CN110468130A

CN110468130A - Influenza long-chain non-coding RNA-lnc330 and its application

Info

Publication number: CN110468130A
Application number: CN201910733059.4A
Authority: CN
Inventors: 谷宏婧; 王希良; 程晋霞; 杨晓岚; 赵忠鹏
Original assignee: Institute of Pharmacology and Toxicology of AMMS
Current assignee: Institute of Pharmacology and Toxicology of AMMS; Academy of Military Medical Sciences AMMS of PLA
Priority date: 2019-08-09
Filing date: 2019-08-09
Publication date: 2019-11-19
Anticipated expiration: 2039-08-09
Also published as: CN110468130B

Abstract

The invention discloses influenza long-chain non-coding RNA-lnc330 and its applications.The present invention provides long-chain non-coding RNAs, are following any: SEQ ID No.3 or SEQ ID No.4 or substitution, deletion and/or addition or 99%, 95%, 90%, 85% or 80% or more the homology of tool by its nucleotide through one or several residues and the RNA for having identical function.LncRNA-330 is cloned, over-express vector is constructed, A549, MDCK is transfected, passes through TCID₅₀And hemagglutination test, it was demonstrated that overexpression can reduce Virus reproductivity.Furthermore after being overexpressed LncRNA-330 tri- days in Mice Body using adenovirus relevant carriers, collunarium influenza virus infection, it was demonstrated that the mouse lung of overexpression and the virus load in Nasopharyngeal swabs reduce.The present invention can be used as a kind of potential anti-influenza virus medicament for the long-chain non-coding RNA of influenza autogene NA design.

Description

Influenza long-chain non-coding RNA-lnc330 and its application

Technical field

The present invention relates to viral fields, and in particular to influenza long-chain non-coding RNA-lnc330 and its application.

Background technique

It is well known that influenza (influenza) is caused by influenza virus, popular one kind in worldwide Seriously endanger the respiratory disease of human health.The World Health Organization (WHO) estimation is seriously exhaled as caused by influenza virus every year Inhaling tract disease, there are about 300-500 ten thousand, and have about 25~500,000 death.In addition, influenza virus is since the last century complete It has broken out in world wide and has repeatedly been very popular, including H1N1 epidemic situation is broken out in Spain in 1918, H2N2 epidemic disease is broken out in nineteen fifty-seven Asia Feelings, nineteen sixty-eight Hong Kong outburst H3N2 epidemic situation, Mexico's outburst H1N1 epidemic situation in 2009, the H7N9 epidemic situation of the outburst of China in 2013, Cause a large amount of mankind's injures and deaths and economic loss^[2].New H7N9 epidemic disease has been broken out again in the end of the year in 2016 to 2017 beginning of the year China Feelings, the end of the year 2017 to the beginning of this year China so that the whole world again broken out Flu-A and influenza B mixing Influenza epidemic situation.According to The data of Chinese Center for Disease Control and Prevention show, this year influenza disease incidence be past three year average data 2 times or more, I State's virus monitor is the results show that Influenza A H1N1 in this year and Type B (Yamagata) are all advantage strain, H3N2 hypotype and Type B (Victoria) jointly popular with low-level.Therefore, influenza has become a kind of propagated extremely strong " killer ", and influenza virus causes Epidemic disease massive losses are come to public health and economy-zone, and will persistently bring harm, even potential bio-terrorism War agent, this has beaten alarm bell for us, and the situation of influenza prevention and control is still abnormal severe.

Influenza virus is a kind of single minus-stranded rna virus for belonging to orthomyxovirus section, be divided into A type (A type), B-mode (Type B) and 3 kinds of third type (c-type).Influenza A virus (Influenza A virus, IAV) is according to its viral surface glycoprotein hemagglutinin (HA) and the difference of neuraminidase (NA) 16 H hypotypes (H1-H16) and 9 N hypotypes (N1-N9) can, be further divided into.First Type influenza virus since its hemagglutinin (HA) and neuraminidase (NA) easily morph (antigenic drift and antigen transfer), It has broken out in worldwide is repeatedly very popular^[3].Due to the variation property of influenza A virus, there are currently no for stream The general vaccine of Influenza Virus, and influenza vaccines in the market are because the easy variability and fast propagation of influenza are on using and preventing There are great limitations.Although currently on the market about anti-influenza virus medicament, these drugs are broadly divided into M2 inhibitor (amantadine and Rimantadine), NA inhibitor (zanamivir, Oseltamivir, Peramivir, sad La Ni meter Wei), virus RNA polymerase inhibitor (Ribavirin and Favipiravir), but due to the variability of Flu-A, be easy resistance to these drugs By, and this kind of side effects of pharmaceutical drugs are larger.Once breaking out novel variant influenza, lack effective control means at present.Therefore, The drug target for finding new treatment influenza is imperative.

LncRNA is that a kind of length is greater than 200nt, the RNA without code capacity.It is similar to mRNA, most lncRNA by Rna plymerase ii transcription, 5 ' ends are capped, 3 ' ends have ployA tail, have exon.According to the adjacent mRNA's of lncRNA Position, lncRNA be divided into again lincRNA, intronic lncRNA, sense lncRNA, antisense lncRNA, Enhancer RNA, bidirectional lncRNAs, pseudogene lncRNA etc..GENCODE database has been infused at present The lncRNA in 15787 human genomes is released, however most lncRNA function is all unclear.In recent years, increasingly More report discovery lncRNA play important adjustment effect in the occurrence and development of a variety of life processes and disease, such as dry thin Occurrence and development and transfer, the differentiation of immunocyte and the immune response regulation, gene imprinting code of the versatility and differentiation tumor of born of the same parents Some functional small peptides play adjusting function.

It has now been found that a variety of lncRNA play important adjustment effect during host anti-virus.LncRNA first It can directly be acted on virus.On the one hand, the inducible host of virus generates lncRNA and helps viral self-replication and infection body.Such as IAV (H1N1, H3N2, H7N7) and VSV can stimulate human squamous lung cancer lincRNA VIN high to express, and promote answering for virus itself The synthesis of system and virus protein.On the other hand, the generation of some lncRNA can be done directly on virus in turn in virus infection Important adjusting function is played in host anti-virus effect.As lncRNA 7SL can be by the core of the packaging of selectivity to HIV-I In ribonucleoprotein complex, and 7SL as a bracket in combination with viral Gag protein, viral RNA and cytidine deaminase APOBEC3G, APOBEC3G are bound to the duplication that viral ribonucleoprotein inhibits HIV by the connection targeting of 7SL.Secondly, LncRNA can be by adjusting the migration of transcription factor and the expression of activity, IFN and cell factor, the transcription of ISGs and immunocyte The bioprocess such as differentiation regulate and control antivirus action.If LncRNA (NKILA) after NF κ B activation by raising, I κ can be bound to B closes its phosphorylation site, and then inhibits the activation of NF κ B, forms negative-feedback circulation, inhibits the excessive activation of NF κ B.Cao Xuetao Academician seminar finds lnc-DC by binding directly STAT3 in cytoplasm, by inhibiting the combination of STAT3 and SHP1 to promote The phosphorylation of STAT3, and then promote the differentiation of DC cell；Multinomial research discovery lincRNA-Cox2 participation has adjusted panimmunity The regulation of related gene, including pattern recognition receptors (TLR1), chemotactic factor (CF) (IL-6, IL-23, CCL5), chemokine receptors (CCR1) and ISGs (IRF7, IFI204, ISG15).The report such as Carpenter lincRNA-Cox2 does not influence it and closes on gene COX2, but its expression expressed while enhancing IL-6 by combining hnRNP A/B and hnRNP A2/B1 inhibition CCL5；Chen Ji Imperial seminar discovery lncRNA NRAV exhales intestines lonely in a variety of viruses such as IAV, sendai virus (Sendai virus, SEV), a kind duck Viral (Muscovy duck reovirus, MDRV), after herpes simplex virus (herpes simplex virus, HSV) stimulation Significant low expression, the histone modification by influencing ISGs inhibit a variety of ISGs such as MxA, IFITM3, IFIT2, IFIT3, The expression of OASL.

