CN111840310A - Application of ssc-miR-151-3p in preparation of medicine for regulating replication of porcine reproductive and respiratory syndrome virus - Google Patents

Application of ssc-miR-151-3p in preparation of medicine for regulating replication of porcine reproductive and respiratory syndrome virus Download PDF

Info

Publication number
CN111840310A
CN111840310A CN202010729745.7A CN202010729745A CN111840310A CN 111840310 A CN111840310 A CN 111840310A CN 202010729745 A CN202010729745 A CN 202010729745A CN 111840310 A CN111840310 A CN 111840310A
Authority
CN
China
Prior art keywords
mir
ssc
replication
respiratory syndrome
preparation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202010729745.7A
Other languages
Chinese (zh)
Other versions
CN111840310B (en
Inventor
张婧
卢曾军
孙普
李凤娟
曹轶梅
李冬
刘在新
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Lanzhou Veterinary Research Institute of CAAS
Original Assignee
Lanzhou Veterinary Research Institute of CAAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Lanzhou Veterinary Research Institute of CAAS filed Critical Lanzhou Veterinary Research Institute of CAAS
Priority to CN202010729745.7A priority Critical patent/CN111840310B/en
Publication of CN111840310A publication Critical patent/CN111840310A/en
Application granted granted Critical
Publication of CN111840310B publication Critical patent/CN111840310B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses

Abstract

The invention relates to application of ssc-miR-151-3p in preparation of a medicine for regulating replication of porcine reproductive and respiratory syndrome virus, and belongs to the technical field of antiviral medicines. The invention provides application of ssc-miR-151-3p in preparation of a medicine for regulating replication of porcine reproductive and respiratory syndrome virus, wherein a nucleotide sequence of the ssc-miR-151-3p is shown in SEQ ID No. 1. The invention provides a new target for researching drugs for antagonizing PRRSV virus replication and also provides a candidate miRNA for deeply knowing a host antiviral signal path after PRRSV infection.

