaag 780

ccgcgggagg agcagtacaa cagcacgtac cgtgtggtca gcgtcctcac cgtcctgcac 840

caggactggc tgaatggcaa ggagtacaag tgcaaggtct ccaacaaagc cctcccagcc 900

cccatcgaga aaaccatctc caaagccaaa gggcagcccc gagaaccaca ggtgtacacc 960

ctgcccccat cccgggagga gatgaccaag aaccaggtca gcctgtggtg cctggtcaaa 1020

ggcttctatc ccagcgacat cgccgtggag tgggagagca atgggcagcc ggagaacaac 1080

tacaagacca cgcctcccgt gctggactcc gacggctcct tcttcctcta cagcaagctc 1140

accgtggaca agagcaggtg gcagcagggg aacgtcttct catgctccgt gatgcatgag 1200

gctctgcaca accactacac gcagaagagc ctctccctgt ctccgggtaa agactacaag 1260

gacgacgatg ataagggcct gaacgacatc ttcgaggccc agaagatcga gtggcacgag 1320

tga 1323

<210>4

<211>1242

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

atgcacagct cagcactgct ctgttgcctg gtcctcctga ctggggtgag ggccgcaccc 60

gcccgctcgc ccagccccag cacgcagccc tgggagcatg tgaatgccat ccaggaggcc 120

cggcgtctcc tgaacctgag tagagacact gctgctgaga tgaatgaaac agtagaagtc 180

atctcagaaa tgtttgacct ccaggagccg acctgcctac agacccgcct ggagctgtac 240

aagcagggcc tgcggggcag cctcaccaag ctcaagggcc ccttgaccat gatggccagc 300

cactacaagc agcactgccc tccaaccccg gaaacttcct gtgcaaccca gattatcacc 360

tttgaaagtt tcaaagagaa cctgaaggac tttctgcttg tcatcccctt tgactgctgg 420

gagccagtcc aggagggcgg aggtggcagt ggaggcggag gtagtggagg cggtgggtct 480

gagcccaaat ctgccgacaa aactcacaca tgcccaccgt gcccagcacc tgaactcctg 540

gggggaccgt cagtcttcct cttcccccca aaacccaagg acaccctcat gatctcccgg 600

acccccgagg tcacatgcgt ggtggtggac gtgagccacg aagaccctga ggtcaagttc 660

aactggtacg tggacggcgt ggaggtgcat aatgccaaga caaagccgcg ggaggagcag 720

tacaacagca cgtaccgtgt ggtcagcgtc ctcaccgtcc tgcaccagga ctggctgaat 780

ggcaaggagt acaagtgcaa ggtctccaac aaagccctcc cagcccccat cgagaaaacc 840

atctccaaag ccaaagggca gccccgagaa ccacaggtgt acaccctgcc cccatcccgg 900

gaggagatga ccaagaacca ggtcagcctg agctgcgccg tcaaaggctt ctatcccagc 960

gacatcgccg tggagtggga gagcaatggg cagccggaga acaactacaa gaccacgcct 1020

cccgtgctgg actccgacgg ctccttcttc ctcgtgagca agctcaccgt ggacaagagc 1080

aggtggcagc aggggaacgt cttctcatgc tccgtgatgc atgaggctct gcacaaccac 1140

tacacgcaga agagcctctc cctgtctccg ggtaaacacc atcaccatca tcacggcctg 1200

aacgacatct tcgaggccca gaagatcgag tggcacgagt ga 1242

Claims

1. An IL7-Fc-GMCSF fusion protein, which is a dimeric protein comprising a first polypeptide chain and a second polypeptide chain which are dimerised, the amino acid sequence of the first polypeptide chain being shown in SEQ ID NO.1 and the amino acid sequence of the second polypeptide chain being shown in SEQ ID NO. 2.

2. The fusion protein of claim 1, wherein the fusion protein is formed by fusion of an Fc protein fragment and an IL7 protein fragment and a GMCSF protein fragment through a Knob-in-hole mode.

3. The fusion protein of claim 2, wherein the fragment of IL7 protein is from the human IL7 region; the Fc protein fragment is from the Fc protein fragment of human IgG; the GMCSF protein fragment is from the GMCSF region of human GMCSF.

4. The gene encoding the fusion protein of claim 1, wherein the nucleotide sequence of the gene is represented by SEQ ID No.3 and SEQ ID No. 4.

5. An expression vector containing IL7-Fc-GMCSF fusion protein is characterized in that IL7-Fc-Flag and GMCSF-Fc-His fusion protein are inserted into the expression vector, and the expression vector is preferably pCDNA3.4 vector.

6. A method of producing an IL7-Fc-GMCSF fusion protein according to claim 1, comprising the steps of:

(1) the pCDNA3.4 vector was processed: digestion with NotI/XbaI

(3) transforming an expression vector containing IL7-Fc-Flag and GMCSF-Fc-His fusion protein into plasmid host bacteria for amplification culture to obtain a low endotoxin plasmid;

7. The method for preparing the expression vector containing IL7-Fc-GMCSF fusion protein according to claim 6, wherein the plasmid host bacterium is selected from TOP10, and/or

The method for separating and purifying the expressed fusion protein comprises the steps of Ni affinity chromatographic column purification and Flag filler purification, and the homodimer is removed to obtain the heterodimer structure of the IL 7-Fc-GMCSF.

8. Use of an IL7-Fc-GMCSF fusion protein according to claim 1 for the preparation of a medicament for immune cell culture for therapeutic use.

9. The use of claim 8, wherein the immune cell is a peripheral blood lymphocyte.

10. A peripheral blood lymphocyte culture reagent comprising the IL7-Fc-GMCSF fusion protein of claim 1.