LncRNA is the very swift and violent non-coding RNA of a kind of Recent study progress, since its length is longer (> 200nt), And many lncRNA have conservative secondary structure, cut mode and subcellular localization, so work of the lncRNA unlike miRNA It is mainly targeted by way of base pair complementarity with mode and is incorporated into target gene and then regulates and controls its transcription or translation, effect side Formula is varied, mainly there is the following aspects: 1, it can act on the upstream promoter area for closing on gene, pass through inhibition The recruitment of rna plymerase ii induces chromosome remodeling, inhibits or enhance its expression for closing on gene；2, lncRNA can be used as instead Adopted RNA is combined by complementary with encoding transcription sheet, the shearing of mRNA is influenced, to generate different spliced bodies；3, length compared with Long lncRNA can be used as the precursor of tiny RNA, generate tiny RNA under the action of Drosha enzyme and Dicer enzyme, as siRNA, MiRNA and piRNA etc.；4, by and protein specificity combination, influence the function of albumen, or formed as structural constituent RNA- protein complexes, and the subcellular localization etc. by specific binding influence albumen；5, lncRNA can be used as " molecule sea It is continuous " competitive binding transcription factor, miRNA etc., to inhibit transcription factor or the function of miRNA；6, some lncRNA can lead to Coding small peptide is crossed to play specific function.

Summary of the invention

The object of the present invention is to provide a kind of influenza long-chain non-coding RNA-lnc330 and its applications.

In a first aspect, a kind of claimed long-chain non-coding RNA.

Present invention long-chain non-coding RNA claimed, concretely following any:

(a1) RNA shown in SEQ ID No.3；

(a2) RNA shown in SEQ ID No.4；

(a3) nucleotide sequence shown in SEQ ID No.3 or SEQ ID No.4 is residual by one or several nucleotide The substitution and/or deletion and/or addition of base and RNA with the same function；

(a4) with (a1) or (a2) or (a3) defined by nucleotide sequence have 99% or more, 95% or more, 90% with Above, 85% or more or 80% or more homology and RNA with the same function.

Second aspect, claimed long-chain non-coding RNA described in first aspect above of capable of being transcribed into DNA。

Further, the DNA it is concretely following in it is any:

(b1) DNA shown in SEQ ID No.1；

(b2) DNA shown in SEQ ID No.2；

(b3) nucleotide sequence shown in SEQ ID No.1 or SEQ ID No.2 is residual by one or several nucleotide The substitution and/or deletion and/or addition of base and DNA with the same function；

(b4) with (b1) or (b2) or (b3) defined by nucleotide sequence have 99% or more, 95% or more, 90% with Above, 85% or more or 80% or more homology and DNA with the same function.

The third aspect, claimed containing long-chain non-coding RNA described in first aspect above or above second Expression cassette, recombinant vector or the recombinant bacterium of DNA described in aspect.

Wherein, the expression cassette is made of promoter, the DNA and transcription terminator.The recombinant vector can attach most importance to Group expression vector or recombinant cloning vector.

Fourth aspect, long-chain non-coding RNA described in claimed first aspect above or above second party DNA described in face or above expression cassette described in the third aspect, recombinant vector or recombinant bacterium it is following it is any in application:

(A1) resisiting influenza virus product is prepared；

(A2) resisiting influenza virus.

In a specific embodiment of the invention, the resisiting influenza virus is embodied as preventative resisiting influenza virus.

5th aspect, long-chain non-coding RNA described in claimed first aspect above or above second party DNA described in face or above expression cassette described in the third aspect, recombinant vector or recombinant bacterium it is following it is any in application:

(B1) preparation can prevent and/or treat the product of influenza infection；

(B2) prevent and/or treat influenza infection.

6th aspect, long-chain non-coding RNA described in claimed first aspect above or above second party DNA described in face or above expression cassette described in the third aspect, recombinant vector or recombinant bacterium it is following it is any in application:

(C1) preparation is able to suppress the product of influenza virus duplication, or inhibits influenza virus duplication；

(C2) preparation can help host to remove the product of influenza virus, or host is helped to remove influenza virus；

(C3) preparation can reduce the product of the acute lung injury of influenza virus mediation, or mitigate the urgency that influenza virus mediates Property injury of lungs；

(C4) preparation can reduce the product of weight loss caused by influenza infection, or mitigates influenza infection and draw The weight loss risen；

(C5) preparation can reduce the product of the death rate caused by influenza infection, or to reduce influenza infection institute lethal Die rate.

In a specific embodiment of the invention, (C1)-(C5) described application is prophylactic use.(C1) described in Inhibit influenza virus duplication that can withdraw deposit and inhibits influenza virus duplication for cellular level and/or animal level.

7th aspect, a kind of claimed product.

Present invention product claimed, effective component are long-chain non-coding RNA described in first aspect above； The product has at least one of following function:

(D1) resisiting influenza virus；

(D2) prevent and/or treat influenza infection；

(D3) inhibit influenza virus duplication；

(D4) host is helped to remove influenza virus；

(D5) mitigate the acute lung injury that influenza virus mediates；

(D6) mitigate weight loss caused by influenza infection；

(D7) death rate caused by influenza infection is reduced.

Eighth aspect, a kind of claimed product.

Present invention product claimed, containing DNA described in second aspect above or above institute in the third aspect State expression cassette, recombinant vector or recombinant bacterium；The product has at least one of following function:

(D1) resisiting influenza virus；

(D2) prevent and/or treat influenza infection；

(D3) inhibit influenza virus duplication；

(D4) host is helped to remove influenza virus；

(D5) mitigate the acute lung injury that influenza virus mediates；

(D6) mitigate weight loss caused by influenza infection；

(D7) death rate caused by influenza infection is reduced.

In a specific embodiment of the invention, function shown in (D3)-(D7) is prevention sexual function.

In the present invention, the acute lung injury for mitigating influenza virus mediation can be specifically presented as following any: be mitigated Inflammatory pulmonary cellular infiltration caused by influenza infection, pulmonary edema degree caused by mitigation influenza infection are (wet dry with lung Than characterization).

In above-mentioned various aspects, the influenza virus is H1N1 subtype influenza virus, H3N2 subtype influenza virus, the Asia H7N9 Type influenza virus or H5N1 subtype influenza virus.