Description

Application of ssc-miR-151-3p in preparation of medicine for regulating replication of porcine reproductive and respiratory syndrome virus
Technical Field
The invention relates to the technical field of antiviral drugs, in particular to application of ssc-miR-151-3p in preparation of a drug for regulating replication of porcine reproductive and respiratory syndrome virus.
Background
Micro non-coding RNA (miRNA) is small non-coding RNA with the endogenous length of about 20-25 nucleotides in an organism, and is complementary and matched with target mRNA, so that the expression of the gene is negatively regulated at the level after transcription, and the translation of the mRNA is inhibited or the degradation of the mRNA is induced. miRNA participates in various biological processes such as regulation of animal development, cell proliferation and death, immune response and the like. In recent years, more and more studies have shown that mirnas are indispensable regulators in the complex network of innate/adaptive immunity and host-pathogen interactions of the body, playing an important role in host-virus interactions.
Porcine Reproductive And Respiratory Syndrome (PRRS), also known as Porcine Reproductive And Respiratory Syndrome, is a highly contagious disease mainly characterized by sow dysgenesis And dyspnea in piglets And growing-finishing pigs, which causes huge losses to the world pig industry every year And is now a major epidemic disease seriously affecting pig production. Its pathogen PRRSV, a single-stranded positive-strand RNA virus, is the only natural host of swine, mainly targets swine alveolar macrophages (PAM), destroys the host immune system, causes severe immunosuppression, causes delayed or even defective acquired immune response, and causes persistent infection. The existing vaccine is difficult to effectively prevent and control the disease, and a new antiviral strategy is urgently needed to be developed.
Disclosure of Invention
The invention aims to provide application of ssc-miR-151-3p in preparation of a medicine for regulating replication of porcine reproductive and respiratory syndrome virus. The invention provides a new target for researching drugs for antagonizing PRRSV virus replication and also provides a candidate miRNA for deeply knowing a host antiviral signal path after PRRSV infection.
The invention provides application of ssc-miR-151-3p in preparation of a medicine for regulating replication of porcine reproductive and respiratory syndrome virus, wherein a nucleotide sequence of the ssc-miR-151-3p is shown in SEQ ID No. 1.
The invention also provides application of a substance for up-regulating the expression of ssc-miR-151-3p in preparation of a medicament for antagonizing porcine reproductive and respiratory syndrome virus replication, wherein the nucleotide sequence of the ssc-miR-151-3p is shown in SEQ ID No. 1.
The invention provides application of ssc-miR-151-3p in preparation of a medicine for regulating replication of porcine reproductive and respiratory syndrome virus. Test results show that the PRRSV replication can be inhibited by up-regulating the expression quantity of ssc-miR-151-3p in PAM cells, and the PRRSV replication can be promoted by down-regulating the expression quantity of miRNA. The invention provides a new target for researching the medicament for antagonizing PRRSV virus replication, lays a foundation for developing a new antiviral strategy, and provides a candidate miRNA for deeply knowing a host antagonistic virus replication mechanism after PRRSV infection.
Drawings
FIG. 1 shows that the PAM cell provided by the invention inoculates GSWW/2015 strain with MOI of 0.5, extracts total cell miRNA 24 hours later, and performs real-time fluorescence quantitative PCR;
FIG. 2 shows that negative control and ssc-miR-151-3p mimics are transfected in PAM cells respectively, total miRNA of the cells is extracted after 24 hours, and real-time fluorescence quantitative PCR results are obtained;
FIG. 3 shows that negative control and ssc-miR-151-3p inhibitor are transfected into PAM cells respectively, total miRNA of the cells is extracted after 24 hours, and real-time fluorescence quantitative PCR results are obtained;
FIG. 4 shows that negative control and ssc-miR-151-3p simulant are transfected in PAM cells respectively, after 24 hours, GSWW/2015 strain is inoculated with MOI of 0.5, total RNA is extracted after infection is carried out for 24 hours, and real-time fluorescence quantitative PCR result is obtained;
FIG. 5 shows that negative control and ssc-miR-151-3p inhibitor are transfected in PAM cells respectively, after 24 hours, GSWW/2015 strain is inoculated with MOI of 0.5, total RNA is extracted after infection is carried out for 24 hours, and real-time fluorescence quantitative PCR result is obtained.
Detailed Description
The invention provides application of ssc-miR-151-3p in preparation of a medicine for regulating replication of porcine reproductive and respiratory syndrome virus, wherein a nucleotide sequence of the ssc-miR-151-3p is shown in SEQ ID No.1 (CUAGACUGAAGCUCCUUGAGGA).
