CN111763771A - A method for the identification and detection of porcine circovirus types 1 to 4 by quadruple real-time fluorescent PCR - Google Patents

Abstract

A quadruple real-time fluorescent PCR identification and detection method for porcine circovirus types 1 to 4 belongs to the technical field of biology. The invention designs specific primers and probe sequences capable of identifying PCV1, PCV2, PCV3 and PCV4 aiming at ORF1 and ORF2 genes of PCV of different genotypes, probes of PCV1-4 strains marked by different fluorescein are used, each probe can be marked by any one fluorescein, the four probes are marked by the fluorescein detected by different detection channels, the primers and the probes which are respectively used for detecting the PCV1-4 strains or the primers and the probes for identifying the PCV1-4 strains are placed in the same reaction tube, a fluorescence PCR amplification instrument is used for real-time fluorescence PCR reaction, and the identification and detection of the PCV1-4 strains can be completed by carrying out detection operation on the same sample once.

Description

A method for the identification and detection of porcine circovirus types 1 to 4 by quadruple real-time fluorescent PCR

technical field

The invention belongs to the field of biotechnology and relates to quadruple real-time fluorescent PCR detection, in particular to a quadruple real-time fluorescent PCR identification and detection method for porcine circovirus types 1 to 4.

Background technique

Porcine circovirus (Porcine circovirus, PCV) belongs to the Circoviridae family, the genus Circovirus. PCV is the smallest known circular single-stranded DNA virus, with a particle diameter of about 17 nm, no envelope, and icosahedral symmetry. Currently, PCV can be divided into four genotypes (PCV1, PCV2, PCV3, PCV4). In 1974, PCV1 was first identified from the contaminated pig kidney cell line PK-15. PCV1 is currently considered to be non-pathogenic to pigs. In 1998, it was first reported that PCV2 was closely related to multisystem wasting syndrome and porcine dermatitis-nephrotic syndrome in weaned piglets. In 2015, PCV3 was first identified in porcine dermatitis-nephrotic syndrome and abortive herds. In 2019, PCV4 was first detected in the affected pig herd in Hunan, my country. Nucleotide homology among the four PCV genotypes was low, ranging from 35% to 75%. Because the pathogenicity, antigenicity and genome of different PCV genotypes are significantly different, the rapid differential diagnosis of different subtypes of PCV is of great significance for taking targeted and effective clinical prevention and control measures.

At present, the classical methods to detect PCV mainly include serological detection and PCR detection. However, these methods are time-consuming, labor-intensive, and prone to false negatives. Although real-time fluorescent PCR detection methods for different PCV subtypes have been established, they cannot simultaneously identify and detect the four genotypes of PCV1 to PCV4. Therefore, the present invention aims to establish a four-fold identification and detection method for PCV1 to PCV4 that is quick and easy, has strong specificity, high sensitivity and good repeatability.

SUMMARY OF THE INVENTION

The invention provides a fourfold real-time fluorescent PCR identification and detection method for porcine circovirus types 1 to 4 (PCV1-4) in order to make up for the deficiency of the rapid identification and detection method of four PCV genotype strains. The detection method of the present invention can determine whether the sample contains PCV1, PCV2, PCV3, PCV4, or co-infection of two or more genotype strains by only one detection. The method of the invention is fast, convenient, strong in specificity, high in sensitivity and good in repeatability, can be used for rapid identification, detection and analysis of PCV infection in a large number of samples, and has a good application prospect.

The present invention is achieved through the following technical solutions:

The nucleotide sequences listed herein are written from the 5' end to the 3' end.

One aspect of the present invention pertains to four primer pairs (comprising eight primer sequences), wherein:

The PCV1 primer pair comprises the nucleotide sequences of PCV1-F2020: AACCCCATAAGAGGTGGGTGTT and PCV1-R2020: TTCTACCCTCTTCCAAACCTTCCT;

The PCV2 primer pair comprises the nucleotide sequences of PCV2-F2020: CTGAGTCTTTTTTATCACTTCGTAATGGT and PCV2-R2020: ACTGCGTTCGAAAACAGTATATACGA;

The PCV3 primer pair comprises the nucleotide sequences of PCV3-F2020:CATAAATGCTCCAAAGCAGTGCT and PCV3-R2020:TCACCCAGGACAAAGCCTCTT;

PCV4 primer pair contains PCV4-F2020:

Nucleotide sequences of ATTATTAAACAGACTTTATTTGTGTCATCACTT and PCV4-R2020:ACAGGGATAATGCGTAGTGATCACT.

Another aspect of the invention relates to four probes comprising:

PCV1 probe PCV1-P2020: nucleotide sequence of TCCGAGGAGGAAAAACAAAATACGGGA;

Probe PCV2-P2020 for PCV2:

The nucleotide sequence of TTAAGTGGGGGGTCTTTAAGATTAAATTCTCTGAATTGT;

PCV3 probe PCV3-P2020: nucleotide sequence of ATATGTGTTGAGCCATGGGGTGGGGTCT;

Probe PCV4-P2020 for PCV4:

Nucleotide sequence of ATACTACACTTGATCTTAGCCAAAAGGCTCGTTGA.

The present invention also relates to a combination of oligonucleotide primer pairs and probes for simultaneous detection of PCV1 to 4 (PCV1-4) strains, including the above-mentioned primer pairs and probes.

In addition, the above-mentioned composition can also be prepared as a kit.

Further, the present invention also relates to the application of the kit in the simultaneous detection of PCV1 to 4 (PCV1-4) strains, wherein the probes are labeled with any one of fluorescein, and the four probes must be labeled with different The fluorescein of the detection channel can be selected from fluorescein such as FAM, VIC, HEX, JOE, NED, TAMRA, CY3, ROX or CY5.

A quadruple real-time fluorescent PCR method for simultaneously identifying and detecting PCV1 to 4 types (PCV1-4) using the above composition, comprising:

(1) The specific primers and probe sequences designed for the ORF1 and ORF2 genes of different genotypes of PCV can identify PCV1, PCV2, PCV3 and PCV4.

(2) Probes of PCV1-4 strains labeled with different fluorescein, each probe can be labeled with any kind of fluorescein, and the four probes must be labeled with fluorescein detected by different detection channels. Fluorescein selected from FAM, VIC, HEX, JOE, NED, TAMRA, CY3, ROX or CY5.

(3) Place the above-mentioned primers and probes for detecting PCV1-4 strains, or for identifying the above-mentioned primers and probes for PCV1-4 strains, in the same reaction tube, and use a fluorescent PCR amplifier A real-time fluorescent PCR reaction was performed.

The salient features of the present invention are: fully utilizing the high-efficiency amplification of PCR technology, the good specificity of nucleic acid hybridization technology, and the rapid sensitivity of fluorescence detection technology, PCV1 to 4 types (PCV1 to 4) can be completed by one detection operation on the same sample. -4) The identification and detection of virus strains can determine which PCV genotype strain the sample is infected with, or the co-infection of two or more PCV different genotype strains. It has the advantages of quickness and simplicity, strong specificity, high sensitivity, good reliability, lower detection cost, and higher detection efficiency.

Description of drawings

Figure 1 shows the specific amplification curve of the quadruple real-time fluorescent PCR detection method for PCV1 to 4 (PCV1-4) strains; in the figure, the representative strains of PCV1, PCV2, PCV3, and PCV4 can obtain specific amplification curves. While other viruses (PPV, PRV, PRRSV, PEDV and CSFV) have no specific amplification;

Figure 2 is a graph showing the sensitivity amplification curve of PCV1-4 strains in the quadruple real-time fluorescent PCR detection method of PCV1 to 4 (PCV1-4) strains;

Figure A: Curves represent the amplification results of PCV1 at a concentration of 1x10 ⁸ to 1x10 ¹ copies; curves in Figure B respectively represent the amplification results of PCV2 at a concentration of 1x10 ⁸ to 1x10 ¹ copies; Figure C The curves represent the amplification results of PCV3 at a concentration of 1×10 ⁸ to 1×10 ¹ copies; the curves D in the figure represent the amplification results of PCV4 at a concentration of 1×10 ⁸ to 1×10 ¹ copies.

Detailed ways

For the conventional experimental methods in the following examples, refer to the third edition of "Molecular Cloning Experiment Guide" written by Sambrook et al. (Beijing: Science Press, 2002). For the use of the instrument, refer to the instrument operation manual.

The actual sources and specifications of the organisms used in the present invention are as follows:

Since PCV3 and PCV4 cannot be separated in vitro at present, the pathogens used in the examples of the present invention all use clinically positive samples verified by sequencing. Porcine Circovirus Type 1 (PCV1), Type 2 (PCV2), Type 3 (PCV3), Type 4 (PCV4), Porcine Parvovirus (PPV), Porcine Pseudorabies Virus (PRV), Porcine Reproductive and Respiratory Syndrome Virus (PRRSV), swine fever virus (CSFV) and other positive samples were kept by our laboratory.

In the examples of the present invention, other reagents used: RNase Free H2O was purchased from Solarbio Company; HiPureTissue DNA Mini Kit was purchased from Magen Biotech Company; 2×Premix Ex Taq, 2×PrimeSTAR MAXDNA Polymearse were purchased from TAKARA Company; FastPure Plasmid Mini Kit was purchased from Novizan Biotechnology Co., Ltd.; DNA Marker was purchased from Zhejiang Boerjin Technology Co., Ltd. The primers and positive standard plasmids used in the experiment were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd., and the probes were synthesized by Kunshan Propuhe Biotechnology Co., Ltd.

Example 1:

Establishment and evaluation of a quadruple real-time fluorescent PCR identification and detection method for porcine circovirus types 1 to 4 (PCV1-4)

1.1 Design of primers and probes

According to the whole genome of PCV strain obtained from the GenBank database, the sequence alignment software DNAMAN was used for multiple sequence alignment analysis, and four specific TaqMans were designed to identify PCV1, PCV2, PCV3 and PCV4 based on the highly conserved regions in the ORF1 and ORF2 genes, respectively. probe and 4 pairs of primers. The 5' ends of the probes were labeled with different fluorophores (FAM, HEX, ROX and TAMRA). The primers and probes in PCV quadruple real-time fluorescent PCR are shown in Table 1-1.

Table 1-1. Primers and probes used to construct the PCV quadruple real-time fluorescent PCR differential detection method

*The positions of the corresponding primers and probes in the genome were determined according to the PCV1 SC-1 strain (DQ358813), PCV2SD17-36 strain (MH191378), PCV3 29160 strain (KT869077), and PCV4 HNU-AHG1-2019 strain (MK986820), respectively. .

1.2 Plasmid standard synthesis

The standard plasmid synthesis method of PCV quadruple real-time fluorescent PCR is as follows:

The sequences obtained by amplifying PCV1, PCV2, PCV3 and PCV4 by four pairs of specific primers of quadruple PCV real-time fluorescent PCR were spliced and inserted into pUC57 vector to prepare standard plasmids. The standard plasmid synthesis was completed by Suzhou Jinweizhi. After sequencing and verification, the concentration was determined by a microspectrophotometer and stored at -20 °C.

1.3 DNA extraction

With reference to HiPure Tissue DNA Mini Kit kit, viral DNA was extracted from diseased pig tissue samples as follows:

(1) Take 20 mg of tissue sample into an EP tube, add 220 μL Buffer ATL and 20 μL Proteinase K, and mix by vortexing. Incubate overnight at 55°C for digestion, inverting and mixing several times.

(2) Add 10 μL of RNase A to the digestion solution, invert and mix, and place at room temperature for 10 min.

(3) Add 250 μL of Buffer DL to the digestion solution, vortex at high speed for 10 sec, and water bath at 70 °C for 10 min.

(4) Add 250 μL of absolute ethanol to the digestion solution, and vortex to mix for 15 sec.

(5) Briefly centrifuge to collect the liquid on the tube wall.

(6) Load the DNA binding column into the collection tube, and transfer the mixture obtained in step 5 to the column. Centrifuge at 10,000 × g for 1 min.

(7) Discard the filtrate, add 500 μL of Buffer GW1, and centrifuge at 10,000×g for 1 min.

(8) Discard the filtrate, add 650 μL of Buffer GW2, and centrifuge at 10,000×g for 1 min.

(9) Repeat step 8.

(10) Discard the filtrate, put the column back into the collection tube, and centrifuge at 10,000 × g for 2 min.

(11) Put the column in a new 1.5 mL EP tube, add 10-100 μL of Buffer TE preheated to 70°C to the center of the membrane of the column, and let stand for 3 min. Centrifuge at 10,000 × g for 1 min.

(12) Repeat step 11.

(13) Discard the DNA binding column, measure the DNA absorbance and concentration, and store at -20°C.

1.4 Preparation of standards

Convert plasmid concentration to RNA copy number according to the following formula:

y(copies/μL)=(6.02×10 ²³ )×[(x ng/uL)×10 ^-9 DNA]/(DNA length×660)

Use RNase Free H ₂ O to dilute the plasmid to a stock solution with a copy number of 10 ⁹ copies/μL, serially dilute the plasmid standard 10 times, and select a plasmid standard with a concentration of 10 ¹ -10 ⁸ copies/μL, according to Table 1-1. Using the StepOne Plus Real-Time PCR system to perform real-time fluorescent PCR reaction to draw the standard curve of PCV quadruple real-time fluorescent quantitative PCR. The PCV quadruple real-time fluorescent PCR reaction system is shown in Table 1-2 below:

Table 1-2. PCV quadruple real-time fluorescent PCR reaction system

The reaction solution volume 2×Premix Ex Taq 10μL 4 kinds of upstream and downstream primer mixture (10μM) 0.4μL/0.4μL/0.4μL/0.4μL 4 probes 0.2μL/0.2μL/0.2μL/0.2μL DNA template 2μL RNase Free H2O Make up to 20μL

The PCR reaction program was: 95°C for 30s; 95°C for 5s, 60°C for 1 min, 40 cycles.

1.5 Specific tests

The PCV quadruple real-time PCR method established in 1.4 was used to detect the DNA of different genotypes of PCV (PCV1, PCV2, PV3 and PCV4) and the nucleic acid of CSFV, PEDV, PRRSV, PRV and PPV to evaluate the specificity of the method. As shown in Figure 1, when PCV quadruple real-time PCR method was used to detect PCV of four genotypes, specific FAM, HEX, ROX and TAMRA fluorescence signals could be detected; the quadruple real-time PCR method was used to detect CSFV , PEDV, PRRSV, PRV and PPV, no specific fluorescence signal was generated, indicating that the method has good specificity.

1.6 Sensitivity test

Using the PCV quadruple real-time PCR method established in 1.4 to detect plasmid standards with copy number of 10 ¹ -10 ⁸ copies/μL, the sensitivity of the method was evaluated. As shown in Figure 2, the detection limits of PCV1, PCV2, PCV3 and PCV4 in PCV quadruple real-time PCR were all 1×10 ¹ copies/μL, indicating that the method has good sensitivity. At the same time, the detection efficiency of each primer probe used alone in the PCV quadruple real-time fluorescence quantitative PCR method was consistent with the detection results of the quadruple real-time fluorescence quantitative PCR method, indicating that each probe has good specificity and does not cause obvious mutual interference when used in combination.

1.7 Reproducibility within and between groups

Plasmid standards with copy numbers of 10 ⁶ , 10 ⁴ and 10 ² copies/μL were detected by the PCV quadruple real-time PCR method established in 1.4, and the intra- and inter-group repeatability was determined. Among them, the plasmid standards of each concentration were tested 3 times (n=3), and the intra-group variation coefficient was calculated according to the CT value; according to the guidance method of MIQE, the inter-group variation coefficient was determined by detecting the above-mentioned plasmid standards to verify the method. the repeatability. As shown in Tables 1-3, the coefficients of variation of the intra- and inter-group experiments of the PCV quadruple real-time PCR method were 0.07%-2.72% and 0.54%-3.91%, respectively. It shows that the method has good intra- and inter-group repeatability.

Table 1-3. Analysis of intra- and inter-group reproducibility of PCV quadruple real-time PCR method

*Intra-group and inter-group repetitions are expressed as mean ± standard deviation of 3 repetitions.

1.8 Clinical sample detection

Using the PCV quadruple real-time PCR method established in 1.4, 120 clinically diseased pig samples collected from Jiangsu Province from 2016 to 2020 were detected. The results are shown in Table 1-4. There are 6 positive samples for PCV1, with a positive rate of 5%; 59 positive samples for PCV2, with a positive rate of 49.2%; 9 positive samples for PCV3, with a positive rate of 7.5% ; There were 4 positive samples of PCV4, and the positive rate was 3.3%. All the above positive samples were further confirmed by PCR amplification and Sanger sequencing. The results show that the PCV quadruple real-time fluorescent PCR method of the present invention has good clinical practicability and application prospect.

Table 1-4 Analysis of positive rate of different PCV genotype strains in Jiangsu sick pig samples from 2016 to 2020

pathogen 2016 2017 2018 2019 2020 total PCV1 0/5* 0/8 3/36 2/23 1/48 6/120 (5.0%) PCV2 4/5 6/8 21/36 14/23 14/48 59/120 (49.2%) PCV3 1/5 0/8 1/36 0/23 7/48 9/120 (7.5%) PCV4 0/5 0/8 2/36 2/23 0/48 4/120 (3.3%)

*This ratio represents the number of positive samples among all tested samples.

sequence listing

<110> Yangzhou University

<120> Quaternary real-time fluorescent PCR identification and detection method for porcine circovirus types 1 to 4

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 1

aaccccataa gaggtgggtg tt 22

<210> 2

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 2

ttctaccctc ttccaaacct tcct 24

<210> 3

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 3

ctgagtcttt tttatcactt cgtaatggt 29

<210> 4

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 4

actgcgttcg aaaacagtat atacga 26

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 5

cataaatgct ccaaagcagt gct 23

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 6

tcacccagga caaagcctct t 21

<210> 7

<211> 33

<212> DNA

<213> Artificial Sequence

<400> 7

attattaaac agactttatt tgtgtcatca ctt 33

<210> 8

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 8

acagggataa tgcgtagtga tcact 25

<210> 9

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 9

tccgaggagg agaaaaacaa aatacggga 29

<210> 10

<211> 39

<212> DNA

<213> Artificial Sequence

<400> 10

ttaagtgggg ggtctttaag attaaattct ctgaattgt 39

<210> 11

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 11

atatgtgttg agccatgggg tgggtct 27

<210> 12

<211> 35

<212> DNA

<213> Artificial Sequence

<400> 12

atactacact tgatcttagc caaaaggctc gttga 35

Claims (4)

1. The quadruple real-time fluorescent PCR identification and detection method for porcine circovirus types 1 to 4 is characterized by comprising the following steps:

1) designing specific primer and probe sequences capable of identifying PCV1, PCV2, PCV3 and PCV4 aiming at ORF1 and ORF2 genes of PCV with different genotypes;

2) probes of PCV1-4 strain labeled by different fluorescein, each probe can be labeled by any one fluorescein, and the four probes are labeled by fluorescein detected by different detection channels and can be selected from FAM, VIC, HEX, JOE, NED, TAMRA, CY3, ROX or CY5 fluorescein;

3) the primer and the probe which are respectively used for detecting the PCV1-4 strain or the primer and the probe which are used for identifying the PCV1-4 strain are placed in the same reaction tube, and a real-time fluorescent PCR reaction is carried out by using a fluorescent PCR amplification instrument.

2. The quadruple real-time fluorescent PCR (polymerase chain reaction) identification and detection method for porcine circovirus types 1 to 4 according to claim 1, which is characterized in that the primers are four primer pairs comprising eight primer sequences,

the PCV1 primer pair comprises PCV1-F2020: AACCCCATAAGAGGTGGGTGTT and PCV 1-R2020: TTCTACCCTCTTCCAAACCTTCCT;

the PCV2 primer pair comprises PCV2-F2020: CTGAGTCTTTTTTATCACTTCGTAATGGT and PCV 2-R2020: ACTGCGTTCGAAAACAGTATATACGA;

the PCV3 primer pair comprises PCV3-F2020: CATAAATGCTCCAAAGCAGTGCT and PCV 3-R2020: TCACCCAGGACAAAGCCTCTT;

the PCV4 primer pair comprises PCV4-F2020: ATTATTAAACAGACTTTATTTGTGTCATCACTT and PCV 4-R2020: ACAGGGATAATGCGTAGTGATCACT in a pharmaceutically acceptable carrier.

3. The method for the quadruple real-time fluorescent PCR (polymerase chain reaction) differential detection of porcine circovirus types 1 to 4 according to claim 2, wherein the probes are four probes comprising:

probe PCV1-P2020 of PCV 1: TCCGAGGAGGAGAAAAACAAAATACGGGA;

probe PCV2-P2020 of PCV 2: TTAAGTGGGGGGTCTTTAAGATTAAATTCTCTGAATTGT;

probe PCV3-P2020 of PCV 3: ATATGTGTTGAGCCATGGGGTGGGTCT;

probe PCV4-P2020 of PCV 4: ATACTACACTTGATCTTAGCCAAAAGGCTCGTTGA in a pharmaceutically acceptable carrier.

4. The quadruple real-time fluorescent PCR (polymerase chain reaction) differential detection method for porcine circovirus types 1 to 4 according to claim 3, which is characterized in that a combination of primers and probes is prepared into a kit for differential detection.

Images