CN111826472A - Primer probe group, kit and iPCR method for detecting porcine circovirus type 4 - Google Patents
Primer probe group, kit and iPCR method for detecting porcine circovirus type 4 Download PDFInfo
- Publication number
- CN111826472A CN111826472A CN202010914246.5A CN202010914246A CN111826472A CN 111826472 A CN111826472 A CN 111826472A CN 202010914246 A CN202010914246 A CN 202010914246A CN 111826472 A CN111826472 A CN 111826472A
- Authority
- CN
- China
- Prior art keywords
- kit
- pcv4
- primer
- probe
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a primer probe group, a kit and an iPCR method for detecting porcine circovirus type 4, belonging to the technical field of virus detection. The primer probe set comprises a PCV4 upstream primer with a nucleotide sequence shown as SEQ ID NO.1, a PCV4 downstream primer with a nucleotide sequence shown as SEQ ID NO.2 and a PCV4 probe with a nucleotide sequence shown as SEQ ID NO.3, wherein a fluorescent reporter group is modified at the 5 'end of the PCV4 probe, and a quenching group is modified at the 3' end of the PCV4 probe. The primer probe set provided by the invention is used for carrying out fluorescence thermal convection PCR (iPCR), can complete the detection of PCV4 in half an hour, has good specificity and high sensitivity, can be used on site, and has important clinical use value.
Description
Technical Field
The invention relates to the technical field of virus detection, in particular to a primer probe set, a kit and an iPCR method for detecting porcine circovirus type 4.
Background
Porcine Circovirus (PCV) is a DNA virus with a circular, single-stranded genome, and four genotypes of PCV1, PCV2, PCV3 and PCV4 have been found to date based on genomic characteristics. Wherein PCV1 is detectable in swine herds but is not pathogenic; PCV2 is the main cause of porcine postweaning wasting syndrome; PCV3 is a virus associated with the dermatitis syndrome and reproductive disorders of sows; the latest genotype of PCV4 may be related to respiratory symptoms, intestinal symptoms, and porcine dermatitis and nephrotic syndrome. Since the virus has not been successfully isolated, rapid and accurate diagnosis in clinical practice is of great significance for the detection of the disease. At present, the virus is reported in China in many provinces, and clinical detection mainly depends on common PCR, real-time fluorescence PCR and other laboratory diagnosis methods. However, the existing detection method has the technical defects of long reaction time, low sensitivity and the like, and has the inconvenience of requiring expensive instruments and being tedious to operate.
Disclosure of Invention
The invention aims to provide a primer probe set, a kit and an iPCR method for detecting porcine circovirus type 4. The primer probe set provided by the invention is used for carrying out fluorescence thermal convection PCR (iPCR), can complete the detection of PCV4 in half an hour, has good specificity and high sensitivity, can be used on site, and has important clinical use value.
The invention provides a primer probe set for detecting porcine circovirus type 4, which comprises a PCV4 upstream primer with a nucleotide sequence shown as SEQ ID No.1, a PCV4 downstream primer with a nucleotide sequence shown as SEQ ID No.2 and a PCV4 probe with a nucleotide sequence shown as SEQ ID No.3, wherein a fluorescent reporter group is modified at the 5 'end of the PCV4 probe, and a quenching group is modified at the 3' end of the PCV4 probe.
Preferably, the fluorescent reporter group is selected from FAM, VIC, HEX, JOE, NED, TAMRA, CY3, ROX or CY 5.
Preferably, the quenching group comprises BHQ.
The invention also provides a kit for detecting porcine circovirus type 4 based on the primer probe set in the technical scheme, and the kit comprises: enzyme mixed liquor and PCR reaction liquor containing the primer probe group in the technical scheme; the enzyme mixture comprises 0.5U/. mu.L TaqDNA polymerase, 20mM Tris-HCl, 0.05mM EDTA, 0.05mM DTT, and a carrier40 percent of glycerol and 0.2 percent of Tween-20 by volume percentage; the PCR reaction solution comprises: 20 μ M of the forward primer, 20 μ M of the reverse primer, 10 μ M of the probe, 10mM Tris-HCl, 5mM dNTPs and ddH2O。
Preferably, the kit is a fluorescent thermal convection PCR kit.
Preferably, the reaction system of the kit comprises 15. mu.L of enzyme mixture, 20. mu.L of PCR reaction solution and 5. mu.L of sample to be tested per 40. mu.L of reaction system.
Preferably, the source of the sample to be tested comprises serum, tissue, feces, environmental swab.