The invention also provides application of a substance for up-regulating the expression of ssc-miR-151-3p in preparation of a medicament for antagonizing porcine reproductive and respiratory syndrome virus replication, wherein the nucleotide sequence of the ssc-miR-151-3p is shown in SEQ ID No. 1. In a specific embodiment of the invention, the expression level of ssc-miR-151-3p in Porcine Alveolar Macrophage (PAM) is reduced after 24 hours of infection with the PPRSV strain GSWW/201524. The expression level of ssc-miR-151-3p (ssc-miR-151-3p analogue, SEQ ID NO.1, (5 '-3') CUAGACUGAAGCUCCUUGAGGA) is up-regulated in PAM cells, so that the PRRSV replication can be inhibited, and the PRRSV replication can be promoted by down-regulating the expression level of miRNA (ssc-miR-151-3p inhibitor, SEQ ID NO.2, UCCUCAAGGAGCUUCAGUCUAG). The invention provides a new target for researching drugs for antagonizing PRRSV virus replication and also provides a candidate miRNA for deeply knowing a host antiviral signal path after PRRSV infection.
The application of ssc-miR-151-3p in the preparation of a medicament for regulating replication of porcine reproductive and respiratory syndrome virus is further described in detail with reference to the following specific examples, and the technical scheme of the invention includes but is not limited to the following examples.
Example 1
Porcine Alveolar Macrophage (PAM) isolation: selecting PRRSV negative healthy pigs of 3 weeks old, aseptically separating lungs after anesthesia sacrifice, and irrigating the lungs with sterile 1% double-antibody PBS buffer solution. Centrifuging 400g of the collected lavage fluid for 10 min, removing supernatant, adding 50ml LPBS buffer solution to resuspend cells, repeatedly washing for 2 times, collecting precipitated cells, resuspending the cells in 10% FBS-containing RPMI-1640 complete medium, counting, and adjusting cell concentration to 1.5 × 106cells/mL, 1mL per well, were seeded in 12-well plates and incubated at 37 ℃ in an incubator (or at 1X 10)7Frozen per mL), adherent cells are PAM.
Virus inoculation: GSWW/2015 strain (Weijie B, Zhijia W, Pu S, et al. the molecular pharmaceutical analysis of PRRSV GSWW/2015 strain and its pathogenesis peptides [ J ]. BMC vector Research,2018,14(1):240, NCBI accession number: KX767091 of GSWW/2015 strain) was inoculated to PAM cells at MOI of 0.5, while a control of non-viral (Mock) was set, supplemented to 1mL with RPMI-1640 medium containing 2% FBS, and cultured in 37 ℃ incubator.
Total miRNA extraction, first strand cDNA synthesis and real-time fluorescence quantitative PCR: lysed cells were harvested 24 hours after inoculation and total mirnas were extracted using Qiagen miRNeasy Mini Kit. All-inOne adopting Guangzhou Yijin biotechnology limitedTMAnd (3) reverse transcribing the total miRNA by the miRNA First-Strand cDNA Synthesis Kit, adding 500ng of the total miRNA into each 25 mu L system, and reacting at 37 ℃ for 60 minutes and 85 ℃ for 5 minutes to obtain the cDNA. All-inOne adopting Guangzhou Yijin biotechnology limitedTMAnd (3) miRNA qPCR kit, configuring a system and setting a program according to the instruction, taking cDNA obtained by reverse transcription as a template, diluting the primer to 10 mu M, and carrying out a fluorescence quantitative experiment to detect the expression quantity of ssc-miR-151-3 p. According to the Ct value of the fluorescent quantitative PCR experiment, U6 was used as an internal reference (U6F: CTCGCTTCGGCAGCACA, SEQ ID NO.4, U6R (universal downstream primer): AACGCTTCACGAATTTGCGT, SEQ ID NO.5) and 2 was used-△△CtThe expression fold change of ssc-miR-151-3p between the virus inoculation group and the control group is calculated by a formula. As shown in FIG. 1 (the PAM cells are inoculated with GSWW/2015 strain at MOI of 0.5, total cellular miRNA is extracted after 24 hours, and the real-time fluorescence quantitative PCR result) shows that the RT-QPCR result shows that ssc-miR-151-3p can reduce the expression in the PAM cells infected with GSWW/2015. The sequence of the ssc-miR-151-3p upstream primer is shown in a sequence table SEQ ID NO.3(CCTAGACTGAAGCTCCTTGAGGA), the sequence of the U6 upstream primer (U6F) is shown in a sequence table SEQ ID NO.4, and the sequence of the universal downstream primer is shown in a sequence table SEQ ID NO.5 (U6R).
The ssc-miR-151-3p mimetic upregulates expression of ssc-miR-151-3p in PAM cells. mu.L of 100. mu.Mscc-miR-151-3 p and a negative control mimetic (UUGUACUACACAAAAGUACUG, SEQ ID NO.9, manufactured by Gima) were added to 125. mu.L of Opti-MEM medium, respectively, mixed, and 2.5. mu.L of Lipofectamine 3000Reagent was added to 125. mu.L of Opti-MEM medium, mixed, and allowed to stand at room temperature for 5 minutes; fully and uniformly mixing the diluted simulant solution with the liposome, and standing for 15 minutes at room temperature; rinsing PAM cells pre-seeded in 12-well plates with Opti-MEM medium, adding the mixture of the mimic and liposome to each well, adding 745. mu.L of 10% FBS RPMI-1640 complete medium, shaking gently, and standing at 37 deg.C and 5% CO2The incubator of (1) is used for culture. Collecting cells after 24 hours, extracting total miRNA, carrying out reverse transcription, and using real-time fluorescence to determineAnd detecting the expression level of ssc-miR-151-3p by quantitative PCR. As shown in FIG. 2 (negative control and mock of ssc-miR-151-3p are transfected in PAM cells respectively, total miRNA of cells is extracted after 24 hours, and real-time fluorescence quantitative PCR result) shows that after the mock of ssc-miR-151-3p is transfected, the expression of ssc-miR-151-3p is remarkably increased, and the expression amount of ssc-miR-151-3p is increased by 3000 times.