In a specific embodiment of the invention, the H1N1 subtype influenza virus is specially A/Beijing/501/2009 Strain or A/California/07/2009 strain；The H3N2 subtype influenza virus is specially A/Singapore/INFIMH- Strain；The H7N9 subtype influenza virus is specially A/Anhui/1/2013 strain；The H5N1 hypotype stream Influenza Virus is specially A/Jiangsu/1/2007.

The present invention obtains the difference expression gene for being derived from influenza virus long-chain non-coding RNA by deep sequencing, by PCR Verifying, it was demonstrated that the long-chain non-coding RNA objective reality of a targeting influenza virus NA is named as lnc330.Clone LncRNA-330 constructs over-express vector, transfects A549, MDCK, passes through TCID₅₀And hemagglutination test, it was demonstrated that be overexpressed LncRNA- 330 reduce Virus reproductivity.Furthermore after being overexpressed LncRNA-330 tri- days in Mice Body using adenovirus relevant carriers, drop Nose influenza virus infection, it was demonstrated that the mouse lung of overexpression and the virus load in Nasopharyngeal swabs reduce.The present invention is directed to influenza The long-chain non-coding RNA of autogene NA design can be used as a kind of potential anti-influenza virus medicament.

Detailed description of the invention

Fig. 1 is to predict LncRNA 330 (SEQ ID No.1 and SEQ using Coding Potential Calculator ID No.2) code capacity schematic diagram.A is SEQ ID No.1 code capacity prediction result；B is SEQ ID No.2 code capacity Prediction result.

Fig. 2 is that LncRNA 330 (SEQ ID No.1 and SEQ ID No.2) structural schematic diagram is predicted using sfold.A is SEQ ID No.1 structure and abundance schematic diagram；B is SEQ ID No.2 structure and abundance schematic diagram.

Fig. 3 is using PCR amplification LncRNA330.Swimming lane 1-10 is respectively different clones after PCR product connection carrier T.

Fig. 4 is that RACE method obtains Lnc330 overall length schematic diagram.

Fig. 5 is BJ501 according to different MOI infection A549, MDCK and CNE-2Z, 24 hours duplication situations of Real_time quantitative detection Schematic diagram.

Fig. 6 is that real-time quantitative PCR detects Lnc330 influenza copy detection in different cell lines.pcDNA3.1 Medium Indicate transfection carrier plasmid pcDNA3.1 (+) uninfecting virus group；PcDNA3.1-lnc330 Medium indicates that transfection is overexpressed Plasmid pcDNA3.1-lnc330 uninfecting virus group；PcDNA3.1 BJ501 indicates transfection carrier plasmid pcDNA3.1 (+) infection Viral group；PcDNA3.1-lnc330 BJ501 indicates that transfection is overexpressed plasmid pcDNA3.1-lnc330 BJ501 virus infection Group.

Fig. 7 is that TCID50 detects Lnc330 influenza duplication situation in different cell lines.PcDNA3.1 BJ501 indicates to turn Contaminate vector plasmid pcDNA3.1 (+) virus infection group；PcDNA3.1-lnc330 BJ501 indicates that transfection is overexpressed plasmid PcDNA3.1-lnc330 BJ501 virus infection group.

Fig. 8 is that real-time quantitative PCR detects Lnc330 different strains of influenza viruses duplication situation schematic diagrams in A549 cell. PcDNA3.1 infection indicates transfection carrier plasmid pcDNA3.1 (+) virus infection group；pcDNA3.1-lnc330 Infection indicates that transfection is overexpressed plasmid pcDNA3.1-lnc330 BJ501 virus infection group.

Fig. 9 is that TCID50 detects Lnc330 different strains of influenza viruses duplication situation schematic diagrams in A549 cell. PcDNA3.1 infection indicates transfection carrier plasmid pcDNA3.1 (+) virus infection group；pcDNA3.1-lnc330 Infection indicates that transfection is overexpressed plasmid pcDNA3.1-lnc330 BJ501 virus infection group.

Figure 10 is changes of weight after mouse infection BJ501 plants of influenza virus.CTL, MOCK indicate the unloaded adenovirus of injection, not Infected group；Lnc330, MOCK indicate that injection is overexpressed Lnc330 adenovirus, are uninfected by group；CTL, BJ501 indicate to inject unloaded gland Virus infects BJ501 group；Lnc330, BJ501 indicate to be overexpressed Lnc330 adenovirus, infection BJ501 group.

Figure 11 is the death rate after mouse infection BJ501 plants of influenza virus.CTL, MOCK are indicated to inject unloaded adenovirus, not felt Dye group；Lnc330, MOCK indicate that injection is overexpressed Lnc330 adenovirus, are uninfected by group；CTL, BJ501 indicate to inject unloaded adenopathy Poison infects BJ501 group；Lnc330, BJ501 indicate to be overexpressed Lnc330 adenovirus, infection BJ501 group.

Figure 12 is lung pathologies after mouse infection BJ501 plants of influenza virus.

Figure 13 is inflammatory pulmonary cellular infiltration counting after mouse infection BJ501 plants of influenza virus.CTL, MOCK indicate injection Unloaded adenovirus, is uninfected by group；Lnc330, MOCK indicate that injection is overexpressed Lnc330 adenovirus, are uninfected by group；CTL,BJ501 It indicates to inject unloaded adenovirus, infects BJ501 group；Lnc330, BJ501 indicate to be overexpressed Lnc330 adenovirus, infection BJ501 Group.

Figure 14 is lung's wet-dry ratio after mouse infection BJ501 plants of influenza virus.CTL, BJ501 indicate to inject unloaded adenopathy Poison infects BJ501 group；Lnc330, BJ501 indicate to be overexpressed Lnc330 adenovirus, infection BJ501 group.

Figure 15 is lungs virus titer after mouse infection BJ501 plants of influenza virus.CTL, MOCK indicate to inject unloaded adenopathy Poison is uninfected by group；Lnc330, MOCK indicate that injection is overexpressed Lnc330 adenovirus, are uninfected by group；CTL, BJ501 indicate injection Unloaded adenovirus infects BJ501 group；Lnc330, BJ501 indicate to be overexpressed Lnc330 adenovirus, infection BJ501 group.

Specific embodiment

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

1, experimental animal

4 week old wild type C57BL/6 of SPF grade (wild-type mice, WT, weight 10-12g) is purchased from as tonneau China public affairs Department, for experimental animal feeding in animal center SPF grades of environment of Military Medical Science Institute, all related experiments pass through military medicine The audit of the animal welfare committee, the academy of sciences.

2, cell line

Experiment A549 cell line used, mdck cell system and CNE-2Z cell line are ATCC product, deposit in military affairs Medical Research Institute's microorganism epidemic research infects and immune Research room.MDCK and CNE-2Z cell culture is in DMEM (Hyclone) culture medium, A549 are incubated at DMEM/F12 (Hyclone) culture medium, and trypsase used in vitellophag is purchased from Gibco company is configured to final concentration of 0.25% pancreatin, wherein containing 2%EDTA, through 0.22 μm of membrane filtration degerming.

3, Strain

H1N1virus strain used in the present invention is BJ501 plants (A/Beijing/501/2009), H3N2 (A/ Singapore/INFIMH-16-0019/2016)、H7N9(A/Anhui/1/2013)、H1N1(A/California/07/ 2009), H5N1 (A/Jiangsu/1/2007) seed culture of viruses is provided by Microbiology and Epidemic Disease Inst., Academy of Military-Medical Sciences's virus base. H1N1 strains of influenza viruses is inoculated in SPF grades of chicken embryos of 9-11 age in days, expands and establishes virus base and is stored in -80 DEG C of laboratory.Virus Titre infects half lethal dose by mdck cell and calculates (Reed-Muench method).In the present invention it is all be related to virus Experiment carries out in bio-safety second level laboratory.

4, expression vector

PcDNA3.1 (+) is saved by laboratory.

5, major experimental related reagent

(1) restriction endonuclease (EcoR I, BamHI) all used in expression vector establishment and plasmid linearization It is NEB Products, T4 ligase and PMD-19T are Takara Products；

(2) for plastic recovery kit to be Products up to section, endotoxin-free plasmid extracts kit is the production of QIAGEN company Product；

(3) 6 × DNA loading Buffer are purchased from GenStar, and Trans 2K plus DNA Ladder is Quan Shijin Product；

(4) it is PolyPlus company that transfection reagent used in transfected plasmids, which is jetPRIME Transfection Regent, Product；

(5) other reagents are commodity at Military Medical Science Institute's condition.

6, key instrument and equipment

(1) carbon dioxide incubator (SANYO GS)

(2) electric-heated thermostatic water bath (the long bearing device in Beijing)

(3) low-temperature and high-speed centrifuge (Sigma)

(4)NanoDrop 2000(Thermo)

(5) 7500 real-time PCR of ABI (ABI)

(6) Biohazard Safety Equipment (Scientific Visions Inc)

(7) superclean bench X90-3 (Beijing is big to reach purification techniques research institute)

(8) refrigerator and ultra low temperature freezer (Haier)

(9) electronic analytical balance (Sartorius)

7, bioinformatic analysis software

(1) UCSC database (http://genome.ucsc.edu/)

(2) Ensembl database (http://grch37.ensembl.org/)

(3)Coding Potential Calculator(http://cpc.cbi.pku.edu.cn/programs/ run_cpc.jsp)

(4)sfold(http://sfold.wadsworth.org/)

8, statistical analysis

GraphPad Prism5 (GraphPad Software, San Diego, CA, USA) is used after all data statistics Software mapping analysis, data statistics are expressed as mean+SD, and the difference analysis between two groups is examined using t, Dan Yin The multilevel experiment statistics of element use one-way analysis of variance (ANOVA), and animal survival rate uses Kaplan-Meier survival analysis.All experiments are repeated three times, and significant difference is expressed as * P < 0.05, P < 0.001 * * P < 0.01, * * *.

Embodiment 1, the discovery of influenza long-chain non-coding RNA-lnc330 and property determine

One, experimental method

1, BJ501 virus infects A549 cell according to MOI=0.1, collects within 24 hours after infection sample, extracts RNA, equally The A549 cell for collecting control group uninfecting virus send Hua Da gene to carry out transcript profile sequencing (10G data/sample).Through transcribing Group data representation analysis, discovery have 2 long-chain non-coding RNAs for being derived from influenza NA gene, length 330nt.

2, viral RNA extracts and reverse transcription PCR is tested

(1) TRIzol is added in the sample (BJ501 virus) of harvest according to specification and mixed, act on 10 points in room temperature Clock；

(2) 200 μ l chloroforms are added in every 1ml TRIzol liquid, is vortexed and mixes, be stored at room temperature 3-5 minutes, 13000g, 4 DEG C Centrifugation, 15 minutes；

(3) supernatant is transferred in new EP pipe, 500 μ l isopropanols is added, mixing of gently turning upside down is stored at room temperature 10 Minute, 12000g, 4 DEG C of centrifugations, 10 minutes；

(4) it discards supernatant, is resuspended and is precipitated with 75% ethyl alcohol, 7500g, 4 DEG C of centrifugations, 5 minutes；

(5) it discards supernatant, precipitating is statically placed in draught cupboard and is air-dried；

(6) with a certain amount of RNase Free dH₂O dissolves RNA precipitate, by specification RNase-Free DNase I (Promega) digestion postgenome quantifies RNA using NANO DROP；

(7) by reverse transcription reagent box (TransScript First-Strand cDNA Synthesis SuperMix, entirely Formula gold, article No. AT301-03) RNA reverse transcription is cDNA by specification and reagent；

(8) according to following respective reaction system RT-PCR or PCR amplification target gene；

1 RT-PCR reaction system of table

2 PCR reaction system of table

Primer in table 1 is the included primer of kit.Primer in table 2:

Lnc330 upstream primer: 5 '-TTACTTGTCAATGGTAAATGGC-3 '；

Lnc330 downstream primer: 5 '-ATGAATCCAAACCAAAAGATAAT-3 '.

3,5 ' and 3 ' RACE (Rapid amplification of cDNA ends) are tested

(1) (A549 of BJ501 influenza strain influenza infection is thin for cell sample collection and the same first part of RNA extraction Born of the same parents), 75% alcohol is washed twice, and 80% alcohol is washed once, and 7500g is centrifuged 5min, discards alcohol, is dried EP and is managed interior residual alcohol Afterwards, 20 μ l RNase-free H are added in each sample₂O。

RACE test is the SMARTer@kit of the RACE5 '/3 ' clontech of Clontech Laboratories company: 634858。

(2) DNA in RNA sample is removed:

A) 0.1 volume 10 × TURBO DNase Buffer and 1 μ l TURBO DNase is added into RNA in each sample, It mixes gently, 37 DEG C of incubation 20-30min；

B) the Resuspended DNase Inactivation Regent (at least 2 μ l) of 0.1 volume is added, gently mixes Even, room temperature (if being lower than 22-26 DEG C, moves to and maintains temperature in metal bath), is incubated for 5min, is incubated among process or mixes；

C) 10000g is centrifuged 2min, supernatant (RNA) is transferred in new EP pipe；

(3) RNA sample reverse transcription:

A) RNA sample reverse transcription is carried out according to following reaction system:

Above-mentioned system is mixed, centrifugal liquid to tube bottom, 72 DEG C of 3min, 42 DEG C of 2min, 14000g centrifugate after incubation Body is to tube bottom；

B) for 5 ' RACE systems, 1 μ l SMARTER, II A oligonucleotide is added in each system；

C) remaining reaction system is prepared:

5×First-Strand buffer	4μl
		DTT(100nM)	0.5μl
dNTP(20nM)	1μl
		Rnase Inhibitor(40U/μl)	0.5μl
Smart scribe Recerse Transcriptase	2μl
		Total	8μl

D) the 8 μ l remaining system prepared being added in the system into step b), total volume is 20 μ l, and piping and druming mixes, from Heart liquid is to bottom；

E) 42 DEG C of 90min, 70 DEG C of 10min carry out reverse transcription in PCR instrument；

F) 10 μ l Tricine- are added in the cDNA obtained using Tricine-EDTA Buffer dilution reverse transcription, every pipe EDTA Buffer.Sample be placed in -20 DEG C it is spare；

(4)RACE PCR

3 ' RACE GSP1:5 '-CAAATTACTTGTCAATGGTAAATGGC-3 '；

5 ' RACE GSP 1:5 '-ACCATTGGTTCGGTCTGTATG-3 '；

5 ' RACE GSP 2:5 '-GCGCCAGTTCTTCCTAAAAGGAAAG-3 '；

3 ' RACE GSP 2:5 '-GC AAAATGAATCCAAACCAAAAGATAAT-3 '.

Reaction condition:

5cycles:

94℃ 30sec

72℃ 1min

20cycles:

94℃ 30sec

68℃ 30sec

72℃ 1min

Two, experimental result

BJ501 infection A549 cell is subjected to deep sequencing, host (A549) cell expressing gene is excluded, obtains 2 sources In the corresponding DNA sequence dna of long-chain non-coding RNA of influenza virus NA gene, length is that (Lnc RNA sequence is respectively SEQ to 330bp ID No.3 and SEQ ID No.4, corresponding DNA sequence dna are respectively SEQ ID No.1 and SEQ ID No.2).Pass through NCBI sequence Column comparison result show SEQ ID No.1 cover NA gene 1-134,1192-1286,1310-1410, SEQ ID No.2 covers NA gene 1-134,1192-1285,1309-1410.SEQ ID No.2 and SEQ ID No.1 are at 102 It mutates, 102 of SEQ ID No.2 are A, and 102 of SEQ ID No.1 are C.By SEQ ID No.3 and SEQ ID Lnc RNA shown in No.4 is named as Lnc330.

For the fundamental property of these clear RNA, Lnc330 pairs is predicted by Coding Potential Calculator DNA sequence dna SEQ ID No.1 and SEQ the ID No.2 answered passes through sfold net without potential code capacity (A and B in Fig. 1) It stands and predicts the secondary structure (A and B in Fig. 2) of SEQ ID No.1 and SEQ ID No.2.

Using Trizol extract influenza virus RNA, and using following primer (Lnc330 upstream primer: TTACTTGTCAATGGTAAATGGC；Lnc330 downstream primer: ATGAATCCAAACCAAAAGATAAT) carry out PCR amplification acquisition Target fragment (SEQ ID No.1 and SEQ ID No.2), and even T selects monoclonal (Fig. 3), sequence verification aim sequence.

In order to further confirm that the transcription initiation and termination site of Lnc330, we have collected influenza strain influenza infection A549 cell, Lnc330 is cloned using the method for 5 ' and 3 ' RACE, detection is sequenced, it is determined that the overall length sequence of Lnc330 It is classified as 330nt (i.e. SEQ ID No.1 and SEQ ID No.2), and there are 3 ' poly A tails (Fig. 4)

The anti influenza Effect study of embodiment 2, influenza long-chain non-coding RNA-lnc330

One, cellular level is tested

1, pcDNA3.1 (+)-lnc330 expression vector establishment

A) Lnc330 sequence (SEQ ID No.1) is obtained by PCR, by sequencing confirmation overall length correctly without mutation.

B) restriction enzyme site has been added in PCR primer used in, upstream restriction enzyme site is BamHI, and downstream restriction enzyme site is Lnc330 and pcDNA3.1 (+) carrier are carried out double digestion using both restriction enzymes, used after glue recycling by EcoRI T4 ligase is attached, and is converted using DH5 α competent cell, in Amp⁺(ampicillin) solid LB culture plate Upper picking monoclonal colonies are expanded, and are chosen positive bacteria by bacterium solution PCR and are dropped into capable sequencing.

C) it chooses the right-on bacterium solution of sequencing to be expanded, after extracting plasmid using endotoxin-free plasmid extracts kit It saves to -20 DEG C and saves backup.

The structure of pcDNA3.1 (+)-lnc330 expression vector is described as follows: in the restriction enzyme site of pcDNA3.1 (+) carrier The recombinant plasmid obtained after DNA fragmentation shown in SEQ ID No.1 is inserted between BamHI and EcoRI.

2, cell transfecting, virus infection and identification

(1) virus infection infects MDCK, CNE-2Z and A549 cell according to different MOI (0.1,1,3,5,10) respectively. Specific step is as follows:

(a) by MDCK, CNE-2Z and A549 cell according to every hole 5 × 10⁴It is a to be taped against in 24 orifice plates；

(b) after 12 hours, infection solution is prepared according to different MOI (0.1,1,3,5,10), solvent is serum-free DMEM (company Gibco, article No.: 11965-092) is added in the cell that (a) is completed, and is incubated for 1 hour；

(c) the infection solution for discarding incubation is washed twice using PBS (company: Macgene article No.: CC008), discards PBS and wash Liquid；

(d) prepare containing 2% fetal calf serum (company: Gibco, article No.: 15140071) DMEM, it is micro- according to every hole 500 It rises and is added in 24 orifice plates of (c) step.

(e) after infecting 24 hours, 500 microlitres of TriZol is added, are placed at room temperature for 10 minutes；

(f) 100 μ l chloroforms are added, is vortexed and mixes, is stored at room temperature 3-5 minutes, 13000g, 4 DEG C and is centrifuged, 15 minutes；

(g) supernatant is transferred in new EP pipe, 500 μ l isopropanols is added, mixing of gently turning upside down is stored at room temperature 10 Minute, 12000g, 4 DEG C of centrifugations, 10 minutes；

(h) it discards supernatant, is resuspended and is precipitated with 75% ethyl alcohol, 7500g, 4 DEG C of centrifugations, 5 minutes；

(i) it discards supernatant, precipitating is statically placed in draught cupboard and is air-dried；

(j) with a certain amount of RNase Free dH₂O dissolves RNA precipitate, by specification RNase-Free DNase I (Promega) digestion postgenome quantifies RNA using NANO DROP；

(k) by reverse transcription reagent box (TransScript First-Strand cDNA Synthesis SuperMix, entirely Formula gold, article No. AT301-03) RNA reverse transcription is cDNA by specification and reagent；

3 RT-PCR reaction system of table

Utilize TB Green Premix Ex Taq (company's T aKaRa, article No. RR820Q), real-time quantitative PCR purpose piece Section, using 2^-ΔΔtMethod analyzes data.Real-time quantitative PCR reaction system is as follows

4 PCR reaction system of table

Primer used in real-time quantitative PCR are as follows:

GAPDH

Upstream primer: 5'-GGTGGTCTCCTCTGACTTCAACA-3'

Downstream primer: 5'-GTTGCTGTAGCCAAATTCGTTGT-3'

Influenza M

Upstream primer: 5'-AAGACCAATCCTGTCACCTCTG-3'

Downstream primer: 5'-CAAAACGTCTACGCTGCAGTCC-3'

As a result as shown in figure 5, in different cells, after influenza infection 24 hours, the duplication of influenza is with infectious agent Dependence is measured, infection concentration is higher, and duplication amount is higher.

(2) plasmid pcDNA3.1 (+)-lnc330 and vector plasmid pcDNA3.1 is overexpressed with the Lnc330 that step 1 constructs (+) utilizes jetPRIME Transfection Reagent (company: polyplus transfection, article No. Cat No114-07 A549 cell, mdck cell, CNE-2Z cell) are transfected respectively.Transfection 24 hours after, influenza virus B J501 according to The cell of MOI=1 infection transfection.As Fig. 6 is grouped: pcDNA3.1 Medium group is that transfection carrier plasmid pcDNA3.1 (+) does not feel It catches an illness malicious group；PcDNA3.1-lnc330 Medium group is that transfection is overexpressed plasmid pcDNA3.1-lnc330 uninfecting virus group； PcDNA3.1 BJ501 group is transfection carrier plasmid pcDNA3.1 (+) virus infection group；PcDNA3.1-lnc330 Medium group Plasmid pcDNA3.1-lnc330 BJ501 virus infection group is overexpressed for transfection.It is mentioned after infection 24 hours according to above-mentioned grouping Take RNA, the specific steps are as follows:

(a) TRIzol is added in sample and mixes according to specification, acted on 10 minutes in room temperature；

(b) 200 μ l chloroforms are added in every 1ml TRIzol liquid, is vortexed and mixes, be stored at room temperature 3-5 minutes, 13000g, 4 DEG C Centrifugation, 15 minutes；

(c) supernatant is transferred in new EP pipe, 500 μ l isopropanols is added, mixing of gently turning upside down is stored at room temperature 10 Minute, 12000g, 4 DEG C of centrifugations, 10 minutes；

(d) it discards supernatant, is resuspended and is precipitated with 75% ethyl alcohol, 7500g, 4 DEG C of centrifugations, 5 minutes；

(e) it discards supernatant, precipitating is statically placed in draught cupboard and is air-dried；

(f) with a certain amount of RNase Free dH₂O dissolves RNA precipitate, by specification RNase-Free DNase I (Promega) digestion postgenome quantifies RNA using NANO DROP；

(g) by reverse transcription reagent box (TransScript First-Strand cDNA Synthesis SuperMix, entirely Formula gold, article No. AT301-03) RNA reverse transcription is cDNA by specification and reagent；

(h) according to following respective reaction system RT-PCR or PCR amplification target gene；

5 RT-PCR reaction system of table

6 PCR reaction system of table

Internal reference GAPDH

Upstream primer: 5'-GGTGGTCTCCTCTGACTTCAACA-3'

Downstream primer: 5'-GTTGCTGTAGCCAAATTCGTTGT-3'

Influenza M

Upstream primer: 5'-AAGACCAATCCTGTCACCTCTG-3'

Downstream primer: 5'-CAAAACGTCTACGCTGCAGTCC-3'

The expression that influenza M gene and internal reference GAPDH are detected by qPCR, detects the duplication situation of influenza.

As a result as shown in fig. 6, in different cells, Lnc330, the duplication amount drop of the related gene M of influenza are overexpressed It is low.

(3) it is detected using the method for TCID50, being overexpressed Lnc330 cell, (A549 cell, mdck cell, CNE-2Z are thin Born of the same parents) influenza virus titre, and then find Lnc330 whether suppressing virus replication.Specific step is as follows:

(a) by MDCK, CNE-2Z and A549 cell according to every hole 3 × 10⁴It is a to be taped against in 24 orifice plates；

(b) adherent to cell after 12 hours, Lnc330 is overexpressed plasmid pcDNA3.1 (+)-lnc330 and vector plasmid PcDNA3.1 (+) utilizes jetPRIME Transfection Reagent (company: polyplus transfection, article No. Cat No114-07) A549 cell, mdck cell, CNE-2Z cell are transfected respectively.

(c) after transfecting 24 hours, according to MOI=1, virus infection BJ50 is prepared, solvent is the DMEM (company of serum-free Gibco, article No.: 11965-092), it is added in (b) infection, is incubated for 1 hour；

(d) the infection solution for discarding incubation is washed twice using PBS (company: Macgene article No.: CC008), discards PBS and wash Liquid；

(e) prepare containing 2% fetal calf serum (company: Gibco, article No.: 15140071) DMEM, it is micro- according to every hole 500 It rises and is added in 24 orifice plates of (c) step.

(f) after 24 hours, by 24 orifice plate multigelations, 3000rpm is centrifuged 5 minutes, takes supernatant, abandons cell fragment.

(g) supernatant measures virus titer using the method for TCID50.

As a result as shown in fig. 7, infecting the A549 of the A549 for being overexpressed Lnc330 and normal (wild) type, mistake according to MOI=1 The influenza titre average of expression group is 10^2.6, as 398.11, normal infection group is 10^3.23, as 1698.24.Therefore mistake The influenza titre of expression group is the 1/5 of normal group control.In addition, also trial has also been made in MDCK and CNE-2Z cell in we, with The result of A549 is similar, and the influenza titre of overexpression group is substantially less than Normal group.

(4) the other influenza of different shaped transfects A549 cell infection 24 hours, and the expression of related gene, inspection are detected by qPCR The duplication situation of flow measurement sense.

Specific step is as follows:

(a) plasmid pcDNA3.1 (+)-lnc330 and vector plasmid pcDNA3.1 is overexpressed with the Lnc330 that step 1 constructs (+) utilizes jetPRIME Transfection Reagent (company: polyplus transfection, article No. Cat No114-07 A549 cell) is transfected.Transfection 24 hours after, according to MOI=1, different Strain (H1N1, H3N2, H7N9, H5N1) the cell of infection transfection.As Fig. 8 is grouped: pcDNA3.1 infection group is transfection carrier plasmid pcDNA3.1 (+) sense It catches an illness malicious group；PcDNA3.1-lnc330 infection group is that transfection is overexpressed plasmid pcDNA3.1-lnc330 virus infection Group.RNA is extracted after infection 24 hours according to above-mentioned grouping, the specific steps are as follows:

7 RT-PCR reaction system of table

8 PCR reaction system of table

Internal reference GAPDH

Upstream primer: 5'-GGTGGTCTCCTCTGACTTCAACA-3'

Downstream primer: 5'-GTTGCTGTAGCCAAATTCGTTGT-3'

Influenza M

Upstream primer: 5'-AAGACCAATCCTGTCACCTCTG-3'

Downstream primer: 5'-CAAAACGTCTACGCTGCAGTCC-3'

As a result as shown in figure 8, the virus replication amount of the overexpression Lnc330 group of different type influenzas is substantially less than normally Group.

(5) it is detected using the method for TCID50, detects different strains (H1N1, H3N2, H7N9, H5N1) infection and be overexpressed The titre of Lnc330 cell (A549 cell) influenza virus, and then find whether Lnc330 inhibits different strain virus replications.Such as Fig. 9 grouping: pcDNA3.1 infection group is transfection carrier plasmid pcDNA3.1 (+) virus infection group；pcDNA3.1- Lnc330 infection group is that transfection is overexpressed plasmid pcDNA3.1-lnc330 virus infection group.Specific step is as follows:

(a) by A549 cell according to every hole 3 × 10⁴It is a to be taped against in 24 orifice plates；

(b) adherent to cell after 12 hours, Lnc330 is overexpressed plasmid pcDNA3.1 (+)-lnc330 and vector plasmid PcDNA3.1 (+) utilizes jetPRIME Transfection Reagent (company: polyplus transfection, article No. Cat No114-07) A549 cell is transfected respectively.

(c) after transfecting 24 hours, according to MOI=1, infection solution (H1N1, H3N2, H7N9, H5N1) is prepared, solvent is nothing The DMEM (company Gibco, article No.: 11965-092) of serum is added in (b) infection, is incubated for 1 hour；

(g) supernatant measures virus titer using the method for TCID50.

As a result it as shown in figure 9, the method using TCID50 detects, is verified, discovery Lnc330 presses down to varying degrees Make the duplication of different type influenzas.

Two, animal level is tested

It is also effective in vivo in order to study whether Lnc330 can become a drug.We conducted a series of bodies Interior zoopery.Carrier mediated vivo medicine-feeding is now emerging administration mode, in numerous viral vectors, gland related diseases Poison has good stability and operability, and it is with good targeting.Report adeno-associated virus AAV2/9 type energy The lungs of mouse are enough targeted to, for this purpose, Lnc330 is building up on AAV2/9 type gland relevant viral vector by we, pass through collunarium AAV2/9-AVAN is overexpressed to Mice Body by mode.BJ501 plants of influenza infection mouse are given after three weeks, are observed continuously Mouse weight changes (n=10) and the death rate (n=10) 14 days after infection.

1, Lnc330 gland relevant viral vector constructs

Lnc330 (SEQ ID No.1) is building up to gland relevant viral vector by commission and first Biotechnology Ltd. On (serotype AAV2/9), container name pAAV-EF1A-EGFP-CMV-Lnc330, clone number is H5192.

2, mouse infection is tested

1) Lnc330 overall length is building up to gland relevant viral vector (pAAV-EF1A-EGFP-CMV-Lnc330 AAV2/9) On, by collunarium route of infection, 1 × 10 is given according to every 4 week old C57BL/6 mouse (12g or so)¹¹V.G/20μl Lnc330 adeno-associated virus or control vector virus (be not loaded with the adenovirus of Lnc330, by with first limited public affairs of biotechnology share Department provides).

2) after three weeks, by collunarium route of infection, it is 10 that experimental mice, which gives dosage,^5.125TCID₅₀BJ501 strain stream Influenza Virus, final volume are 20 μ l；Control group mice gives chick embryo allantoic liquid (AF, 20 μ l).

3, antiviral effect detects

(1) performance of timing detection mouse and changes of weight, and count the death rate.

The results show that the mouse of Lnc330 overexpression weight loss after infecting BJ501 plants of influenza viruses is bright compared with control group It is aobvious to mitigate (Figure 10)；In terms of the death rate, the mouse that Lnc330 is overexpressed survival rate after infecting BJ501 plants of influenza viruses is relatively compareed Group is obvious to rise (Figure 11).In the entire observation period, after we are able to observe that BJ501 plants of influenza viruses of infection, Lnc330 crosses table The mouse reached is active compared with control group mice, and the infection symptoms such as piloerection are all light compared with control group.It can be seen that Lnc330 can be effective Alleviating mouse weight caused by BJ501 plants of influenza infections reduces degree and reduces mouse death rate.

(2) the inflammatory cell meter that infiltrates in the detection of mouse lung tissue wet-dry ratio and mouse organs' pathological examination and lung tissue Number

A. mouse lung tissue wet-dry ratio

1) the 5th day after infecting, the lungs of mouse is completely taken out, are rapidly cleaned up the bloodstain on lungs surface with PBS；

2) lungs surface PBS and water mark are blotted with filter paper, weighs mouse lung weight in wet base；

3) lungs are placed in 68 DEG C of baking ovens after toasting 48 hours and weigh dry weight；

4) weight in wet base and dry weight ratio are calculated, lung tissue wet-dry ratio is obtained, lung tissue oedema degree is evaluated with this.

B. the inflammatory cell infiltrated in mouse organs' pathological examination and lung tissue counts

1) the 5th day after infecting, the lung tissue of mouse is taken out, is rapidly cleaned up the bloodstain on lung tissue surface with PBS Afterwards, it is put into 10% formalin fixed；

2) it after 48 hours sufficiently fixed, send and carries out histopathologic slide to pathology room and carry out H&E dyeing；

3) mouse lung tissue pathological section is placed in microscopically observation, chooses 200 times of visuals field of amplification, counts lung in the visual field The apocyte and macrophage infiltrated in tissue.Each experimental group is randomly choosed respectively after 100 visuals field are counted, statistics The cell number that each group is observed calculates its average and standard deviation, for statistical analysis.

As the result is shown: being overexpressed Lnc330 after three weeks using adeno-associated virus in Mice Body, give BJ501 plants of influenza diseases Poison infection, the 5th day observation mouse (n=3) pathologic and inflammatory cell infiltration situation after infection.The results show that After Lnc330 is overexpressed, mouse degree of inflammation of lung after infecting BJ501 plants of influenza viruses is substantially less than control mice, mainly Show that the lung mechanics of Lnc330 overexpression mouse are complete compared with control group mice, bleeding is less, and inflammatory cell infiltration is significant Lower than control group (Figure 12 and Figure 13).It further has detected Lnc330 and is overexpressed mouse and control mice BJ501 plants of influenzas of infection 5th day pulmonary edema degree (n=6) after virus.After Lnc330 is overexpressed as the result is shown, mouse lung wet-dry ratio is substantially less than open country Raw type mouse, this shows that the pulmonary edema degree of mouse after Lnc330 is overexpressed is lower (Figure 14).

The above results illustrate that Lnc330 can alleviate virus-mediated chmice acute injury of lungs, improve its pulmonary condition.

(3) mouse lung virus titer detects

1) the 5th day after infecting, the lungs of mouse is completely taken out under aseptic condition and are placed in grinding pipe, are proportionally added into Containing the dual anti-DMEM culture medium of 100U/ml blueness-streptomysin (be free of serum), by tissue grinder at suspension in ice-water bath；

2) 4 DEG C of centrifugations, 3000 revs/min, 20 minutes；

3) supernatant is carefully sucked out and is placed in 2.0ml cryopreservation tube, be stored in -80 DEG C it is to be checked；

4) virus titer (TCID in tissue fluid₅₀) demarcated using mdck cell, calculation method is Reed-Muench method (refer to Erich Hoffmann, A DNA transfection system for generation of influenza A virus from eight plasmids.(2000),vol.97,6108-6113.)；

5) experimentation is all kept sterile.

As the result is shown: being overexpressed Lnc330 after three weeks, give BJ501 plants of influenza infections, took mouse (n=in the 5th day 6) lungs are ground, and lapping liquid is taken to carry out virus titer (TCID₅₀) measurement, it is found that the virus titer of Lnc330 processing group is bright It is aobvious to be less than control group (Figure 15).This shows that Lnc330 can help host to remove influenza virus, inhibits influenza virus in Mice Body Interior duplication.

Brief summary:

In research of the invention, we are in Lnc330 of the discovery from influenza itself and can significantly inhibit influenza disease Poison duplication, research brief summary are as follows:

1, by the way that influenza infection A549 cell sample is sequenced, obtain the Lnc330 of viral origin sequence signature and Structure；

2, in different cell line, it is overexpressed Lnc330, discovery can inhibit the influenza virus of H1N1 to replicate；

3, in mouse experiment in vivo, the acute lung injury that Lnc330 infected by influenza mediates just has relaxation effect, Lnc330 Effectively carrying capacity of the control influenza virus in lung.

The present invention is directed to the long-chain non-coding RNA of influenza autogene NA design --- and Lnc330 can be used as a kind of potential Anti-influenza virus medicament.

<110>PLA Academy of Military Sciences's military medical research institute

<120>influenza long-chain non-coding RNA-lnc330 and its application

<130> GNCLN191673

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 330

<212> DNA

<213> Artificial sequence

<400> 1

ttacttgtca atggtaaatg gcaactcagc accgtctggc caagaccaac ccacagtgtc 60

actgtttaca ccacaaaagg atatgctgct cccgctagtc ccctctgatt agttcaaccc 120

agaagcaagg tcttatacaa tccagccctg ttagttctgg atgctgaaca aaactcccgc 180

tatatcctga ccactctgat tttgattccc aagttgaatt gagtggctaa tccatattga 240

gattatgttt ccaatttgta atattaagtt agccattcca attgtcatac agaccgaacc 300

aatggttatt atcttttggt ttggattcat 330

<210> 2

<211> 330

<212> DNA

<213> Artificial sequence

<400> 2

ttacttgtca atggtaaatg gcaactcagc accgtctggc caagaccaac ccacagtgtc 60

actgtttaca ccacaaaagg atatgctgct cccgctagtc cactctgatt agttcaaccc 120

agaagcaagg tcttatacaa tccagccctg ttagttctgg atgctgaaca aaactcccgc 180

tatatcctga ccactctgat tttgattccc aagttgaatt gagtggctaa tccatattga 240

gattatgttt ccaatttgta atattaagtt agccattcca attgtcatac agaccgaacc 300

aatggttatt atcttttggt ttggattcat 330

<210> 3

<211> 330

<212> RNA

<213> Artificial sequence

<400> 3

uuacuuguca augguaaaug gcaacucagc accgucuggc caagaccaac ccacaguguc 60

acuguuuaca ccacaaaagg auaugcugcu cccgcuaguc cccucugauu aguucaaccc 120

agaagcaagg ucuuauacaa uccagcccug uuaguucugg augcugaaca aaacucccgc 180

uauauccuga ccacucugau uuugauuccc aaguugaauu gaguggcuaa uccauauuga 240

gauuauguuu ccaauuugua auauuaaguu agccauucca auugucauac agaccgaacc 300

aaugguuauu aucuuuuggu uuggauucau 330

<210> 4

<211> 330

<212> RNA

<213> Artificial sequence

<400> 4

uuacuuguca augguaaaug gcaacucagc accgucuggc caagaccaac ccacaguguc 60

acuguuuaca ccacaaaagg auaugcugcu cccgcuaguc cacucugauu aguucaaccc 120

agaagcaagg ucuuauacaa uccagcccug uuaguucugg augcugaaca aaacucccgc 180

uauauccuga ccacucugau uuugauuccc aaguugaauu gaguggcuaa uccauauuga 240

gauuauguuu ccaauuugua auauuaaguu agccauucca auugucauac agaccgaacc 300

aaugguuauu aucuuuuggu uuggauucau 330

Claims

1. long-chain non-coding RNA is following any:

(a1) RNA shown in SEQ ID No.3；

(a2) RNA shown in SEQ ID No.4；

(a3) by nucleotide sequence shown in SEQ ID No.3 or SEQ ID No.4 by one or several nucleotide residues Substitution and/or deletion and/or addition and RNA with the same function；

(a4) with (a1) or (a2) or (a3) defined by nucleotide sequence have 99% or more, 95% or more, 90% or more, 85% or more or 80% or more homology and RNA with the same function.

2. the DNA of long-chain non-coding RNA described in claim 1 can be transcribed into.

3. DNA according to claim 2, it is characterised in that: the DNA is any in following:

(b1) DNA shown in SEQ ID No.1；

(b2) DNA shown in SEQ ID No.2；

(b3) by nucleotide sequence shown in SEQ ID No.1 or SEQ ID No.2 by one or several nucleotide residues Substitution and/or deletion and/or addition and DNA with the same function；

(b4) with (b1) or (b2) or (b3) defined by nucleotide sequence have 99% or more, 95% or more, 90% or more, 85% or more or 80% or more homology and DNA with the same function.

4. expression cassette, recombinant vector containing DNA described in long-chain non-coding RNA described in claim 1 or Claims 2 or 3 or Recombinant bacterium.

5. being expressed described in long-chain non-coding RNA described in claim 1 or DNA described in claim 2 or 3 or claim 4 Box, recombinant vector or recombinant bacterium it is following it is any in application:

(A1) resisiting influenza virus product is prepared；

(A2) resisiting influenza virus.

6. being expressed described in long-chain non-coding RNA described in claim 1 or DNA described in claim 2 or 3 or claim 4 Box, recombinant vector or recombinant bacterium it is following it is any in application:

(B1) preparation can prevent and/or treat the product of influenza infection；

(B2) prevent and/or treat influenza infection.

7. being expressed described in long-chain non-coding RNA described in claim 1 or DNA described in claim 2 or 3 or claim 4 Box, recombinant vector or recombinant bacterium it is following it is any in application:

(C3) preparation can reduce the product of the acute lung injury of influenza virus mediation, or mitigate the acute lung that influenza virus mediates Damage；

(C4) preparation can reduce the product of weight loss caused by influenza infection, or mitigate caused by influenza infection Weight loss；

(C5) preparation can reduce the product of the death rate caused by influenza infection, or reduce death caused by influenza infection Rate.

8. a kind of product, effective component is long-chain non-coding RNA described in claim 1；The product has following function At least one of:

(D1) resisiting influenza virus；

(D2) prevent and/or treat influenza infection；

(D3) inhibit influenza virus duplication；

(D4) host is helped to remove influenza virus；

(D5) mitigate the acute lung injury that influenza virus mediates；

(D6) mitigate weight loss caused by influenza infection；

(D7) death rate caused by influenza infection is reduced.

9. a kind of product contains expression cassette described in DNA described in claim 2 or 3 or claim 4, recombinant vector or recombination Bacterium；The product has at least one of following function:

(D1) resisiting influenza virus；

(D2) prevent and/or treat influenza infection；

(D3) inhibit influenza virus duplication；

(D4) host is helped to remove influenza virus；

(D5) mitigate the acute lung injury that influenza virus mediates；

(D6) mitigate weight loss caused by influenza infection；

(D7) death rate caused by influenza infection is reduced.

10. according to the application or method any in claim 5-9, it is characterised in that: the influenza virus is H1N1 sub- Type influenza virus, H3N2 subtype influenza virus, H7N9 subtype influenza virus or H5N1 subtype influenza virus.