Preferably, the reaction conditions of the kit are as follows: the temperature of the upper hole is 95 ℃, the temperature of the lower hole is 60 ℃, and the reaction time is 30 minutes.
The invention provides a primer probe group for detecting porcine circovirus type 4, which is suitable for rapid and accurate detection of the virus on site. The invention takes PCV4 REP gene as a target, designs primers and probes, establishes a fluorescent heat convection PCR method, optimizes a PCR reaction system and reaction conditions, develops a kit with the technical advantages of high sensitivity, good specificity, strong stability and the like, can be used in clinical sites, can greatly shorten the reaction time, and has good clinical application value. The kit provided by the invention can complete detection of PCV4 in clinical samples within half an hour, overcomes the technical defects of long reaction time, low sensitivity and the like of the traditional PCR, overcomes the inconvenience that fluorescence quantitative PCR needs expensive instruments and is tedious to operate, can quickly detect PCV4 on site, and has important clinical practical value and wide market application prospect.
Drawings
FIG. 1 is a diagram of the results of clinical iPCR detection of piglets, fattening pigs and pregnant sows provided by the invention.
Detailed Description
The invention provides a primer probe set for detecting porcine circovirus type 4, which comprises a PCV4 upstream primer with a nucleotide sequence shown as SEQ ID NO.1(acaactacacagaagaggag), a PCV4 downstream primer with a nucleotide sequence shown as SEQ ID NO.2(cattttctttttcaggttca) and a PCV4 probe with a nucleotide sequence shown as SEQ ID NO.3(agtacgctgttgtcg), wherein a fluorescent reporter group is modified at the 5 'end of the PCV4 probe, and a quenching group is modified at the 3' end of the PCV4 probe.
In the present invention, the fluorescent reporter group is preferably selected from FAM, VIC, HEX, JOE, NED, TAMRA, CY3, ROX or CY 5.
In the present invention, the quenching group preferably includes BHQ.
The invention also provides a kit for detecting porcine circovirus type 4 based on the primer probe set in the technical scheme, and the kit comprises: enzyme mixed liquor and PCR reaction liquor containing the primer probe group in the technical scheme; the enzyme mixed solution comprises 0.5U/muL Taq DNA polymerase, 20mM Tris-HCl, 0.05mM EDTA, 0.05mM DTT, 40% glycerol by volume percentage and 0.2% Tween-20 by volume percentage; the PCR reaction solution comprises: 20 μ M of the forward primer, 20 μ M of the reverse primer, 10 μ M of the probe, 10mM Tris-HCl, 5mM dNTPs and ddH2And O. The enzyme mixed solution and the PCR reaction solution can improve the convenience and the sensitivity of the kit.
In the invention, the kit is a fluorescent thermal convection PCR kit. The kit is sensitive, convenient, high in specificity, high in sensitivity and good in reliability, can finish the detection of PCV4 within half an hour, provides powerful technical support for monitoring, preventing and controlling the PCV4 epidemic situation, and has a good application prospect. In the invention, the instrument directly judges the yin-yang type of the sample according to the fluorescence signal of the target to be detected. In the present invention, the instrument is preferably POCKITTMAn intelligent portable nucleic acid analyzer, available from Jinruinhui Biotechnology Ltd.
In the present invention, the reaction system of the kit preferably comprises 15. mu.L of the enzyme mixture, 20. mu.L of the PCR reaction solution and 5. mu.L of the sample to be tested per 40. mu.L of the reaction system.
In the present invention, the source of the sample to be tested preferably includes serum, tissue, feces, environmental swab.
In the present invention, the reaction conditions of the kit are: the temperature of the upper hole is 95 ℃, the temperature of the lower hole is 60 ℃, and the reaction time is 30 minutes.
In the present invention, the kit preferably further comprises a positive control and a negative control. The negative control is preferably water, has no Ct value and no specific amplification curve; the positive control of the present invention is preferably a plasmid synthesized by a conventional plasmid synthesis method (the present invention does not specifically limit the type of the plasmid), and the plasmid preferably comprises a partial sequence of a REP gene of PCV4HNU-AHG1-2019 strain (GenBank: MK 986820.1). The positive control shows a specific amplification curve.
PCV4 REP partial sequence:
atgataatggcgggccaccccgtgaagagatattgtttcactcttaacaactacacagaagaggaggagaagaaaattaaagaattccttacctctgagaactgtgagtacgctgttgtcgggaaggaggtcggagaaaatggcaccccgcacttgcaagggtttgtgaacctgaaaaagaaaatgaggttccacccgtttaagaaagctatcggagagcggagccatattgagcaggcccgcggtactgattgtgataataagaagtattgctccaaaggaggggacttactactggaagtaggagagcccagtgcccagggaaagcgcagcgaccttaaagcgg(SEQ ID NO.4)
the primer probe set, the kit and the iPCR method for detecting porcine circovirus type 4 of the invention are further described in detail with reference to specific examples, and the technical scheme of the invention includes, but is not limited to, the following examples.
Example 1
Design and screening of primer and probe combination
1. Primer design
Primers and probes were designed based on PCV4HNU-AHG1-2019 strain (GenBank: MK986820.1), as shown in Table 1.
TABLE 1 primer/Probe design
2. The reaction system of the PCV4iiPCR method was optimized as shown in table 2.
The optimization principle is as follows: the maximum amplification efficiency and the minimum Ct value of the same sample are obtained by optimizing the following conditions.
TABLE 2 reaction System of PCV4 iPCR method
3. Reaction conditions of PCV4 iPCR method
The temperature of the upper hole is 95 ℃, the temperature of the lower hole is 60 ℃, and the reaction time is 30 minutes.
4. Results
(1) Setting of conditions for analysis of results
And directly judging the yin and yang type of the sample by the instrument according to the fluorescence signal of the target to be detected.
(2) Quality control standard
The negative control is water, and the result is judged to be negative by an instrument after amplification.
The positive control is a synthetic plasmid containing a partial sequence of PCV4 REP, the synthetic method is conventional, and the result is judged to be positive by an instrument after amplification.
Example 2
Specificity verification of iPCR method
The test is used for amplifying the hog cholera virus (CSFV), the Porcine Reproductive and Respiratory Syndrome Virus (PRRSV), the Japanese encephalitis B virus (JEV), the porcine pseudorabies virus (PRV), the Porcine Parvovirus (PPV), the porcine circovirus type 1 (PCV1), the porcine circovirus type 2 (PCV2) and the porcine circovirus type 3 (PCV3), and the results are negative. See table 3.
TABLE 3 PCV4 iPCR specificity verification
| Viral species | CSFV | PRRSV | JEV | PRV | PPV | PCV1 | PCV2 | PCV3 | PCV4 |
| iPCR detection result | - | - | - | - | - | - | - | - | + |
Example 3
Sensitivity verification of iPCR method
After PCV4 plasmid is used as a template to be continuously diluted by 10 times, iPCR, real-time fluorescence PCR and ordinary PCR are respectively used for detection, the lower detection limits of the three PCR methods are respectively 10 copies, 100 copies and 1000 copies, and the iPCR method is proved to have higher sensitivity than the real-time fluorescence PCR and the ordinary PCR. In addition, the real-time fluorescent PCR detection process needs 1 hour, the ordinary PCR detection process needs 2.5 hours, and the iPCR method only needs 0.5 hour, so that the detection speed is higher. In addition, the iPCR detection result is directly displayed as "-" (negative) or "+" (positive) on the instrument, while the real-time fluorescence PCR requires special software for result analysis, and the ordinary PCR requires electrophoresis for result analysis, so that the iPCR has better convenience. The results of the PCV4 iPCR sensitivity verification are shown in Table 4.
TABLE 4 PCV4 iPCR sensitivity validation
| Number of copies | 106 | 105 | 104 | 103 | 102 | 101 | 100 |
| iPCR detection result | + | + | + | + | + | + | - |
| Real-time fluorescent PCR | + | + | + | + | + | - | - |
| General PCR (electrophoresis) | + | + | + | + | - | - | - |
Example 4
Detection of different sample types
Clinical PCV4 suspected positive tissue samples including pig serum, lung, liver, spleen, kidney, brain, lymph and small intestine are subjected to iPCR detection, and the results show that PCV4 can be detected in all types of samples, and the detection results are shown in Table 4 and are consistent with the detection results of PCV4 real-time fluorescence PCR method.
TABLE 4 detection of clinically suspected PCV4 infected samples
Example 5
The results of the clinical application of the PCV4iiPCR kit are shown in table 5.
TABLE 5 clinical test results of PCV4 iPCR kit
The results show that in the 48 samples, the positive rates of PCV4 detected by using the iPCR method and the real-time fluorescence PCR method are both 25.00%, and the coincidence rate of the two methods is 100%.
Example 6
The iiPCR detection is carried out on the positive serum of the piglets, the fattening pigs and the pregnant sows infected with PCV4 and the normal serum of the piglets, the fattening pigs and the pregnant sows not infected with PCV4 in clinic, the detection result is consistent with the real-time fluorescence PCR result, the details are shown in Table 6 and figure 1, and figure 1 is a clinical iPCR detection result graph of the piglets, the fattening pigs and the pregnant sows. The results show that the established PCV4 iPCR method is suitable for pigs with different ages in days and different sexes.
TABLE 6 results of clinical examinations on piglets, finishing pigs and pregnant sows
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Yangzhou university
<120> primer probe group, kit and iPCR method for detecting porcine circovirus type 4
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
acaactacac agaagaggag 20
<210>2
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
cattttcttt ttcaggttca 20
<210>3
<211>15
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
agtacgctgt tgtcg 15
<210>4
<211>346
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
atgataatgg cgggccaccc cgtgaagaga tattgtttca ctcttaacaa ctacacagaa 60
gaggaggaga agaaaattaa agaattcctt acctctgaga actgtgagta cgctgttgtc 120
gggaaggagg tcggagaaaa tggcaccccg cacttgcaag ggtttgtgaa cctgaaaaag 180
aaaatgaggt tccacccgtt taagaaagct atcggagagc ggagccatat tgagcaggcc 240
cgcggtactg attgtgataa taagaagtat tgctccaaag gaggggactt actactggaa 300
gtaggagagc ccagtgccca gggaaagcgc agcgacctta aagcgg 346
Claims (8)
1. The primer probe set for detecting the porcine circovirus type 4 is characterized by comprising a PCV4 upstream primer with a nucleotide sequence shown as SEQ ID No.1, a PCV4 downstream primer with a nucleotide sequence shown as SEQ ID No.2 and a PCV4 probe with a nucleotide sequence shown as SEQ ID No.3, wherein a fluorescent reporter group is modified at the 5 'end of the PCV4 probe, and a quenching group is modified at the 3' end of the PCV4 probe.
2. The primer probe set of claim 1, wherein the fluorescent reporter is selected from FAM, VIC, HEX, JOE, NED, TAMRA, CY3, ROX, or CY 5.
3. The primer probe set of claim 1, wherein the quenching group comprises BHQ.
4. A kit for detecting porcine circovirus type 4 based on the primer probe set of any one of claims 1 to 3, the kit comprising: an enzyme mixture and a PCR reaction solution containing the primer probe set according to any one of claims 1 to 3; the enzyme mixed solution comprises 0.5U/muL Taq DNA polymerase, 20mM Tris-HCl, 0.05mM EDTA, 0.05mM DTT, 40% glycerol by volume percentage and 0.2% Tween-20 by volume percentage; the PCR reaction solution comprises: 20 μ M of the forward primer, 20 μ M of the reverse primer, 10 μ M of the probe, 10mM Tris-HCl, 5mM dNTPs and ddH2O。
5. The kit of claim 4, wherein the kit is a fluorescent thermal convection PCR kit.
6. The kit according to claim 4, wherein the reaction system of the kit comprises 15. mu.L of the enzyme mixture, 20. mu.L of the PCR reaction solution and 5. mu.L of the sample to be tested per 40. mu.L of the reaction system.
7. The kit of claim 6, wherein the sources of the test sample include serum, tissue, stool, and environmental swabs.
8. The kit according to claim 4, wherein the reaction conditions of the kit are: the temperature of the upper hole is 95 ℃, the temperature of the lower hole is 60 ℃, and the reaction time is 30 minutes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010914246.5A CN111826472A (en) | 2020-09-03 | 2020-09-03 | Primer probe group, kit and iPCR method for detecting porcine circovirus type 4 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010914246.5A CN111826472A (en) | 2020-09-03 | 2020-09-03 | Primer probe group, kit and iPCR method for detecting porcine circovirus type 4 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111826472A true CN111826472A (en) | 2020-10-27 |
Family
ID=72918444
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010914246.5A Pending CN111826472A (en) | 2020-09-03 | 2020-09-03 | Primer probe group, kit and iPCR method for detecting porcine circovirus type 4 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111826472A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114164300A (en) * | 2021-12-18 | 2022-03-11 | 扬州大学 | iPCR kit capable of rapidly identifying ASFV gene I type and gene II type and use method thereof |
| CN115141826A (en) * | 2022-06-01 | 2022-10-04 | 安徽省农业科学院畜牧兽医研究所 | RPA primer pair and application thereof, kit for visual detection of PCV4, application thereof and PCV 4detection method |
-
2020
- 2020-09-03 CN CN202010914246.5A patent/CN111826472A/en active Pending
Non-Patent Citations (2)
| Title |
|---|
| A. AMBAGALA等: "Field-Deployable Reverse Transcription-Insulated Isothermal PCR (RT-iiPCR) Assay for Rapid and Sensitive Detection of Foot-and-Mouth Disease Virus", 《TRANSBOUNDARY AND EMERGING DISEASES》 * |
| GIOVANNI FRANZO等: "Lack of Porcine circovirus 4 Genome Detection in Pig Samples from Italy and Spain", 《PATHOGENS》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114164300A (en) * | 2021-12-18 | 2022-03-11 | 扬州大学 | iPCR kit capable of rapidly identifying ASFV gene I type and gene II type and use method thereof |
| CN114164300B (en) * | 2021-12-18 | 2023-10-31 | 扬州大学 | iiiPCR kit capable of rapidly identifying ASFV gene type I and ASFV gene type II and application method thereof |
| CN115141826A (en) * | 2022-06-01 | 2022-10-04 | 安徽省农业科学院畜牧兽医研究所 | RPA primer pair and application thereof, kit for visual detection of PCV4, application thereof and PCV 4detection method |
| CN115141826B (en) * | 2022-06-01 | 2024-01-05 | 安徽省农业科学院畜牧兽医研究所 | RPA primer pair and application thereof, kit for visually detecting PCV4, application of kit and method for detecting PCV4 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111020064B (en) | Novel coronavirus ORF1ab gene nucleic acid detection kit | |
| CN110273027B (en) | Nucleic acid typing detection kit and detection method for norovirus GII, GII and GIV | |
| CN111961761A (en) | Primer probe group and kit for detecting different genotypes of porcine circovirus | |
| CN111763771A (en) | Quadruple real-time fluorescent PCR (polymerase chain reaction) identification and detection method for porcine circovirus types 1 to 4 | |
| CN111500791A (en) | Triple FQ-PCR detection method for porcine epidemic diarrhea virus, porcine coronavirus and porcine acute diarrhea syndrome coronavirus | |
| CN113930547B (en) | RT-RAA fluorescence detection primer pair, kit and detection method for porcine epidemic diarrhea virus N gene | |
| CN113462820A (en) | Multiplex RT-PCR primer probe set for real-time fluorescent quantitative detection of four porcine diarrhea viruses, kit and detection method thereof | |
| CN111826472A (en) | Primer probe group, kit and iPCR method for detecting porcine circovirus type 4 | |
| CN113913559B (en) | Reagent for fluorescence quantitative detection of PRRSV and detection method for PRRSV typing | |
| Zhang et al. | Development of a loop-mediated isothermal amplification for visual detection of the HCLV vaccine against classical swine fever in China | |
| CN113584230A (en) | Reagent and method for detecting different genotypes of porcine circovirus | |
| CN113718058A (en) | Primer probe set and kit for identifying epidemic strains and gene deletion strains of African swine fever virus, and use method and application of primer probe set and kit | |
| CN111676316B (en) | Primer, probe and detection method for rapidly distinguishing African swine fever virus gene type II from other genotypes | |
| CN112593011A (en) | Primer and probe for detecting coxsackie virus B group | |
| CN112280899A (en) | Porcine astrovirus type 2 TaqMan fluorescent quantitative PCR kit and application thereof | |
| CN115044711A (en) | Method for identifying novel coronavirus variant strain by real-time fluorescence PCR | |
| CN112266980A (en) | Novel coronavirus 2019-nCoV real-time fluorescent PCR detection primer, probe, kit and method | |
| CN113122660A (en) | Primer probe combination and kit for detecting pathogen nucleic acid of human herpesvirus and application of primer probe combination and kit | |
| CN111500777A (en) | Kit for detecting novel coronavirus nucleic acid based on fluorescence RT-PCR method | |
| CN111172319A (en) | Primer pair for detecting porcine epidemic diarrhea virus, kit and application thereof | |
| CN113025755B (en) | Reagent for detecting porcine circovirus type 2e and application thereof | |
| Shi et al. | A Quadruplex Reverse Transcription Quantitative Polymerase Chain Reaction for Detecting Canine Coronavirus, Canine Rotavirus, Canine Parvovirus, and Canine Distemper Virus | |
| CN118028544B (en) | Primer pair for detecting 4-type parrot borna virus N gene and application thereof | |
| CN114736990B (en) | Primer probe set and kit for detecting Alapplication virus and enteritis virus of minks based on double microdroplet digital PCR | |
| CN116622908B (en) | Primer probe, kit and method for rapidly detecting wild adeno-associated virus and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20201027 |