Inhibitors of ssc-miR-151-3p down-regulate the expression of ssc-miR-151-3p in PAM cells. 1.25. mu.L of 100. mu.Msc-miR-151-3 p and an inhibitor of a negative control (CAGUACUUUUGUGUAGUACAA, SEQ ID NO.10, manufactured by Gima) were added to 125. mu.L of LOpti-MEM medium, respectively, and mixed, 1.25. mu.L of Lipofectamine 3000Reagent was added to 125. mu.L of Opti-MEM medium, and mixed, followed by standing at room temperature for 5 minutes; fully and uniformly mixing the diluted inhibitor solution and the liposome solution, and standing for 15 minutes at room temperature; rinsing PAM cells pre-seeded in 12-well plates with Opti-MEM medium, adding the mixture of inhibitor and liposome to each well, adding 747.5 μ L10% BS, shaking gently, and adding 5% CO at 37 deg.C2The incubator of (1) is used for culture. And collecting cells after 24 hours, extracting total miRNA, carrying out reverse transcription, and detecting the expression level of ssc-miR-151-3p by using real-time fluorescent quantitative PCR. As shown in FIG. 3 (negative control and ssc-miR-151-3p inhibitor are transfected in PAM cells respectively, total miRNA of cells is extracted after 24 hours, and real-time fluorescence quantitative PCR result) shows that after the inhibitor of ssc-miR-151-3p is transfected, the expression of ssc-miR-151-3p is obviously reduced.
And increasing the influence of the expression quantity of ssc-miR-151-3p on the reproduction of PRRSV. Transfecting a sac-miR-151-3 p and a negative control simulant by using a PAM cell at a final concentration of 50nM, inoculating the cell with GSWW/2015 at an MOI of 0.5 after 24 hours, harvesting the virus after 24 hours, discarding the supernatant, collecting the cell, and extracting total RNA by using a Qiagen RNeasy Mini Kit; reverse transcription is carried out by utilizing a kit (RR036A) of Takara bioengineering (Dalian) Co., Ltd, then the expression level of PRRSV ORF6 is determined by real-time fluorescent quantitative PCR, and the relative expression level of PRRSV ORF6 mRNA is calculated by taking GAPDH as an internal reference. The sequences of the upstream primer and the downstream primer of PRRSV ORF6 are respectively shown in sequence table SEQ ID No.6(CGGCAAATGATAACCACGC and SEQ ID No.7 (TTCTGCCACCCAACACGAG)), as shown in FIG. 4 (negative control and ssc-miR-151-3p simulant are respectively transfected in PAM cells, after 24 hours, GSWW/2015 strain is inoculated with MOI of 0.5, total RNA is extracted after 24 hours of infection, and the real-time fluorescent quantitative PCR result shows that the expression quantity of ssc-miR-151-3p is up-regulated, the replication level of PRRSV is reduced, and the ssc-miR-151-3p has the function of inhibiting the replication of PRRSV.
The influence of the expression quantity of the ssc-miR-151-3p on the reproduction of the PRRSV is reduced. Transfecting a PAM cell with ssc-miR-151-3p and an inhibitor of a negative control at a final concentration of 25nM, inoculating GSWW/2015 with a MOI of 0.5 after 24 hours, harvesting viruses after 24 hours, and extracting total RNA by using a Qiagen RNeasy Mini Kit; the copy number of PRRSV virus is determined by absolute quantitative PCR with kit (RR064A) of Baoji bioengineering (Dalian) Co., Ltd, and the PRRSV probe sequence is shown in sequence table SEQ ID NO.8 (TGTGCCGTTRACCGTAGTGGAGCC). As shown in fig. 5 (negative control and ssc-miR-151-3p inhibitor were transfected in PAM cells, respectively, after 24 hours, GSWW/2015 strain was inoculated with MOI of 0.5, total RNA was extracted 24 hours after infection, real-time fluorescence quantitative PCR results) the expression of ssc-miR-151-3p was down-regulated, and the replication level of PRRSV was increased. The ssc-miR-151-3p is suggested to have the function of inhibiting virus replication.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Lanzhou veterinary research institute of Chinese academy of agricultural sciences
Application of <120> ssc-miR-151-3p in preparation of medicine for regulating porcine reproductive and respiratory syndrome virus replication
<160>10
<170>SIPOSequenceListing 1.0
<210>1
<211>22
<212>RNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
cuagacugaa gcuccuugag ga 22
<210>2
<211>22
<212>RNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
uccucaagga gcuucagucu ag 22
<210>3
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
cctagactga agctccttga gga 23
<210>4
<211>17
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
ctcgcttcgg cagcaca 17
<210>5
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
aacgcttcac gaatttgcgt 20
<210>6
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
cggcaaatga taaccacgc 19
<210>7
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
ttctgccacc caacacgag 19
<210>8
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
tgtgccgttr accgtagtgg agcc 24
<210>9
<211>21
<212>RNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
uuguacuaca caaaaguacu g 21
<210>10
<211>21
<212>RNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
caguacuuuu guguaguaca a 21

