CN111840210A - Novel immune medicine for treating solid tumor - Google Patents

Abstract

The invention provides a novel immune medicament for treating solid tumors, which comprises the following components in part by weight: a virus expression vector for simultaneously expressing Fut1 gene and ABO blood group gene, wherein the ABO blood group gene comprises N-acetylgalactosamine transferase gene and/or galactosyltransferase gene. The immune drug clones human ABO blood group genes to a medical drug-level lentivirus vector, co-expresses the human ABO blood group genes with a Fut1 gene, injects the prepared medical drug-level lentivirus drug to a tumor part by a solid tumor local injection method, and permanently translates a target gene sequence in a tumor cell, so that a large amount of blood group antigens are expressed on the surface of a tumor cell membrane, and the tumor cell membrane has the capacity of being recognized by corresponding blood group antibodies existing in serum, thereby causing the activation of complement to kill the tumor cell and achieving the purpose of reducing the tumor.

Description

Novel immune medicine for treating solid tumor

Technical Field

The invention belongs to the field of immunotherapy, and particularly relates to an immune medicament, in particular to a novel immune medicament for treating solid tumors.

Background

The ABO blood group antigen is glycoprotein and glycolipid on the surface of erythrocyte membrane catalytically synthesized by specific glycosyltransferase encoded by ABO blood group antigen gene, and 4 main blood groups, namely A type, B type, AB type and O type, are formed by 3 alleles. Blood group antigens exist in 3 forms of free oligo-saccharide, protein-bound and lipid-bound, the first 2 being secreted into various body fluids, while most cell membrane-bound blood group antigens are lipid-bound. The lipid-bound blood group antigen with immunocompetence is located on the outer membrane of a cell membrane, can be expressed by erythrocytes and can also be widely expressed in other cells and tissues, such as epithelial cells of the digestive tract, and the like, so that the clinical significance of the ABO blood group system is not limited in the field of transfusion medicine, and has an important role in the development of other diseases, particularly tumors.

Studies have shown that cancerous cells may be associated with aberrant expression of the a or B antigen. A tumor tissue of a blood patient of type A or type B has a loss of the A antigen or the B antigen, and the tumor with the loss of the A antigen or the B antigen is accompanied by the loss of the corresponding glycosyltransferase. After detecting A, B, H antigen on the surface of erythrocytes of patients with bone marrow malignant tumor by using a flow cytometer, the loss of A or B antigen exists in part of tumor cells of patients with A or B type blood, and the loss of H antigen exists in part of tumor cells of patients with O type blood. Therefore, researches suggest that the reduced expression level of the A antigen or the B antigen is a sign of canceration cells, and the tumor cells lacking the A antigen or the B antigen have enhanced directional migration in an in vitro matrigel invasion experiment; after the A or B glycosyltransferase gene is transfected into a colon cancer cell strain HRTl8 and a gastric cancer cell strain MKN74 expressing H antigen, the migration capability of tumor cells is inhibited. Thus, in the clinical treatment of tumors, it may be possible to control tumor progression by up-regulating blood group antigens in tumor cells.

The ABO blood group antibodies are divided into natural and immune antibodies, generally O-type serum contains anti-A and anti-B of IgG type higher than those in B-type and A-type individual serum, and A-type or B-type serum is mostly IgM antibodies, and because blood group antigens on cells and corresponding antibodies in body fluid are likely to have antigen-antibody reaction, further immunological hemolysis is developed. Studies have shown that the severity of hemolysis is related to the class of antibodies on erythrocytes, including antibodies of the IgM type, which are all more hemolytic; simple IgG-type antibodies are lighter. The mechanisms by which each type of antibody causes destruction of red blood cells differ: (1) IgG-sensitized erythrocytes, which bind to Fc receptors of macrophages, cause the erythrocytes to be phagocytosed and destroyed, but antibody-dependent cytotoxicity also plays an important role, i.e., the macrophages, after binding to the antibody, release lysosomal enzymes and lyse the erythrocytes outside the cell. (2) There is no IgM-Fc receptor on macrophage membrane, but IgM can activate complement (C3b), and it is rare that IgM may be a warm hemolysin, which activates complement to form a Membrane Attack Complex (MAC) to directly cause intravascular hemolysis, so people with IgM are generally more important in hemolysis and are caused by IgM alone and often accompanied by complement activation.

The complement system is a core component of the body's natural immune response, and as an important component of the body's immune system, it eventually causes leakage of cellular contents through the recognition phase, activation phase, and membrane work-up phase, resulting in cell damage. The relationship between complement and tumor is complex, and complement can inhibit the occurrence and development of tumor and clear tumor cells in vivo, thereby maintaining the homeostasis of the body. In general, when the cells are cultured, fetal bovine serum is used instead of adult serum, and the serum inactivates complement at 56 ℃ for 30min because the existence of complement can affect the growth of tumor cells.

The mechanism of complement clearance of tumor cells is mainly composed of the following two aspects: (1) in antigen presenting cells CD4⁺With the aid of T cells, B cells respond to soluble or membrane-expressed antigens secreted by tumor cells and produce anti-tumor antibodies that activate the complement system and pass through the antibodyDepends on the cell-mediated cytotoxicity (ADCC) to kill tumor cells and control the growth of the tumor, and the effect is consistent with the effect of complement in immune hemolysis; (2) complement can also activate the classical complement pathway by binding specific antibodies to corresponding antigens on the cell membrane surface to form complexes, forming MACs that exert a lytic effect on tumor cells, i.e., Complement Dependent Cytotoxicity (CDC). In conclusion, blood group antibodies and complement systems are produced by the human body, no additional input is required, and complement plays an important role in the occurrence and development of tumors.

At present, the tumor incidence is high, the health of the masses of people is seriously harmed, and the high recurrence rate is usually taken as a characteristic, so that huge economic burden is caused to the society. At present, the treatment of tumors is mainly performed by operation, but radiotherapy and chemotherapy have no breakthrough progress in treating tumors, and the prognosis of stage III and stage IV tumors is still not optimistic.

Therefore, there is an urgent need to find new therapeutic means to improve the therapeutic effect of tumors.

Disclosure of Invention

In view of the problems in the prior art, the invention provides a novel immune medicament for treating solid tumors, which adopts a solid tumor local injection method, reduces the side effect of the medicament on tumor patients, improves the treatment effect of the tumors and avoids the drug resistance of the tumors. In addition, the medicine has simple and convenient treatment operation, can be operated by primary hospitals, and can reduce the running pain of tumor patients.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the present invention provides an immunopharmaceutical for treating solid tumors, which simultaneously expresses viral expression vectors of Fut1 gene (fucosyltransferase gene) and ABO blood group genes.

The ABO blood group genes comprise an N-acetylgalactosamine transferase gene (A type gene) and/or a galactosyltransferase gene (B type gene).

For convenience of description, in the present invention, a drug obtained by co-expressing the a-type gene and the Fut1 gene is referred to as an a-type drug, a drug obtained by co-expressing the B-type gene and the Fut1 gene is referred to as a B-type drug, and a drug capable of expressing the a-type gene, the B-type gene, and the Fut1 gene at the same time is referred to as an AB-type drug.

The immune drug provided by the invention is a novel immune drug, human ABO blood group genes are cloned to a medical drug-grade lentiviral vector and are co-expressed with Fut1 genes, the lentiviral vector is used as a tool, blood group antigens are used as tumor expression proteins, and in the clinical treatment of solid tumors, a large amount of blood group antigens are expressed on the surface of a tumor cell membrane through tumor local injection and can be recognized by corresponding blood group antibodies existing in serum, so that complement is activated to kill tumor cells.

For patients with type A blood, the preferred injected medicament of the immune medicament provided by the invention is a type B medicament; for patients with type B blood, the preferred injected drug is a type A drug; for patients with blood type O, the injection of the medicament of type A or B can be carried out, preferably, the injection of the medicament of type AB is carried out, but for the patients with blood type AB, the medicament of the invention has poor treatment effect on the patients with blood type AB because ABO blood group antibodies do not exist in the bodies of the patients with blood type AB.

Preferably, the Fut1 gene is linked to the ABO blood group gene by any one of P2A, T2A or IRES.

As a preferred technical scheme of the invention, the amino acid sequence expressed by the virus expression vector is shown as SEQ ID NO.1 and/or SEQ ID NO. 2.

A type medicine amino acid sequence (SEQ ID NO.1)

MWLRSHRQLCLAFLLVCVLSVIFFLHIHQDSFPHGLGLSILCPDRRLVTPPVAIFCLPGTAMGPNASSSCPQHPASLSGTWTVYPNGRFGNQMGQYATLLALAQLNGRRAFILPAMHAALAPVFRITLPVLAPEVDSRTPWRELQLHDWMSEEYADLRDPFLKLSGFPCSWTFFHHLREQIRREFTLHDHLREEAQSVLGQLRLGRTGDRPRTFVGVHVRRGDYLQVMPQRWKGVVGDSAYLRQAMDWFRARHEAPVFVVTSNGMEWCKENVDTSQGDVTFAGDGQEATPWKDFALLTQCNHTIMTIGTFGFWAAYLAGGDTVYLANFTLPDSEFLKIFKPEAAFLPEWVGINADLSPLWTLAKPLEEGRGSLLTCGDVEENPGPMAEVLRTLAGKPKCHALRPMILFLIMLVLVLFGYGVLSPRSLMPGSLERGFCMAVREPDHLQRVSLPRMVYPQPKVLTPCRKDVLVVTPWLAPIVWEGTFNIDILNEQFRLQNTTIGLTVFAIKKYVAFLKLFLETAEKHFMVGHRVHYYVFTDQLAAVPRVTLGTGRQLSVLEVRAYKRWQDVSMRRMEMISDFCERRFLSEVDYLVCVDVDMEFRDHVGVEILTPLFGTLHPGFYGSSREAFTYERRPQSQAYIPKDEGDFYYLGGFFGGSVQEVQRLTRACHQAMMVDQANGIEAVWHDESHLNKYLLRHKPTKVLSPEYLWDQQLLGWPAVLRKLRFTAVPKNHQAVRNP。

B type medicine amino acid sequence (SEQ ID NO.2)

MWLRSHRQLCLAFLLVCVLSVIFFLHIHQDSFPHGLGLSILCPDRRLVTPPVAIFCLPGTAMGPNASSSCPQHPASLSGTWTVYPNGRFGNQMGQYATLLALAQLNGRRAFILPAMHAALAPVFRITLPVLAPEVDSRTPWRELQLHDWMSEEYADLRDPFLKLSGFPCSWTFFHHLREQIRREFTLHDHLREEAQSVLGQLRLGRTGDRPRTFVGVHVRRGDYLQVMPQRWKGVVGDSAYLRQAMDWFRARHEAPVFVVTSNGMEWCKENVDTSQGDVTFAGDGQEATPWKDFALLTQCNHTIMTIGTFGFWAAYLAGGDTVYLANFTLPDSEFLKIFKPEAAFLPEWVGINADLSPLWTLAKPLEEGRGSLLTCGDVEENPGPMAEVLRTLAGKPKCHALRPMILFLIMLVLVLFGYGVLSPRSLMPGSLERGFCMAVREPDHLQRVSLPRMVYPQPKVLTPCRKDVLVVTPWLAPIVWEGTFNIDILNEQFRLQNTTIGLTVFAIKKYVAFLKLFLETAEKHFMVGHRVHYYVFTDQLAAVPRVTLGTGRQLSVLEVGAYKRWQDVSMRRMEMISDFCERRFLSEVDYLVCVDVDMEFRDHVGVEILTPLFGTLHPSFYGSSREAFTYERRPQSQAYIPKDEGDFYYMGAFFGGSVQEVQRLTRACHQAMMVDQANGIEAVWHDESHLNKYLLRHKPTKVLSPEYLWDQQLLGWPAVLRKLRFTAVPKNHQAVRNP。

Preferably, the nucleotide sequence encoding SEQ ID NO.1 is as shown in SEQ ID NO. 3.

Preferably, the nucleotide sequence encoding SEQ ID NO.2 is as shown in SEQ ID NO. 4.

Wherein, the nucleotide sequence of the Fut1 gene is shown in SEQ ID NO. 5:

ATGTGGCTCCGGAGCCATCGTCAGCTCTGCCTGGCCTTCCTGCTAGTCTGTGTCCTCTCTGTAATCTTCTTCCTCCATATCCATCAAGACAGCTTTCCACATGGCCTAGGCCTGTCGATCCTGTGTCCAGACCGCCGCCTGGTGACACCCCCAGTGGCCATCTTCTGCCTGCCGGGTACTGCGATGGGCCCCAACGCCTCCTCTTCCTGTCCCCAGCACCCTGCTTCCCTCTCCGGCACCTGGACTGTCTACCCCAATGGCCGGTTTGGTAATCAGATGGGACAGTATGCCACGCTGCTGGCTCTGGCCCAGCTCAACGGCCGCCGGGCCTTTATCCTGCCTGCCATGCATGCCGCCCTGGCCCCGGTATTCCGCATCACCCTGCCCGTGCTGGCCCCAGAAGTGGACAGCCGCACGCCGTGGCGGGAGCTGCAGCTTCACGACTGGATGTCGGAGGAGTACGCGGACTTGAGAGATCCTTTCCTGAAGCTCTCTGGCTTCCCCTGCTCTTGGACTTTCTTCCACCATCTCCGGGAACAGATCCGCAGAGAGTTCACCCTGCACGACCACCTTCGGGAAGAGGCGCAGAGTGTGCTGGGTCAGCTCCGCCTGGGCCGCACAGGGGACCGCCCGCGCACCTTTGTCGGCGTCCACGTGCGCCGTGGGGACTATCTGCAGGTTATGCCTCAGCGCTGGAAGGGTGTGGTGGGCGACAGCGCCTACCTCCGGCAGGCCATGGACTGGTTCCGGGCACGGCACGAAGCCCCCGTTTTCGTGGTCACCAGCAACGGCATGGAGTGGTGTAAAGAAAACGTCGACACCTCCCAGGGCGATGTGACGTTTGCTGGCGATGGACAGGAGGCTACACCGTGGAAAGACTTTGCCCTGCTCACACAGTGCAACCACACCATTATGACCATTGGCACCTTCGGCTTCTGGGCTGCCTACCTGGCTGGCGGAGACACTGTCTACCTGGCCAACTTCACCCTGCCAGACTCTGAGTTCCTGAAGATCTTTAAGCCGGAGGCGGCCTTCCTGCCCGAGTGGGTGGGCATTAATGCAGACTTGTCTCCACTCTGGACATTGGCTAAGCCT。

the T2A connecting sequence is shown in SEQ ID NO. 6:

CTCGAGGAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCT。

as a preferred embodiment of the present invention, the viral expression vector includes any one or a combination of at least two of an adenovirus vector, a lentivirus vector, an adeno-associated virus vector, and a measles virus vector.

Preferably, the immune medicament further comprises pharmaceutically acceptable auxiliary materials.

Preferably, the adjuvant comprises any one or a combination of at least two of a carrier, a cytokine, a diluent, an excipient, a filler, a binder, a wetting agent, a disintegrating agent, an emulsifier, a cosolvent, a solubilizer, an osmotic pressure regulator, a surfactant, a coating material, a colorant, a pH regulator, an antioxidant, a bacteriostatic agent or a buffer.

Preferably, the administration route of the immune drug comprises any one or a combination of at least two of interventional therapy introduction, intratumoral injection, intravenous injection, intraperitoneal injection, intramuscular injection or subcutaneous injection, and is preferably intratumoral injection.

In a second aspect, the present invention further provides a method for preparing an immune drug according to the first aspect, which specifically comprises the following steps:

synthesizing nucleotide sequences for encoding a Fut1 gene and an ABO blood group gene, and constructing the nucleotide sequences on a virus expression vector to obtain the immune medicament.

Preferably, the viral expression vector comprises any one of an adenoviral vector, a lentiviral vector, an adeno-associated viral vector or a measles viral vector or a combination of at least two thereof.

Preferably, the lentiviral vector comprises any one of pspax2, pMD2G, or pLVX-IRES-ZsGreen1, or a combination of at least two thereof.

Preferably, the preparation method further comprises the operation of transferring the viral expression vector into a packaging cell.

Preferably, the packaging cells comprise 293T cells.

As a preferred technical scheme of the invention, the preparation method comprises the following steps:

(1) synthesizing nucleotide sequences of Fut1 gene and ABO blood group gene, wherein the nucleotide sequences encode and synthesize amino acid sequences shown as SEQ ID NO.1 or SEQ ID NO. 2;

(2) constructing the nucleotide sequence on a viral expression vector, wherein the viral expression vector comprises any one of pspax2, pMD2G or pLVX-IRES-ZsGreen1 or a combination of at least two of the pspax2, the pMD2G and the pLVX-IRES-ZsGreen 1;

(3) and (3) transferring the virus expression vector obtained in the step (2) into 293T cells, and adding pharmaceutically acceptable auxiliary materials to obtain the immune medicament.

The recitation of numerical ranges herein includes not only the above-recited values, but also any values between any of the above-recited numerical ranges not recited, and for brevity and clarity, is not intended to be exhaustive of the specific values encompassed within the range.

Compared with the prior art, the invention has at least the following beneficial effects:

(1) the immune drug provided by the invention is a novel immune drug, and is characterized in that human ABO blood group genes and Fut1 genes are cloned on a medical drug-level lentivirus vector for co-expression, the prepared medical drug-level lentivirus particles are injected to a solid tumor part by a tumor local injection method, a target sequence is persistently expressed at the tumor part, a large amount of blood group antigens are expressed on the surface of a tumor cell membrane and are identified with corresponding blood group antibodies, so that complement is activated to kill tumor cells, and the purpose of reducing tumors is achieved;

(2) the immune medicament provided by the invention uses a lentiviral vector as a tool, takes ABO blood group antigen as tumor expression protein, changes the traditional systemic administration mode, adopts a solid tumor local injection method, improves the treatment effect of the tumor while reducing the side effect of the tumor patient, and simultaneously can prevent the tumor cells from generating drug resistance, thereby prolonging the life of the tumor patient;

(3) the immune medicine provided by the invention can reduce tumor, and meanwhile, the treatment method is simple, the primary hospital can perform operation treatment on the tumor by using the color Doppler ultrasound with good positioning, and the problem of tumor drug resistance is not caused.

Drawings

FIG. 1 is a schematic diagram of the structure of the fragment inserted into a lentiviral vector constructed in example 1.

FIG. 2 is a graph showing the change in tumor volume of the control and experimental mice in example 3.

Fig. 3 is a display diagram of tumor sizes of mice without using the immunopharmaceutical in example 3.

Fig. 4 is a display of tumor sizes of mice after treatment with the immunopharmaceutical in example 3.

FIG. 5 is a graph showing tumor formation in the control and experimental mice in example 3.

Detailed Description

The technical solutions of the present invention are further described in the following embodiments with reference to the drawings, but the following examples are only simple examples of the present invention and do not represent or limit the scope of the present invention, which is defined by the claims.

In the following examples, reagents, consumables, instruments and the like used were purchased from conventional manufacturers, except for the specific descriptions; the experimental methods used are all routine experimental methods in the field.

The preparation, whether by synthesis of the nucleotide sequence, ligation of the fragment into a vector, or packaging using packaging cells, can be achieved using methods well known to those skilled in the art.

Example 1

The embodiment provides an immune medicament for treating solid tumors and a preparation method thereof.

1. The immune drug is a B-type drug, and comprises:

a virus expression vector pLVX-IRES-ZsGreen1 (donated by Beijing Li Keli laboratory) for simultaneously expressing the Fut1 gene and the B blood group gene, wherein the virus expression vector comprises a nucleotide sequence SEQ ID NO.4, which comprises a Fut1 gene, the B blood group gene and a connecting sequence T2A;

the virus expression vector can express an amino acid sequence shown as SEQ ID NO. 2;

2. the preparation method of the immune medicine comprises the following steps:

(1) synthesizing a nucleotide sequence SEQ ID NO. 4;

(2) as shown in figure 1, the novel immune drug is obtained by inserting SEQ ID NO.4 into pLVX-IRES-ZsGreen1 vector, and then packaging therapeutic virus in 293T cells;

example 2

The embodiment provides an immune medicament for treating solid tumors and a preparation method thereof.

1. The immune drug is an A-type drug, comprising:

the virus expression vector simultaneously expresses a Fut1 gene and an A blood group gene, and the virus expression vector comprises a nucleotide sequence SEQ ID NO.3, wherein the virus expression vector comprises a Fut1 gene, an A blood group gene and a connecting sequence T2A; the virus expression vector can express an amino acid sequence shown as SEQ ID NO. 1;

2. the preparation method of the immune medicine comprises the following steps:

(1) synthesizing a nucleotide sequence SEQ ID NO. 3;

(2) the immune drug is obtained by inserting SEQ ID NO.3 into pLVX-IRES-ZsGreen1 vector, and then packaging therapeutic virus in 293T cells.

Example 3

In this example, the type a drug provided in example 2 was used to treat mouse tumors, and the therapeutic effect was observed. The specific operation steps are as follows:

the MC38 cells used in this example were from the cell resource center of Shanghai Life sciences research institute of Chinese academy of sciences; culturing at 37 deg.C and 5% CO₂The medium was RPMI-1640 medium (Thermo Fisher, USA) supplemented with 10% fetal bovine serum.

(1) Three weeks in advance, C57 mice (purchased from beijing huafukang, inc.) 6, five weeks old, about 20g, were immunized with blood group a antigen and immunized once a week after the first immunization; under SPF conditions, mice were housed in cages, each of which contained a maximum of five mice at the southern medical university laboratory animal center.

(2) Inoculation of MC38 Large intestine cancer cell line (2X 10)⁵/only) in the subcutaneous part of the mouse;

(3) five days later, the immunopharmaceutical prepared in example 1 (1X 10) was topically injected⁷TU/mouse, 200. mu.L) and a control group, wherein the control group is a no-load virus group;

(4) drugs were injected on days 1, 3 and 7 of treatment.

The mice were treated as described above, and the tumor volume of the mice was measured daily using calipers, and the tumor volume was plotted as length × width × 0.50, and the growth curve of the tumor was plotted.

The resulting tumor growth curve is shown in figure 2,

the treatment effect at day 14 is shown in fig. 3 and 4, wherein fig. 3 is a graph showing the treatment effect of the control group, and fig. 4 is a graph showing the treatment effect of the experimental group, and it is apparent that the tumor size of the mice of the experimental group is significantly smaller than that of the mice of the control group.

When the tumor volume reaches 1000mm³Immediately, when the maximum tumor diameter reached 15mm, or when tumor ulceration occurred, the mice were sacrificed by cervical dislocation.

Then, tumor portions of the mice were removed, and as shown in FIG. 5, the tumor sizes of the experimental groups were significantly larger than those of the control group.

Similarly, mice were antigen-immunized in advance with type B blood and treated with the type B drug provided in example 1, and the same results as in example 3 were obtained.

In conclusion, the immune medicament provided by the invention can reduce the tumor, has a simple treatment method, changes the traditional systemic administration mode, adopts a solid tumor local injection method, improves the treatment effect of the tumor while reducing the side effect of a tumor patient, and can avoid the drug resistance of tumor cells.

The applicant declares that the above description is only a specific embodiment of the present invention, but the scope of the present invention is not limited thereto, and it should be understood by those skilled in the art that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope of the present invention are within the scope and disclosure of the present invention.

SEQUENCE LISTING

<110> Wang Lei

Luoqiong (Rouqiong) for treating male infertility

<120> novel immune drug for treating solid tumors

<130>20200824

<160>6

<170>PatentIn version 3.3

<210>1

<211>739

<212>PRT

<213> Artificial Synthesis

<400>1

Met Trp Leu Arg Ser His Arg Gln Leu Cys Leu Ala Phe Leu Leu Val

1 5 10 15

Cys Val Leu Ser Val Ile Phe Phe Leu His Ile His Gln Asp Ser Phe

20 25 30

Pro His Gly Leu Gly Leu Ser Ile Leu Cys Pro Asp Arg Arg Leu Val

35 40 45

Thr Pro Pro Val Ala Ile Phe Cys Leu Pro Gly Thr Ala Met Gly Pro

50 55 60

Asn Ala Ser Ser Ser Cys Pro Gln HisPro Ala Ser Leu Ser Gly Thr

65 70 75 80

Trp Thr Val Tyr Pro Asn Gly Arg Phe Gly Asn Gln Met Gly Gln Tyr

85 90 95

Ala Thr Leu Leu Ala Leu Ala Gln Leu Asn Gly Arg Arg Ala Phe Ile

100 105 110

Leu Pro Ala Met His Ala Ala Leu Ala Pro Val Phe Arg Ile Thr Leu

115 120 125

Pro Val Leu Ala Pro Glu Val Asp Ser Arg Thr Pro Trp Arg Glu Leu

130 135 140

Gln Leu His Asp Trp Met Ser Glu Glu Tyr Ala Asp Leu Arg Asp Pro

145 150 155 160

Phe Leu Lys Leu Ser Gly Phe Pro Cys Ser Trp Thr Phe Phe His His

165 170 175

Leu Arg Glu Gln Ile Arg Arg Glu Phe Thr Leu His Asp His Leu Arg

180 185 190

Glu Glu Ala Gln Ser Val Leu Gly Gln Leu Arg Leu Gly Arg Thr Gly

195 200 205

Asp Arg Pro Arg Thr Phe Val Gly Val His Val Arg Arg Gly Asp Tyr

210 215 220

Leu Gln Val Met Pro Gln Arg Trp Lys Gly Val Val Gly Asp Ser Ala

225 230 235 240

Tyr Leu Arg Gln Ala Met Asp Trp Phe Arg Ala Arg His Glu Ala Pro

245 250 255

Val Phe Val Val Thr Ser Asn Gly Met Glu Trp Cys Lys Glu Asn Val

260 265 270

Asp Thr Ser Gln Gly Asp Val Thr Phe Ala Gly Asp Gly Gln Glu Ala

275 280 285

Thr Pro Trp Lys Asp Phe Ala Leu Leu Thr Gln Cys Asn His Thr Ile

290 295 300

Met Thr Ile Gly Thr Phe Gly Phe Trp Ala Ala Tyr Leu Ala Gly Gly

305 310 315 320

Asp Thr Val Tyr Leu Ala Asn Phe Thr Leu Pro Asp Ser Glu Phe Leu

325 330 335

Lys Ile Phe Lys Pro Glu Ala Ala Phe Leu Pro Glu Trp Val Gly Ile

340 345 350

Asn Ala Asp Leu Ser Pro Leu Trp Thr Leu Ala Lys Pro Leu Glu Glu

355 360 365

Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly

370 375 380

Pro Met Ala Glu Val Leu Arg Thr Leu Ala Gly Lys Pro Lys Cys His

385 390 395 400

Ala Leu Arg Pro Met Ile Leu Phe Leu Ile Met Leu Val Leu Val Leu

405 410 415

Phe Gly Tyr Gly Val Leu Ser Pro Arg Ser Leu Met Pro Gly Ser Leu

420 425 430

Glu Arg Gly Phe Cys Met Ala Val Arg Glu Pro Asp His Leu Gln Arg

435 440 445

Val Ser Leu Pro Arg Met Val Tyr Pro Gln Pro Lys Val Leu Thr Pro

450 455 460

Cys Arg Lys Asp Val Leu Val Val Thr Pro Trp Leu Ala Pro Ile Val

465 470 475 480

Trp Glu Gly Thr Phe Asn Ile Asp Ile Leu Asn Glu Gln Phe Arg Leu

485 490 495

Gln Asn Thr Thr Ile Gly Leu Thr Val Phe Ala Ile Lys Lys Tyr Val

500 505 510

Ala Phe Leu Lys Leu Phe Leu Glu Thr Ala Glu Lys His Phe Met Val

515 520 525

Gly His Arg Val His Tyr Tyr Val Phe Thr Asp Gln Leu Ala Ala Val

530 535 540

Pro Arg Val Thr Leu Gly Thr Gly Arg Gln Leu Ser Val Leu Glu Val

545 550 555 560

Arg Ala Tyr Lys Arg Trp Gln Asp Val Ser Met Arg Arg Met Glu Met

565 570 575

Ile Ser Asp Phe Cys Glu Arg Arg Phe Leu Ser Glu Val Asp Tyr Leu

580 585 590

Val Cys Val Asp Val Asp Met Glu Phe Arg Asp His Val Gly Val Glu

595 600 605

Ile Leu Thr Pro Leu Phe Gly Thr Leu His Pro Gly Phe Tyr Gly Ser

610 615 620

Ser Arg Glu Ala Phe Thr Tyr Glu Arg Arg Pro Gln Ser Gln Ala Tyr

625 630 635 640

Ile Pro Lys Asp Glu Gly Asp Phe Tyr Tyr Leu Gly Gly Phe Phe Gly

645 650 655

Gly Ser Val Gln Glu Val Gln Arg Leu Thr Arg Ala Cys His Gln Ala

660 665 670

Met Met Val Asp Gln Ala Asn Gly Ile Glu Ala Val Trp His Asp Glu

675 680 685

Ser His Leu Asn Lys Tyr Leu Leu Arg His Lys Pro Thr Lys Val Leu

690 695 700

Ser Pro Glu Tyr Leu Trp Asp Gln Gln Leu Leu Gly Trp Pro Ala Val

705 710 715 720

Leu Arg Lys Leu Arg Phe Thr Ala Val Pro Lys Asn His Gln Ala Val

725 730 735

Arg Asn Pro

<210>2

<211>739

<212>PRT

<213> Artificial Synthesis

<400>2

Met Trp Leu Arg Ser His Arg Gln Leu Cys Leu Ala Phe Leu Leu Val

1 5 10 15

Cys Val Leu Ser Val Ile Phe Phe Leu His Ile His Gln Asp Ser Phe

20 25 30

Pro His Gly Leu Gly Leu Ser Ile Leu Cys Pro Asp Arg Arg Leu Val

35 40 45

Thr Pro Pro Val Ala Ile Phe Cys Leu Pro Gly Thr Ala Met Gly Pro

50 55 60

Asn Ala Ser Ser Ser Cys Pro Gln His Pro Ala Ser Leu Ser Gly Thr

65 70 75 80

Trp Thr Val Tyr Pro Asn Gly Arg Phe Gly Asn Gln Met Gly Gln Tyr

85 90 95

Ala Thr Leu Leu Ala Leu Ala Gln Leu Asn Gly Arg Arg Ala Phe Ile

100105 110

Leu Pro Ala Met His Ala Ala Leu Ala Pro Val Phe Arg Ile Thr Leu

115 120 125

Pro Val Leu Ala Pro Glu Val Asp Ser Arg Thr Pro Trp Arg Glu Leu

130 135 140

Gln Leu His Asp Trp Met Ser Glu Glu Tyr Ala Asp Leu Arg Asp Pro

145 150 155 160

Phe Leu Lys Leu Ser Gly Phe Pro Cys Ser Trp Thr Phe Phe His His

165 170 175

Leu Arg Glu Gln Ile Arg Arg Glu Phe Thr Leu His Asp His Leu Arg

180 185 190

Glu Glu Ala Gln Ser Val Leu Gly Gln Leu Arg Leu Gly Arg Thr Gly

195 200 205

Asp Arg Pro Arg Thr Phe Val Gly Val His Val Arg Arg Gly Asp Tyr

210 215 220

Leu Gln Val Met Pro Gln Arg Trp Lys Gly Val Val Gly Asp Ser Ala

225 230 235 240

Tyr Leu Arg Gln Ala Met Asp Trp Phe Arg Ala Arg His Glu Ala Pro

245 250 255

Val Phe Val Val Thr Ser Asn Gly Met Glu Trp Cys Lys Glu Asn Val

260265 270

Asp Thr Ser Gln Gly Asp Val Thr Phe Ala Gly Asp Gly Gln Glu Ala

275 280 285

Thr Pro Trp Lys Asp Phe Ala Leu Leu Thr Gln Cys Asn His Thr Ile

290 295 300

Met Thr Ile Gly Thr Phe Gly Phe Trp Ala Ala Tyr Leu Ala Gly Gly

305 310 315 320

Asp Thr Val Tyr Leu Ala Asn Phe Thr Leu Pro Asp Ser Glu Phe Leu

325 330 335

Lys Ile Phe Lys Pro Glu Ala Ala Phe Leu Pro Glu Trp Val Gly Ile

340 345 350

Asn Ala Asp Leu Ser Pro Leu Trp Thr Leu Ala Lys Pro Leu Glu Glu

355 360 365

Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly

370 375 380

Pro Met Ala Glu Val Leu Arg Thr Leu Ala Gly Lys Pro Lys Cys His

385 390 395 400

Ala Leu Arg Pro Met Ile Leu Phe Leu Ile Met Leu Val Leu Val Leu

405 410 415

Phe Gly Tyr Gly Val Leu Ser Pro Arg Ser Leu Met Pro Gly Ser Leu

420 425430

Glu Arg Gly Phe Cys Met Ala Val Arg Glu Pro Asp His Leu Gln Arg

435 440 445

Val Ser Leu Pro Arg Met Val Tyr Pro Gln Pro Lys Val Leu Thr Pro

450 455 460

Cys Arg Lys Asp Val Leu Val Val Thr Pro Trp Leu Ala Pro Ile Val

465 470 475 480

Trp Glu Gly Thr Phe Asn Ile Asp Ile Leu Asn Glu Gln Phe Arg Leu

485 490 495

Gln Asn Thr Thr Ile Gly Leu Thr Val Phe Ala Ile Lys Lys Tyr Val

500 505 510

Ala Phe Leu Lys Leu Phe Leu Glu Thr Ala Glu Lys His Phe Met Val

515 520 525

Gly His Arg Val His Tyr Tyr Val Phe Thr Asp Gln Leu Ala Ala Val

530 535 540

Pro Arg Val Thr Leu Gly Thr Gly Arg Gln Leu Ser Val Leu Glu Val

545 550 555 560

Gly Ala Tyr Lys Arg Trp Gln Asp Val Ser Met Arg Arg Met Glu Met

565 570 575

Ile Ser Asp Phe Cys Glu Arg Arg Phe Leu Ser Glu Val Asp Tyr Leu

580 585590

Val Cys Val Asp Val Asp Met Glu Phe Arg Asp His Val Gly Val Glu

595 600 605

Ile Leu Thr Pro Leu Phe Gly Thr Leu His Pro Ser Phe Tyr Gly Ser

610 615 620

Ser Arg Glu Ala Phe Thr Tyr Glu Arg Arg Pro Gln Ser Gln Ala Tyr

625 630 635 640

Ile Pro Lys Asp Glu Gly Asp Phe Tyr Tyr Met Gly Ala Phe Phe Gly

645 650 655

Gly Ser Val Gln Glu Val Gln Arg Leu Thr Arg Ala Cys His Gln Ala

660 665 670

Met Met Val Asp Gln Ala Asn Gly Ile Glu Ala Val Trp His Asp Glu

675 680 685

Ser His Leu Asn Lys Tyr Leu Leu Arg His Lys Pro Thr Lys Val Leu

690 695 700

Ser Pro Glu Tyr Leu Trp Asp Gln Gln Leu Leu Gly Trp Pro Ala Val

705 710 715 720

Leu Arg Lys Leu Arg Phe Thr Ala Val Pro Lys Asn His Gln Ala Val

725 730 735

Arg Asn Pro

<210>3

<211>2220

<212>DNA

<213> Artificial Synthesis

<400>3

atgtggctcc ggagccatcg tcagctctgc ctggccttcc tgctagtctg tgtcctctct 60

gtaatcttct tcctccatat ccatcaagac agctttccac atggcctagg cctgtcgatc 120

ctgtgtccag accgccgcct ggtgacaccc ccagtggcca tcttctgcct gccgggtact 180

gcgatgggcc ccaacgcctc ctcttcctgt ccccagcacc ctgcttccct ctccggcacc 240

tggactgtct accccaatgg ccggtttggt aatcagatgg gacagtatgc cacgctgctg 300

gctctggccc agctcaacgg ccgccgggcc tttatcctgc ctgccatgca tgccgccctg 360

gccccggtat tccgcatcac cctgcccgtg ctggccccag aagtggacag ccgcacgccg 420

tggcgggagc tgcagcttca cgactggatg tcggaggagt acgcggactt gagagatcct 480

ttcctgaagc tctctggctt cccctgctct tggactttct tccaccatct ccgggaacag 540

atccgcagag agttcaccct gcacgaccac cttcgggaag aggcgcagag tgtgctgggt 600

cagctccgcc tgggccgcac aggggaccgc ccgcgcacct ttgtcggcgt ccacgtgcgc 660

cgtggggact atctgcaggt tatgcctcag cgctggaagg gtgtggtggg cgacagcgcc 720

tacctccggc aggccatgga ctggttccgg gcacggcacg aagcccccgt tttcgtggtc 780

accagcaacg gcatggagtg gtgtaaagaa aacgtcgaca cctcccaggg cgatgtgacg 840

tttgctggcg atggacagga ggctacaccg tggaaagact ttgccctgct cacacagtgc 900

aaccacacca ttatgaccat tggcaccttc ggcttctggg ctgcctacct ggctggcgga 960

gacactgtct acctggccaa cttcaccctg ccagactctg agttcctgaa gatctttaag1020

ccggaggcgg ccttcctgcc cgagtgggtg ggcattaatg cagacttgtc tccactctgg 1080

acattggcta agcctctcga ggagggcaga ggaagtcttc taacatgcgg tgacgtggag 1140

gagaatcccg gccctatggc cgaggtgttg cggacgctgg ccggaaaacc aaaatgccac 1200

gcacttcgac ctatgatcct tttcctaata atgcttgtct tggtcttgtt tggttacggg 1260

gtcctaagcc ccagaagtct aatgccagga agcctggaac gggggttctg catggctgtt 1320

agggaacctg accatctgca gcgcgtctcg ttgccaagga tggtctaccc ccagccaaag 1380

gtgctgacac cgtgtaggaa ggatgtcctc gtggtgaccc cttggctggc tcccattgtc 1440

tgggagggca cattcaacat cgacatcctc aacgagcagt tcaggctcca gaacaccacc 1500

attgggttaa ctgtgtttgc catcaagaaa tacgtggctt tcctgaagct gttcctggag 1560

acggcggaga agcacttcat ggtgggccac cgtgtccact actatgtctt caccgaccag 1620

ctggccgcgg tgccccgcgt gacgctgggg accggtcggc agctgtcagt gctggaggtg 1680

cgcgcctaca agcgctggca ggacgtgtcc atgcgccgca tggagatgat cagtgacttc 1740

tgcgagcggc gcttcctcag cgaggtggat tacctggtgt gcgtggacgt ggacatggag 1800

ttccgcgacc acgtgggcgt ggagatcctg actccgctgt tcggcaccct gcaccccggc 1860

ttctacggaa gcagccggga ggccttcacc tacgagcgcc ggccccagtc ccaggcctac 1920

atccccaagg acgagggcga tttctactac ctgggggggt tcttcggggg gtcggtgcaa 1980

gaggtgcagc ggctcaccag ggcctgccac caggccatga tggtcgacca ggccaacggc 2040

atcgaggccg tgtggcacga cgagagccac ctgaacaagt acctgctgcg ccacaaaccc 2100

accaaggtgc tctcccccga gtacttgtgg gaccagcagc tgctgggctg gcccgccgtc 2160

ctgaggaagc tgaggttcac tgcggtgccc aagaaccacc aggcggtccg gaacccgtga 2220

<210>4

<211>2220

<212>DNA

<213> Artificial Synthesis

<400>4

atgtggctcc ggagccatcg tcagctctgc ctggccttcc tgctagtctg tgtcctctct 60

gtaatcttct tcctccatat ccatcaagac agctttccac atggcctagg cctgtcgatc 120

ctgtgtccag accgccgcct ggtgacaccc ccagtggcca tcttctgcct gccgggtact 180

gcgatgggcc ccaacgcctc ctcttcctgt ccccagcacc ctgcttccct ctccggcacc 240

tggactgtct accccaatgg ccggtttggt aatcagatgg gacagtatgc cacgctgctg 300

gctctggccc agctcaacgg ccgccgggcc tttatcctgc ctgccatgca tgccgccctg 360

gccccggtat tccgcatcac cctgcccgtg ctggccccag aagtggacag ccgcacgccg 420

tggcgggagc tgcagcttca cgactggatg tcggaggagt acgcggactt gagagatcct 480

ttcctgaagc tctctggctt cccctgctct tggactttct tccaccatct ccgggaacag 540

atccgcagag agttcaccct gcacgaccac cttcgggaag aggcgcagag tgtgctgggt 600

cagctccgcc tgggccgcac aggggaccgc ccgcgcacct ttgtcggcgt ccacgtgcgc 660

cgtggggact atctgcaggt tatgcctcag cgctggaagg gtgtggtggg cgacagcgcc 720

tacctccggc aggccatgga ctggttccgg gcacggcacg aagcccccgt tttcgtggtc 780

accagcaacg gcatggagtg gtgtaaagaa aacgtcgaca cctcccaggg cgatgtgacg 840

tttgctggcg atggacagga ggctacaccg tggaaagact ttgccctgct cacacagtgc 900

aaccacacca ttatgaccat tggcaccttc ggcttctggg ctgcctacct ggctggcgga 960

gacactgtct acctggccaa cttcaccctg ccagactctg agttcctgaa gatctttaag 1020

ccggaggcgg ccttcctgcc cgagtgggtg ggcattaatg cagacttgtc tccactctgg 1080

acattggcta agcctctcga ggagggcaga ggaagtcttc taacatgcgg tgacgtggag 1140

gagaatcccg gccctatggc cgaggtgttg cggacgctgg ccggaaaacc aaaatgccac 1200

gcacttcgac ctatgatcct tttcctaata atgcttgtct tggtcttgtt tggttacggg 1260

gtcctaagcc ccagaagtct aatgccagga agcctggaac gggggttctg catggctgtt 1320

agggaacctg accatctgca gcgcgtctcg ttgccaagga tggtctaccc ccagccaaag 1380

gtgctgacac cgtgtaggaa ggatgtcctc gtggtgaccc cttggctggc tcccattgtc 1440

tgggagggca cgttcaacat cgacatcctc aacgagcagt tcaggctcca gaacaccacc 1500

attgggttaa ctgtgtttgc catcaagaaa tacgtggctt tcctgaagct gttcctggag 1560

acggcggaga agcacttcat ggtgggccac cgtgtccact actatgtctt caccgaccag 1620

ctggccgcgg tgccccgcgt gacgctgggg accggtcggc agctgtcagt gctggaggtg 1680

ggcgcctaca agcgctggca ggacgtgtcc atgcgccgca tggagatgat cagtgacttc 1740

tgcgagcggc gcttcctcag cgaggtggat tacctggtgt gcgtggacgt ggacatggag 1800

ttccgcgacc atgtgggcgt ggagatcctg actccgctgt tcggcaccct gcaccccagc 1860

ttctacggaa gcagccggga ggccttcacc tacgagcgcc ggccccagtcccaggcctac 1920

atccccaagg acgagggcga tttctactac atgggggcgt tcttcggggg gtcggtgcaa 1980

gaggtgcagc ggctcaccag ggcctgccac caggccatga tggtcgacca ggccaacggc 2040

atcgaggccg tgtggcacga cgagagccac ctgaacaagt acctactgcg ccacaaaccc 2100

accaaggtgc tctcccccga gtacttgtgg gaccagcagc tgctgggctg gcccgccgtc 2160

ctgaggaagc tgaggttcac tgcggtgccc aagaaccacc aggcggtccg gaacccgtga 2220

<210>5

<211>1095

<212>DNA

<213> Artificial Synthesis

<400>5

atgtggctcc ggagccatcg tcagctctgc ctggccttcc tgctagtctg tgtcctctct 60

gtaatcttct tcctccatat ccatcaagac agctttccac atggcctagg cctgtcgatc 120

ctgtgtccag accgccgcct ggtgacaccc ccagtggcca tcttctgcct gccgggtact 180

gcgatgggcc ccaacgcctc ctcttcctgt ccccagcacc ctgcttccct ctccggcacc 240

tggactgtct accccaatgg ccggtttggt aatcagatgg gacagtatgc cacgctgctg 300

gctctggccc agctcaacgg ccgccgggcc tttatcctgc ctgccatgca tgccgccctg 360

gccccggtat tccgcatcac cctgcccgtg ctggccccag aagtggacag ccgcacgccg 420

tggcgggagc tgcagcttca cgactggatg tcggaggagt acgcggactt gagagatcct 480

ttcctgaagc tctctggctt cccctgctct tggactttct tccaccatct ccgggaacag 540

atccgcagag agttcaccct gcacgaccac cttcgggaag aggcgcagag tgtgctgggt 600

cagctccgcc tgggccgcac aggggaccgc ccgcgcacct ttgtcggcgt ccacgtgcgc 660

cgtggggact atctgcaggt tatgcctcag cgctggaagg gtgtggtggg cgacagcgcc 720

tacctccggc aggccatgga ctggttccgg gcacggcacg aagcccccgt tttcgtggtc 780

accagcaacg gcatggagtg gtgtaaagaa aacgtcgaca cctcccaggg cgatgtgacg 840

tttgctggcg atggacagga ggctacaccg tggaaagact ttgccctgct cacacagtgc 900

aaccacacca ttatgaccat tggcaccttc ggcttctggg ctgcctacct ggctggcgga 960

gacactgtct acctggccaa cttcaccctg ccagactctg agttcctgaa gatctttaag 1020

ccggaggcgg ccttcctgcc cgagtgggtg ggcattaatg cagacttgtc tccactctgg 1080

acattggcta agcct 1095

<210>6

<211>60

<212>DNA

<213> Artificial Synthesis

<400>6

ctcgaggagg gcagaggaag tcttctaaca tgcggtgacg tggaggagaa tcccggccct 60

Claims (10)

1. An immunopharmaceutical for treating solid tumors, comprising: and (3) a virus expression vector for simultaneously expressing the Fut1 gene and the ABO blood group gene.

2. The immunopharmaceutical of claim 1, wherein the ABO blood group genes comprise N-acetylgalactosamine transferase gene and/or galactosyltransferase gene.

Preferably, the Fut1 gene is linked to the ABO blood group gene by any one of P2A, T2A or IRES.

3. The immunopharmaceutical according to claim 1 or 2, wherein the amino acid sequence expressed by the viral expression vector is shown as SEQ ID No.1 and/or SEQ ID No. 2;

preferably, the nucleotide sequence encoding SEQ ID NO.1 is shown as SEQ ID NO. 3;

preferably, the nucleotide sequence encoding SEQ ID NO.2 is as shown in SEQ ID NO. 4.

4. The immunopharmaceutical according to any one of claims 1 to 3, wherein the viral expression vector comprises any one of or a combination of at least two of an adenovirus vector, a lentivirus vector, an adeno-associated virus vector or a measles virus vector.

5. The immunopharmaceutical according to any one of claims 1 to 4, further comprising pharmaceutically acceptable excipients;

preferably, the auxiliary materials comprise any one or the combination of at least two of a carrier, a cytokine, a diluent, an excipient, a filler, a binder, a wetting agent, a disintegrating agent, an emulsifier, a cosolvent, a solubilizer, an osmotic pressure regulator, a surfactant, a coating material, a coloring agent, a pH regulator, an immune factor, an antioxidant, a bacteriostatic agent or a buffering agent;

preferably, the administration route of the immune drug comprises any one or a combination of at least two of interventional therapy introduction, intratumoral injection, intravenous injection, intraperitoneal injection, intramuscular injection or subcutaneous injection, and is preferably intratumoral injection.

6. The method for preparing an immunopharmaceutical according to any one of claims 1 to 5, comprising the steps of:

synthesizing nucleotide sequences for encoding a Fut1 gene and an ABO blood group gene, and constructing the nucleotide sequences on a virus expression vector to obtain the immune medicament.

7. The method according to claim 6, wherein the viral expression vector comprises any one or a combination of at least two of an adenovirus vector, a lentivirus vector, an adeno-associated virus vector, or a measles virus vector;

preferably, the lentiviral vector comprises any one of pspax2, pMD2G, or pLVX-IRES-ZsGreen1, or a combination of at least two thereof.

8. The method according to claim 6 or 7, further comprising a step of transferring the viral expression vector into a packaging cell;

preferably, the packaging cells comprise 293T cells.

9. The method according to any one of claims 6 to 8, characterized by comprising the steps of:

(1) synthesizing nucleotide sequences of Fut1 gene and ABO blood group gene, wherein the nucleotide sequences encode and synthesize amino acid sequences shown as SEQ ID NO.1 or SEQ ID NO. 2;

(2) constructing the nucleotide sequence on a viral expression vector, wherein the viral expression vector comprises any one of pspax2, pMD2G or pLVX-IRES-ZsGreen1 or a combination of at least two of the pspax2, the pMD2G and the pLVX-IRES-ZsGreen 1;

(3) and (3) transferring the virus expression vector obtained in the step (2) into 293T cells, and adding pharmaceutically acceptable auxiliary materials to obtain the immune medicament.

10. Use of an immunopharmaceutical according to any one of claims 1-5 for the construction of immune cell or mouse tumor models.

Images