Claims (2)

  1. The application of ssc-miR-151-3p in preparing a medicament for regulating the replication of porcine reproductive and respiratory syndrome virus, wherein the nucleotide sequence of the ssc-miR-151-3p is shown in SEQ ID No. 1.
  2. 2. Application of a substance for up-regulating ssc-miR-151-3p expression in preparation of a medicament for antagonizing porcine reproductive and respiratory syndrome virus replication, wherein a nucleotide sequence of ssc-miR-151-3p is shown as SEQ ID No. 1.
CN202010729745.7A 2020-07-27 2020-07-27 Application of ssc-miR-151-3p in preparation of medicine for regulating replication of porcine reproductive and respiratory syndrome virus Active CN111840310B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010729745.7A CN111840310B (en) 2020-07-27 2020-07-27 Application of ssc-miR-151-3p in preparation of medicine for regulating replication of porcine reproductive and respiratory syndrome virus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010729745.7A CN111840310B (en) 2020-07-27 2020-07-27 Application of ssc-miR-151-3p in preparation of medicine for regulating replication of porcine reproductive and respiratory syndrome virus

Publications (2)

Publication Number Publication Date
CN111840310A true CN111840310A (en) 2020-10-30
CN111840310B CN111840310B (en) 2021-11-26

Family

ID=72947129

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010729745.7A Active CN111840310B (en) 2020-07-27 2020-07-27 Application of ssc-miR-151-3p in preparation of medicine for regulating replication of porcine reproductive and respiratory syndrome virus

Country Status (1)

Country Link
CN (1) CN111840310B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115068611A (en) * 2022-06-24 2022-09-20 天津市农业科学院 Application of ssc-miR-374b-3p in preparation of PDCoV proliferation resistant medicine
CN115161321A (en) * 2022-06-24 2022-10-11 天津市农业科学院 Application of ssc-miR-30c-3p in preparation of PDCoV proliferation-resistant medicine

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102573856A (en) * 2009-09-10 2012-07-11 弗莱明·韦林 Method for the preparation of micro-RNAand its therapeutic application
EP2559442A1 (en) * 2010-04-13 2013-02-20 Jiangsu Mingma Biotech Co., Ltd Method for regulating microrna content in organisms and uses thereof
CN107586780A (en) * 2017-10-25 2018-01-16 中国农业科学院兰州兽医研究所 A kind of long-chain non-coding RNA for suppressing porcine reproductive and respiratory syndrome virus

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102573856A (en) * 2009-09-10 2012-07-11 弗莱明·韦林 Method for the preparation of micro-RNAand its therapeutic application
EP2559442A1 (en) * 2010-04-13 2013-02-20 Jiangsu Mingma Biotech Co., Ltd Method for regulating microrna content in organisms and uses thereof
CN107586780A (en) * 2017-10-25 2018-01-16 中国农业科学院兰州兽医研究所 A kind of long-chain non-coding RNA for suppressing porcine reproductive and respiratory syndrome virus

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
SUN O. PARK等: "TGF-b and Iron Differently Alter HBV Replication in Human Hepatocytes through TGF-b/BMP Signaling and Cellular MicroRNA Expression", 《PLOS ONE》 *
林德麟等: "乳中miRNA的研究进展", 《畜牧兽医学报》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115068611A (en) * 2022-06-24 2022-09-20 天津市农业科学院 Application of ssc-miR-374b-3p in preparation of PDCoV proliferation resistant medicine
CN115161321A (en) * 2022-06-24 2022-10-11 天津市农业科学院 Application of ssc-miR-30c-3p in preparation of PDCoV proliferation-resistant medicine
CN115068611B (en) * 2022-06-24 2023-04-18 天津市农业科学院 Application of ssc-miR-374b-3p in preparation of PDCoV proliferation resistant medicine

Also Published As

Publication number Publication date
CN111840310B (en) 2021-11-26

Similar Documents

Publication Publication Date Title
CN111840310B (en) Application of ssc-miR-151-3p in preparation of medicine for regulating replication of porcine reproductive and respiratory syndrome virus
CN111154763B (en) Application of long-chain non-coding RNA lncMGPF in regulation and control of pig muscle development function
CN111904973B (en) Application of ssc-miR-122 in preparation of medicine for regulating replication of porcine reproductive and respiratory syndrome virus
CN107828788B (en) Application of lncRNA related to PRRSV infection and siRNA thereof in inhibiting virus replication
CN104531700A (en) shRNA sequence for suppressing mouse MACF1 gene expression and application thereof
CN113416768B (en) Application of PRKRA gene as target in inhibiting replication of peste des petits ruminants virus
CN101928782A (en) Kit for simultaneously detecting classical strains and variant strains of porcine reproductive and respiratory syndrome virus and detection method thereof
Najib et al. Viral hemorrhagic septicemia virus (VHSV) infection-mediated sequential changes in microRNAs profile of Epithelioma papulosum cyprini (EPC) cells
CN111676222A (en) shRNA for inhibiting Mettl3 gene expression, recombinant adeno-associated virus thereof and application thereof
CN108324727B (en) Application of miR-1307 or precursor thereof in preparation of composition for preventing and/or treating foot-and-mouth disease virus infection
US9909127B2 (en) Inhibitor for inhibiting avian influenza virus and a pharmaceutical composition containing the same
CN115161321B (en) Application of ssc-miR-30c-3p in preparation of PDCoV proliferation-resistant medicine
CN110468130A (en) Influenza long-chain non-coding RNA-lnc330 and its application
Fang et al. Design of miRNA sponges for MDV-1 as a therapeutic strategy against lymphomas
Xie et al. Dietary supplementation of exopolysaccharides from Lactobacillus rhamnosus GCC-3 improved the resistance of zebrafish against spring viremia of carp virus infection
CN114262717A (en) Method for regulating and controlling PCV2 to replicate in host cell and application
CN102965372A (en) SiRNA interfering GDF9 gene expression and application thereof
CN110904056A (en) Infectious bronchitis virus rH120-YZS1 delta 5a and construction method and application thereof
CN108210497B (en) Application of compound MLN4924 in preparation of bunyaviridae phlebovirus inhibitor
CN111110828A (en) Application of duck-origin natural immunomodulatory protein DDX3X
Luo et al. Porcine reproductive and respiratory syndrome virus infection induces microRNA novel-216 production to facilitate viral-replication by targeting MAVS 3´ UTR
Gao et al. MiR-361 and miR-34a suppress foot-and-mouth disease virus proliferation by activating immune response signaling in PK-15 cells
CN116694636A (en) HNRNPA3 gene affecting PEDV replication and application thereof
CN109628450B (en) RXR beta gene and application of siRNA thereof
CN116942693A (en) Medicine for preventing and treating myocarditis caused by CVB3 virus and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant