CN111826399A - Method for promoting overexpression of mesenchymal stem cell TSP4, and preparation and application thereof - Google Patents

Method for promoting overexpression of mesenchymal stem cell TSP4, and preparation and application thereof Download PDF

Info

Publication number
CN111826399A
CN111826399A CN201910309552.3A CN201910309552A CN111826399A CN 111826399 A CN111826399 A CN 111826399A CN 201910309552 A CN201910309552 A CN 201910309552A CN 111826399 A CN111826399 A CN 111826399A
Authority
CN
China
Prior art keywords
tsp4
mesenchymal stem
stem cells
culture medium
lentivirus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201910309552.3A
Other languages
Chinese (zh)
Inventor
张倩
刘韬
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shenzhen Luohu Peoplel's Hospital
Original Assignee
Shenzhen Luohu Peoplel's Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shenzhen Luohu Peoplel's Hospital filed Critical Shenzhen Luohu Peoplel's Hospital
Priority to CN201910309552.3A priority Critical patent/CN111826399A/en
Publication of CN111826399A publication Critical patent/CN111826399A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0663—Bone marrow mesenchymal stem cells (BM-MSC)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0667—Adipose-derived stem cells [ADSC]; Adipose stromal stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0668—Mesenchymal stem cells from other natural sources
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Developmental Biology & Embryology (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Rheumatology (AREA)
  • Immunology (AREA)
  • Veterinary Medicine (AREA)
  • Virology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Vascular Medicine (AREA)
  • Urology & Nephrology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Epidemiology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

The invention belongs to the technical field of biology, and particularly relates to a method for promoting overexpression of mesenchymal stem cell TSP4 through lentivirus infection, wherein a pENTR11-TSP4 expression plasmid is obtained through a pCMV6-Thbs4 plasmid and a pENTR11 plasmid vector; then, the pENTR11-TSP4 expression plasmid and the Plv-Easy-T plasmid are connected to obtain a Plv-Easy-GFP-TSP4 lentivirus expression plasmid; packaging to obtain Plv-Easy-GFP-TSP4 lentivirus; and finally, infecting mesenchymal stem cells by using Plv-Easy-GFP-TSP4 lentivirus, integrating the virus gene fragment into the genome of the mesenchymal stem cells to obtain the mesenchymal stem cells over-expressed by TSP4, and improving the angiogenesis promoting and activating efficiency of the mesenchymal stem cells, so that the mesenchymal stem cells are applied to the medicines for treating ischemic diseases, in particular to the medicines for treating ischemic stroke.

Description

Method for promoting overexpression of mesenchymal stem cell TSP4, and preparation and application thereof
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a method for promoting overexpression of mesenchymal stem cell TSP4 through lentivirus infection, a lentivirus-infected mesenchymal stem cell preparation and application.
Background
Ischemic stroke refers to hemiplegia and disturbance of consciousness caused by cerebral infarction and cerebral artery occlusion based on cerebral thrombosis or cerebral thrombosis. Angiogenesis is very important for the prognosis of patients with ischemic stroke, and endogenous neural stem cells enter an ischemic injury area along the angiogenesis 'track' to perform nerve regeneration repair after the stroke. Angiogenesis is defined as the generation of new blood vessels from existing blood vessels and is a normal and critical process in tissue growth and development. Reestablishing functional vasculature is beneficial in promoting stroke recovery, where angiogenesis results in restoration of blood flow in the ischemic penumbra and promotes long-term functional recovery from ischemic stroke.
Mesenchymal stem cells, a cell population with self-renewal, high proliferation and multi-lineage differentiation capabilities. With the advance of stem cell therapy in related fields, various stem cell lines are used in related researches on cerebral ischemic diseases, stem cell therapy has become the most promising treatment strategy for ischemic stroke, and application of stem cell transplantation provides hopes for repair and functional recovery of ischemia damaged tissues of ischemic stroke. At present, clinical trials of phase I and II of autologous mesenchymal stem cells (BMSCs) approved by the FDA in the United states for treating ischemic stroke are completed, and the feasibility of treating cerebral ischemia by transplanting the autologous BMSCs through a vein is proved.
However, in practical applications, since the content of mesenchymal stem cells in the human body is not high, for example: the bone marrow mesenchymal stem cells occupy about 0.001 to 0.01 percent of the mononuclear cell number in bone marrow, and need larger marrow collection amount in clinical treatment, and have higher requirements on the age, physical condition and psychological acceptance of patients. Moreover, due to the change of microenvironment such as oxidative stress, hypoxia and the like, the survival rate of the transplanted mesenchymal stem cells is very low, the formation speed of new blood vessels is slow and the like, so that the treatment effect of the stem cells in ischemic stroke diseases is greatly limited.
Disclosure of Invention
The embodiment of the invention aims to provide a method for promoting overexpression of mesenchymal stem cells TSP4 through lentivirus infection, and aims to solve the technical problems that the existing mesenchymal stem cells in a human body are few in number, low in survival rate and low in neovascularization speed, and the application and treatment effect in ischemic disease medicines is poor.
It is another object of embodiments of the invention to provide a lentiviral-infected mesenchymal stem cell preparation.
It is a further object of embodiments of the invention to provide a use of lentivirus-infected mesenchymal stem cells.
In order to achieve the purpose of the invention, the technical scheme adopted by the invention is as follows:
a method for promoting overexpression of mesenchymal stem cell TSP4 by lentivirus infection, comprising the steps of:
obtaining pCMV6-Thbs4 plasmid, designing an amplification primer of TSP4 according to the gene coding region sequence of the pCMV6-Thbs4 plasmid, and carrying out polymerase chain reaction amplification to obtain oligonucleotide chain;
obtaining pENTR11 plasmid vector, adopting XhoI and BamHI to carry out double enzyme digestion on the pENTR11 plasmid vector, and obtaining pENTR11 plasmid vector with viscous tail end; carrying out DNA connection reaction on the pENTR11 plasmid vector with the cohesive tail end and the oligonucleotide chain to obtain pENTR11-TSP4 expression plasmid;
obtaining a Plv-Easy-T plasmid, and connecting the Plv-Easy-T plasmid with the pENTR11-TSP4 expression plasmid to obtain a Plv-Easy-GFP-TSP4 lentivirus expression plasmid;
co-transfecting the Plv-Easy-GFP-TSP4 lentivirus expression plasmid with a lentivirus packaging plasmid psPAX2 and pMD.2G to obtain Plv-Easy-GFP-TSP4 lentivirus;
obtaining mesenchymal stem cells, and infecting the mesenchymal stem cells by the Plv-Easy-GFP-TSP4 lentivirus to obtain the mesenchymal stem cells with TSP4 over-expression.
Preferably, the step of the connection process includes:
obtaining a TE buffer solution and an LR clonase II enzyme Mix culture medium, adding a plasmid Plv-Easy-T, pENTR11-TSP4 and a TE buffer solution into the LR clonase II enzyme Mix culture medium according to the concentration that the dosage of the plasmid Plv-Easy-T is 150-200 ng/ul, the dosage of the pENTR11-TSP4 expression plasmid is 50-150 ng/reactant and the TE buffer solution is 8-10 ul/ul.culture medium, and reacting for 12-24 hours at the temperature of 25-30 ℃;
then adding 1-2 ul/ul of proteinase K solution in a culture medium, and reacting for 10-20 minutes at the temperature of 35-40 ℃ to obtain the Plv-Easy-GFP-TSP4 lentivirus expression plasmid.
Preferably, the primers comprise an upstream primer and a downstream primer, and the sequences of the upstream primer and the downstream primer are as follows:
upstream primer of 5 'CGGGATCCATGCCGGCCCCAC 3'
Downstream primer 5 'CCGCTCGAGATTATCCAAGCGGTC 3'.
Preferably, the system of the DNA ligation reaction comprises:
Figure BDA0002031005450000031
preferably, the mesenchymal stem cells are selected from the group consisting of: bone marrow mesenchymal stem cells, umbilical cord mesenchymal stem cells, placental mesenchymal stem cells or adipose mesenchymal stem cells.
Preferably, the mesenchymal stem cells are selected from the group consisting of: mesenchymal stem cells of the third to sixth generations.
Preferably, said step of infecting said mesenchymal stem cells with said Plv-Easy-GFP-TSP4 lentivirus comprises:
inoculating the mesenchymal stem cells into a cell culture bottle containing a first culture medium, and culturing in a cell culture box at the temperature of 35-40 ℃ until the density of the mesenchymal stem cells is 75-85% to obtain a first culture product, wherein the first culture medium is a DMEM/F12 culture medium containing FBS and a double antibody, the mass percentage of the FBS accounts for 10% of the total mass of the first culture medium, and the mass percentage of the double antibody accounts for 1% of the total mass of the first culture medium;
replacing the culture medium of the first culture product with a second culture medium, and culturing for 2-4 hours at 35-40 ℃ to obtain a second culture product, wherein the second culture medium is DMEM/F12 medium containing FBS, and the mass percentage of the FBS accounts for 5% of the total mass of the second culture medium;
replacing the culture medium of the second culture product with a lentivirus culture medium, and culturing for 5-8 hours at 35-40 ℃ to obtain a third culture product;
and replacing the culture medium of the third culture product with a third culture medium, and culturing for 48-72 hours to obtain the TSP4 overexpressed mesenchymal stem cells, wherein the third culture medium is a DMEM/F12 culture medium containing FBS and GM, the mass percentage of the FBS accounts for 5% of the total mass of the third culture medium, and the mass percentage of the GM accounts for 1% of the total mass of the third culture medium.
Preferably, the culture medium of the lentivirus is a DMEM/F-12 culture medium containing FBS, polybrene and a supernatant of Plv-Easy-GFP-TSP4 lentivirus, wherein the mass percentage of the FBS accounts for 5% of the total mass of the lentivirus culture medium, the concentration of the polybrene is 8ng/ml culture medium, and the concentration of the supernatant of the Plv-Easy-GFP-TSP4 lentivirus is (0.5-1) ml/ml culture medium.
A lentivirus-infected mesenchymal stem cell preparation, comprising: TSP4 overexpressed mesenchymal stem cells prepared by the above method.
An application of a lentivirus-infected mesenchymal stem cell, the TSP4 over-expressed mesenchymal stem cell prepared by the preparation method or the lentivirus-infected mesenchymal stem cell preparation in preparing a medicament for treating ischemic stroke.
The invention provides a method for promoting the overexpression of mesenchymal stem cell TSP4 through lentivirus infection, which comprises the steps of firstly obtaining pENTR11-TSP4 expression plasmids through pCMV6-Thbs4 plasmids and pENTR11 plasmid vectors; then, the pENTR11-TSP4 expression plasmid and the Plv-Easy-T plasmid are connected to obtain a Plv-Easy-GFP-TSP4 lentivirus expression plasmid; packaging to obtain Plv-Easy-GFP-TSP4 lentivirus; and finally, infecting mesenchymal stem cells by using Plv-Easy-GFP-TSP4 lentivirus, and integrating the virus gene fragment into the genome of the mesenchymal stem cells to obtain the mesenchymal stem cells with TSP4 over-expression. TSP4 in the Plv-Easy-GFP-TSP4 lentivirus has the functions of promoting the growth of new blood vessels and promoting angiogenesis in endothelial cells, and TSP4 gene segments are brought into mesenchymal stem cell genomes, so that when the mesenchymal stem cells express secretory proteins, the mesenchymal stem cells express self proteins and newly added TSP4 target gene segments, and TSP4 can be over-expressed in the mesenchymal stem cells. The TSP4 in the mesenchymal stem cells is overexpressed by lentivirus infection, the paracrine function of the mesenchymal stem cells can be promoted so as to play a synergistic effect, multiple angiogenesis factors such as vascular endothelial growth factor, angiopoietin 1/2 and the like in the mesenchymal stem cells are overexpressed, the angiogenesis and activation efficiencies of the mesenchymal stem cells are improved, and the generated activated blood vessels can promote the recovery of microcirculation and metabolism, so that the application of the mesenchymal stem cells in ischemic disease treatment medicines, particularly the application in ischemic stroke treatment medicines, is improved.
The lentivirus infected mesenchymal stem cell preparation provided by the invention contains the mesenchymal stem cells over-expressed by TSP4 prepared by the method, so that the over-expression of TSP4 in the mesenchymal stem cells is realized, the paracrine function of the mesenchymal stem cells is promoted, and various angiogenesis factors such as vascular endothelial growth factor, angiopoietin 1/2 and the like in the mesenchymal stem cells are over-expressed, so that the self-renewal, multidirectional differentiation, high proliferation and other capabilities of the mesenchymal stem cells are improved, the efficiencies of hematopoietic reconstruction and angiogenesis are further accelerated, the induction of angiogenesis in an ischemic injury edge region is facilitated, the metabolism of the ischemic region is promoted, and a nervous system is repaired.
The application of the lentivirus infected mesenchymal stem cells provided by the invention can realize over-expression of a plurality of angiogenesis factors such as TSP4, vascular endothelial growth factor, angiopoietin 1/2 and the like, has excellent self-renewal, multidirectional differentiation and high proliferation capacity, has high efficiency of hematopoietic reconstruction and angiogenesis, can effectively induce angiogenesis of ischemic injury marginal areas, promote metabolism of ischemic areas and repair Plv-Easy-GFP-TSP4 lentivirus infected mesenchymal stem cells of nervous systems, is applied to medicaments for treating ischemic stroke, can obviously promote angiogenesis of ischemic areas of stroke, improve angiogenesis efficiency of the ischemic areas and further promote recovery of nerve functions of the ischemic stroke.
Drawings
FIG. 1 is a diagram of an agarose gel electrophoresis of the Plv-Easy-GFP-TSP4 lentivirus plasmid restriction enzyme provided in example 1 of the present invention.
Fig. 2 is a flow chart of bone marrow mesenchymal stem cells provided in example 2 of the present invention.
Fig. 3 is a fluorescent protein assay of TSP4 overexpressed mesenchymal stem cells provided in example 3 of the present invention.
FIG. 4 is a graph showing the positive expression rate of a vascular endothelial cell marker vWF in an angiogenesis test of an ischemic zone in a rat MCAO model by lentivirus-infected mesenchymal stem cells according to an embodiment of the present invention.
FIG. 5 is a graph of the distribution of lentivirus-infected mesenchymal stem cells of the present invention on vascular endothelial cell marker vWF measured in angiogenesis in ischemic areas of rat MCAO model.
FIG. 6 is a graph of lentivirus-infected mesenchymal stem cells assessed on a rat MCAO model neural function recovery assay, provided in an example of the present invention.
Detailed Description
In order to make the purpose, technical solution and technical effect of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention is clearly and completely described, and it is obvious that the described embodiments are a part of the embodiments of the present invention, but not all embodiments. All other embodiments obtained by a person of ordinary skill in the art without any inventive step in connection with the embodiments of the present invention shall fall within the scope of protection of the present invention.
In the description of the present invention, it is to be understood that the terms "first", "second" and the like are used for descriptive purposes only and are not to be construed as indicating or implying relative importance or implying any number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. In the description of the present invention, "a plurality" means two or more unless specifically defined otherwise.
The weight of the related components mentioned in the description of the embodiments of the present invention may not only refer to the specific content of each component, but also represent the proportional relationship of the weight among the components, and therefore, the content of the related components is scaled up or down within the scope disclosed in the description of the embodiments of the present invention as long as it is in accordance with the description of the embodiments of the present invention. Specifically, the weight described in the description of the embodiment of the present invention may be a unit of mass known in the chemical industry field, such as μ g, mg, g, and kg.
The embodiment of the invention provides a method for promoting overexpression of mesenchymal stem cell TSP4 through lentivirus infection, which comprises the following steps:
s10, obtaining pCMV6-Thbs4 plasmids, designing an amplification primer of TSP4 according to the gene coding region sequence of the pCMV6-Thbs4 plasmids, and carrying out polymerase chain reaction amplification to obtain oligonucleotide chains;
s20, obtaining a pENTR11 plasmid vector, and carrying out double enzyme digestion on the pENTR11 plasmid vector by adopting XhoI and BamHI to obtain a pENTR11 plasmid vector with a viscous tail end;
s30, carrying out DNA connection reaction on the pENTR11 plasmid vector with the viscous tail end and the oligonucleotide chain to obtain pENTR11-TSP4 expression plasmid;
s40, obtaining a Plv-Easy-T plasmid, and connecting the Plv-Easy-T plasmid with the pENTR11-TSP4 expression plasmid to obtain a Plv-Easy-GFP-TSP4 lentivirus expression plasmid;
s50, co-transfecting the Plv-Easy-GFP-TSP4 lentivirus expression plasmid, a lentivirus packaging plasmid psPAX2 and pMD.2G into 293T cells to obtain Plv-Easy-GFP-TSP4 lentivirus;
s60, obtaining mesenchymal stem cells, and infecting the mesenchymal stem cells by adopting the Plv-Easy-GFP-TSP4 lentivirus to obtain the mesenchymal stem cells with TSP4 over-expression.
The method for promoting the overexpression of the mesenchymal stem cell TSP4 through the lentiviral infection, which is provided by the embodiment of the invention, comprises the steps of firstly obtaining pENTR11-TSP4 expression plasmids through pCMV6-Thbs4 plasmids and pENTR11 plasmid vectors; then, the pENTR11-TSP4 expression plasmid and the Plv-Easy-T plasmid are connected to obtain a Plv-Easy-GFP-TSP4 lentivirus expression plasmid; packaging to obtain Plv-Easy-GFP-TSP4 lentivirus; and finally, infecting mesenchymal stem cells by using Plv-Easy-GFP-TSP4 lentivirus, and integrating the virus gene fragment into the genome of the mesenchymal stem cells to obtain the mesenchymal stem cells with TSP4 over-expression. In the embodiment of the invention, TSP4 in the Plv-Easy-GFP-TSP4 lentivirus has the functions of promoting the growth of new blood vessels and promoting angiogenesis in endothelial cells, and the TSP4 gene fragment is carried into the mesenchymal stem cell genome, so that when the mesenchymal stem cells express secretory proteins, the mesenchymal stem cells express self proteins and also express newly added TSP4 target gene fragments, and TSP4 can be over-expressed in the mesenchymal stem cells. The TSP4 in the mesenchymal stem cells is overexpressed by lentivirus infection, the paracrine function of the mesenchymal stem cells can be promoted so as to play a synergistic effect, multiple angiogenesis factors such as vascular endothelial growth factor, angiopoietin 1/2 and the like in the mesenchymal stem cells are overexpressed, the angiogenesis and activation efficiencies of the mesenchymal stem cells are improved, and the generated activated blood vessels can promote the recovery of microcirculation and metabolism, so that the application of the mesenchymal stem cells in ischemic disease treatment medicines, particularly the application in ischemic stroke treatment medicines, is improved.
Specifically, in the step S10, plasmid pCMV6-Thbs4 was obtained, and amplification primers of TSP4 were designed based on the gene coding region sequence of the plasmid pCMV6-Thbs4, and polymerase chain reaction amplification was performed to obtain an oligonucleotide chain. In the embodiment of the invention, primers are designed through pCMV6-Thbs4 plasmids, on one hand, Thbs4 in pCMV6-Thbs4 plasmids contains TSP4 gene sequences, and TSP4 has the characteristics of binding collagen, heparin and calcium ions, can be combined with various matrix proteins to regulate the interaction between cells and cell matrixes, participate in the biological processes of regulating platelet adhesion and aggregation, thrombosis, smooth muscle proliferation, migration and the like, can promote the growth of new blood vessels, activate vascular endothelial cells and improve the function of promoting the angiogenesis of the endothelial cells. On the other hand, the pCMV6-Thbs4 plasmid also contains a green fluorescent protein GFP marker gene, and the marker gene is beneficial to the subsequent detection and identification of a target product. In the embodiment of the invention, a primer sequence containing TSP4 and GFP is designed by utilizing a gene sequence of Thbs4 in pCMV6-Thbs4 plasmid, Polymerase Chain Reaction (PCR) amplification is carried out to obtain an oligonucleotide chain, and the oligonucleotide chain can be directly over-expressed on the surface of mesenchymal stem cells after being connected into the mesenchymal stem cells through subsequent steps, so that the paracrine function of the mesenchymal stem cells is promoted, and the angiogenesis promoting efficiency of the mesenchymal stem cells is improved.
As a preferred embodiment, the primers include an upstream primer and a downstream primer, and the sequences of the upstream primer and the downstream primer are as follows
Upstream primer of 5 'CGGGATCCATGCCGGCCCCAC 3'
Downstream primer 5 'CCGCTCGAGATTATCCAAGCGGTC 3'.
As a preferred embodiment, the PCR amplification comprises the following table 1:
TABLE 1
Figure BDA0002031005450000081
Figure BDA0002031005450000091
Wherein the DNA template is pCMV6-Thbs4 plasmid, the extension rate is 15-30s/kb, and after the PCR amplification reaction is finished, the gel is recovered and purified to obtain a purified DNA solution. As a preferred example, the denaturation temperature is 92 ℃, the annealing temperature is 50 ℃ and the elongation temperature is 72 ℃.
Specifically, in the step S20, the pENTR11 plasmid vector is obtained, and the pENTR11 plasmid vector is subjected to double digestion with XhoI and BamHI, so as to obtain pENTR11 plasmid vector with a cohesive end. In the embodiment of the invention, pENTR11 plasmid vector with viscous end is obtained by double enzyme digestion of pENTR11 plasmid vector with XhoI and BamHI, and the double enzyme digestion system is shown in the following table 2 as a preferred embodiment:
TABLE 2
Figure BDA0002031005450000092
Specifically, in the step S30, the plasmid vector pENTR11 with a cohesive end and the oligonucleotide chain are subjected to a DNA ligation reaction, so as to obtain an expression plasmid pENTR11-TSP 4. In the embodiment of the invention, the DNA connection reaction time for connecting the pENTR11 plasmid vector with the viscous tail end to the oligonucleotide chain is 12-24 hours, and the DNA connection reaction system is shown in the following table 3:
TABLE 3
Figure BDA0002031005450000093
Figure BDA0002031005450000101
The pENTR11-TSP4 expression plasmid can be obtained through DNA ligation reaction. In some embodiments, the method further comprises performing enzyme digestion identification on the ligation product pENTR11-TSP4 expression plasmid.
Specifically, in the step S40, a Plv-Easy-T plasmid is obtained, and the Plv-Easy-T plasmid and the pENTR11-TSP4 expression plasmid are connected to obtain a Plv-Easy-GFP-TSP4 lentivirus expression plasmid. The embodiment of the invention adopts the Plv-Easy-T plasmid and the pENTR11-TSP4 expression plasmid, the Plv-Easy-T plasmid has better combination effect with the mesenchymal stem cells, and the combination effect of the lentivirus and the mesenchymal stem cells can be improved by connecting the pENTR11-TSP4 expression plasmid to the Plv-Easy-T plasmid.
As a preferred embodiment, the step of the connection process includes:
s41, obtaining a TE buffer solution and an LR clonase II enzyme Mix culture medium, adding the plasmid Plv-Easy-T, pENTR11-TSP4 and the TE buffer solution into the LR clonase II enzyme Mix culture medium according to the concentration that the dosage of the plasmid Plv-Easy-T is 150-200 ng/ul, the dosage of the pENTR11-TSP4 expression plasmid is 50-150 ng/reactant and the TE buffer solution is 8-10 ul/ul.culture medium, and reacting for 12-24 hours at the temperature of 25-30 ℃;
s42, adding 1-2 ul/ul of proteinase K solution in a culture medium, and reacting for 10-20 minutes at the temperature of 35-40 ℃ to obtain the Plv-Easy-GFP-TSP4 lentivirus expression plasmid. Wherein, the TE buffer solution is prepared by Tris and EDTA, is mainly used for dissolving nucleic acid and can stably store DNA and RNA. In the embodiment of the invention, the Plv-Easy-GFP-TSP4 lentivirus expression plasmid can be obtained by the connection treatment of the S41 and the S42. In some embodiments, enzymatic identification of the ligation product Plv-Easy-GFP-TSP4 lentiviral expression plasmid is also included.
Specifically, in the step S50, the Plv-Easy-GFP-TSP4 lentivirus expression plasmid and the lentivirus packaging plasmid psPAX2 and pMD.2G are co-transfected into 293T cells to obtain the Plv-Easy-GFP-TSP4 lentivirus. The embodiment of the invention adopts psPAX2 and pMD.2G plasmids to package Plv-Easy-GFP-TSP4 lentivirus expression plasmids, the Plv-Easy-GFP-TSP4 lentivirus expression plasmids are packaged and transfected into virus particles with infectivity, and after 293T cells are cotransfected, Plv-Easy-GFP-TSP4 lentiviruses are obtained, so that the expression of lentivirus genes in cells or living tissues is realized. In some examples, the Plv-Easy-GFP-TSP4 lentivirus expression plasmid after correct enzyme cleavage was co-transfected with the lentivirus packaging plasmid psPAX2 and pmd.2g into 293T cells (human renal epithelial cell line) to give Plv-Easy-GFP-TSP4 lentivirus.
Specifically, mesenchymal stem cells are obtained in step S60, and the mesenchymal stem cells are infected with the Plv-Easy-GFP-TSP4 lentivirus, thereby obtaining mesenchymal stem cells with TSP4 overexpressed. The embodiment of the invention can obtain TSP4 over-expressed mesenchymal stem cells by infecting the mesenchymal stem cells with the prepared Plv-Easy-GFP-TSP4 lentivirus, the mesenchymal stem cells infected with the Plv-Easy-GFP-TSP4 lentivirus can realize the over-expression of TSP4 and promote the paracrine function of the mesenchymal stem cells, so that vascular endothelial growth factors, angiopoietin 1/2 and other growth factors in the mesenchymal stem cells are over-expressed, the angiogenesis promoting efficiency of the mesenchymal stem cells is improved, and the application of the mesenchymal stem cells in the medicines for treating ischemic diseases is improved.
As a preferred embodiment, the mesenchymal stem cells are selected from the group consisting of: bone marrow mesenchymal stem cells, umbilical cord mesenchymal stem cells, placental mesenchymal stem cells or adipose mesenchymal stem cells. The mesenchymal stem cells, umbilical cord mesenchymal stem cells, placental mesenchymal stem cells or adipose mesenchymal stem cells used in the embodiments of the present invention include Vascular Endothelial Growth Factor (VEGF), Platelet Derived Growth Factor (PDGF), angiopoietin 1/2(angiopoietin-1/2, Ang1/2), transforming growth factor- β (transforming growth factor- β, TGF- β), epidermal growth factor (epidermal growth factor, EGF), and other growth factors, which participate in various cellular responses such as regulation of cell nutrition, migration, support, proliferation, survival, apoptosis, differentiation, and further include thrombospondin-4 (thrombospondin-4) that can promote the growth of new blood vessels and improve the angiogenesis function of endothelial cells. The mesenchymal stem cells adopted by the embodiment of the invention have the capabilities of self-renewal, multidirectional differentiation, high proliferation and the like, can accelerate hematopoietic reconstruction, induce angiogenesis in the edge area of ischemic injury, promote metabolism in the ischemic area and repair a nervous system.
As a preferred embodiment, the mesenchymal stem cells are selected from the group consisting of: mesenchymal stem cells of the third to sixth generations. The embodiment of the invention adopts the mesenchymal stem cells from the third generation to the sixth generation, mainly uniform long fusiform cells, more filopodia are arranged around the cells and form the reticular connection between adjacent cells, at the moment, the cell nucleus is larger, the nuclear membrane is clear, two or three nucleoli are contained, the nucleoplasm is smaller, at the moment, the life of the stem cell is vigorous, the cell proliferation and differentiation capacity is strong, and the infection rate of the Plv-Easy-GFP-TSP4 lentivirus is high. More preferably, the mesenchymal stem cells are selected from the group consisting of: bone marrow mesenchymal stem cells of third to sixth generations.
In some embodiments, the culturing of the bone marrow mesenchymal stem cells comprises the steps of: obtaining marrow to 10cm2And blowing and beating the mixture into a cell suspension by a pipette gun in a cell culture dish. ② transferring the cell suspension into a 15ml centrifuge tube, marking, centrifuging at 800rpm for 10min, and discarding the supernatant. After complete cell suspension in DMEM/F12 medium, the cell suspension was transferred to 25cm2Placing into a culture flask, and adding 95% CO at 37 deg.C2Culturing in a cell culture box, and changing the culture solution after 48 hours. ③ when the cell density is more than 80%, the cells are digested with 0.25% trypsin and transferred to 75cm2The cell culture flask continues to culture. Fourthly, waiting for 75cm2And when the cell density in the cell culture bottle is more than 80%, digesting the cells by using 0.25% trypsin, stopping digestion by using a complete culture medium, centrifuging, and re-suspending the cells by using PBS (phosphate buffer solution) to obtain the third-generation mesenchymal stem cells.
As a preferred embodiment, said step of infecting said mesenchymal stem cells with said Plv-Easy-GFP-TSP4 lentivirus comprises:
s61, inoculating the mesenchymal stem cells into a cell culture bottle containing a first culture medium, and culturing in a cell culture box at the temperature of 35-40 ℃ until the density of the mesenchymal stem cells is 75-85% to obtain a first culture product, wherein the first culture medium is a DMEM/F12 culture medium containing FBS and a double antibody, the mass percentage of the FBS accounts for 10% of the total mass of the first culture medium, and the mass percentage of the double antibody accounts for 1% of the total mass of the first culture medium;
s62, replacing the culture medium of the first culture product with a second culture medium, and culturing for 2-4 hours at 35-40 ℃ to obtain a second culture product, wherein the second culture medium is a DMEM/F12 culture medium containing FBS, and the mass percentage of the FBS accounts for 5% of the total mass of the second culture medium;
s63, replacing the culture medium of the second culture product with a lentivirus culture medium, and culturing for 5-8 hours at 35-40 ℃ to obtain a third culture product;
s64, replacing the culture medium of the third culture product with a third culture medium, and culturing for 48-72 hours to obtain the TSP4 overexpressed mesenchymal stem cells, wherein the third culture medium is a DMEM/F12 culture medium containing FBS and GM, the mass percentage of the FBS accounts for 5% of the total mass of the third culture medium, and the mass percentage of the GM accounts for 1% of the total mass of the third culture medium.
Specifically, in step S61, the mesenchymal stem cells are inoculated into a cell culture flask of a first culture medium, and cultured in a cell culture box at 35-40 ℃ until the density of the mesenchymal stem cells is 75-85%, so as to obtain a first culture product. The first culture medium adopted by the embodiment of the invention is a DMEM/F12 culture medium containing FBS and a double antibody, the mass percentage of the FBS accounts for 10% of the total mass of the first culture medium, the mass percentage of the double antibody accounts for 1% of the total mass of the first culture medium, and the DMEM/F12 culture medium plays a role in inhibiting bacterial growth and avoiding cell pollution while culturing mesenchymal stem cells. The first culture product obtained by the embodiment of the invention has the mesenchymal stem cell density of 75-85%, and the cell density not only keeps the cells in the optimal proliferation state, but also keeps the cells in a certain number so as to be better combined with the virus.
Specifically, in step S62, the medium of the first culture product is replaced with a second medium, and the first culture product is cultured at 35 to 40 ℃ for 2 to 4 hours to obtain a second culture product. The second culture medium adopted in the embodiment of the invention is DMEM/F12 culture medium containing FBS, the mass percentage of the FBS accounts for 5% of the total mass of the second culture medium, and the main purpose of culture in the culture medium is to remove the killing effect of double antibodies in the culture medium on subsequently added Plv-Easy-GFP-TSP4 lentivirus, reduce the serum content, enable mesenchymal stem cells to be in a starvation state and facilitate the subsequent lentivirus to enter the cells.
Specifically, in step S63, the medium of the second culture product is replaced with a lentiviral culture medium, and the second culture product is cultured at 35 to 40 ℃ for 5 to 8 hours to obtain a third culture product. In the embodiment of the invention, the second culture product is cultured by using the lentivirus culture medium, so that lentiviruses enter the mesenchymal stem cells to infect the mesenchymal stem cells.
In a preferred embodiment, the culture medium of the lentivirus is a DMEM/F-12 culture medium containing FBS, polybrene and a supernatant of Plv-Easy-GFP-TSP4 lentivirus, wherein the mass percentage of the FBS accounts for 5% of the total mass of the lentivirus culture medium, the concentration of the polybrene is 8ng/ml culture medium, and the concentration of the supernatant of the Plv-Easy-GFP-TSP4 lentivirus is (0.5-1) ml/ml culture medium.
Specifically, in the step S64, the medium of the third culture product is replaced by a third medium, and the third medium is cultured for 48 to 72 hours to obtain the TSP4 overexpressed mesenchymal stem cells, wherein the third medium is a DMEM/F12 medium containing FBS and GM, the mass percentage of the FBS accounts for 5% of the total mass of the third medium, and the mass percentage of the GM accounts for 1% of the total mass of the third medium. In the embodiment of the invention, the mesenchymal stem cells after lentivirus infection are cultured in a DMEM/F12 culture medium containing FBS and GM, wherein the mass percentage of the FBS accounts for 5% of the total mass of the third culture medium, and the mass percentage of the GM accounts for 1% of the total mass of the third culture medium for later use.
The embodiment of the invention also provides a lentivirus-infected mesenchymal stem cell preparation, which comprises the following components in percentage by weight: TSP4 over-expressed mesenchymal stem cells prepared by the method for promoting the over-expression of the mesenchymal stem cells TSP4 through lentivirus infection.
The lentivirus-infected mesenchymal stem cell preparation provided by the embodiment of the invention contains the mesenchymal stem cells over-expressed by TSP4 prepared by the method, so that the over-expression of TSP4 in the mesenchymal stem cells is realized, the paracrine function of the mesenchymal stem cells is promoted, and various angiogenesis factors such as vascular endothelial growth factor, angiopoietin 1/2 and the like in the mesenchymal stem cells are over-expressed, so that the self-renewal, multidirectional differentiation, high proliferation and other capabilities of the mesenchymal stem cells are improved, the hematopoietic reconstruction and angiogenesis efficiency is further accelerated, the angiogenesis in the ischemic injury edge area is more favorably induced, the metabolism of the ischemic area is promoted, and the nervous system is repaired.
The embodiment of the invention also provides application of the lentivirus-infected mesenchymal stem cells, and the TSP4 over-expressed mesenchymal stem cells prepared by the preparation method or the lentivirus-infected mesenchymal stem cell preparation are applied to medicines for treating ischemic stroke.
The application of the lentivirus-infected mesenchymal stem cells provided by the embodiment of the invention can realize over-expression of a plurality of angiogenesis factors such as TSP4, vascular endothelial growth factor, angiopoietin 1/2 and the like, has excellent self-renewal, multidirectional differentiation and high proliferation capacities, has high efficiency of hematopoietic reconstruction and angiogenesis, can effectively induce angiogenesis of ischemic injury marginal areas, promote metabolism of ischemic areas and repair the nerve system, and can obviously promote angiogenesis of ischemic areas of stroke and improve angiogenesis efficiency of the ischemic areas so as to promote recovery of the nerve function of ischemic stroke when being applied to the medicine for treating ischemic stroke.
As a preferred embodiment, the mesenchymal stem cell preparation or the mesenchymal stem cell over-expressed by TSP4 prepared by the above preparation method is applied to an intramuscular injection medicament for treating ischemic stroke. According to the embodiment of the invention, the aim of treating ischemic stroke can be fulfilled by locally and intramuscularly injecting the medicament containing the TSP4 overexpressed mesenchymal stem cells, the medicament is convenient to use and directly reaches an affected part, and the curative effect is quick.
In order to clearly understand the details and operation of the above-mentioned embodiments of the present invention and to clearly understand the progress of the method, preparation and application of the present invention for promoting the overexpression of the mesenchymal stem cell TSP4 through lentivirus infection, the above technical solution is illustrated by the following embodiments.
Example 1
A preparation method of Plv-Easy-GFP-TSP4 lentivirus.
(1) Corresponding primers were designed based on the coding region (CDS region) sequence of the plasmid pCMV6-Thbs4 gene using snapgene software: upstream 5 'CGGGATCCATGCCGGCCCCAC 3'; downstream, 5 'CCGCTCGAGATTATCCAAGCGGTC 3'.
(2) And performing polymerase chain reaction amplification on the upper primer in the system of the following table 4 to obtain an oligonucleotide chain.
TABLE 4
Figure BDA0002031005450000151
Figure BDA0002031005450000161
Wherein the DNA template is pCMV6-Thbs4 plasmid, the extension rate is 15-30s/kb, and after the PCR amplification reaction is finished, the gel is recovered and purified to obtain a purified DNA solution.
(3) In the system of the following table 5, the pENTR11 plasmid vector was double digested with XhoI and BamHI to obtain pENTR11 plasmid vector with a cohesive end.
TABLE 5
Figure BDA0002031005450000162
(4) In the ligation reaction system of the following table 6, the pENTR11 plasmid vector with the cohesive end and the oligonucleotide chain are subjected to DNA ligation reaction for 12 hours to obtain pENTR11-TSP4 expression plasmid, and the ligation product pENTR11-TSP4 expression plasmid is subjected to enzyme digestion identification.
TABLE 6
Figure BDA0002031005450000163
(5) Reacting in an LR clonase II enzymeMix culture medium at 25 ℃ overnight according to the dosage ratio of the plasmid Plv-Easy-T of 150-200 ng/ul, the dosage ratio of the pENTR11-TSP4 expression plasmid of 50-150 ng/reactant and the TE buffer solution of 8-10 ul; and then adding 1-2 ul of protease K solution into the system, incubating for 10min at 37 ℃, and stopping the reaction to obtain the Plv-Easy-GFP-TSP4 lentivirus expression plasmid. And carrying out enzyme digestion identification on the ligation product Plv-Easy-GFP-TSP4 lentivirus expression plasmid.
(6) After the enzyme digestion identification is correct, the lentivirus packaging plasmid psPAX2 and pMD.2G are co-transfected into 293T cells to prepare the Plv-Easy-GFP-TSP4 lentivirus.
The product obtained by double digestion of the constructed Plv-Easy-GFP-TSP4 lentivirus expression plasmid through SalI and HindIII is detected by agarose gel electrophoresis, and the detection result is shown in figure 1.
As can be seen from FIG. 1, there are two clear bands at 7256bp and 1720bp, consistent with the expected number of fragments and fragment size. The plasmid pENTR11-TSP4 was proved to be successfully inserted into the Plv-Easy-T vector to obtain the Plv-Easy-GFP-TSP4 lentivirus.
Example 2
A method for culturing bone marrow mesenchymal stem cells BMSC.
(1) SD rats (50 + -10) g are killed by neck-breaking and soaked in 75% alcohol for 10 min.
(2) The rat femur was isolated under sterile conditions, the femoral metaphysis was cut off, and DMEM/F12 complete medium (DMEM/F12+ 20% FBS + 1) was aspirated with a 5ml syringe% double resistance) to 10cm2And blowing and beating the mixture into a cell suspension by a pipette gun in a cell culture dish.
(3) The cell suspension was transferred to a 15ml centrifuge tube, labeled, centrifuged at 800rpm for 10min, and the supernatant was discarded. After complete cell suspension in DMEM/F12 medium, the cell suspension was transferred to 25cm2Placing into a culture flask, and adding 95% CO at 37 deg.C2Culturing in a cell culture box, and changing the culture solution after 48 hours.
(4) When the cell density reached more than 80%, the cells were digested with 0.25% trypsin and passed to 75cm2The cell culture flask continues to culture.
(5) Waiting for 75cm2When the cell density in the cell culture flask is more than 80%, digesting the cells by using 0.25% trypsin, stopping digestion by using complete culture medium, centrifuging, and resuspending the cells by using PBS to obtain the BMSC.
The phenotypic characteristics of the cells were analyzed by flow cytometry using CD90(BMSC surface characteristic marker), CD34 (lymphocyte marker) and CD45 (hematopoietic stem cell marker) (eBioscience, San Diego, Calif., USA), and the results of flow assay of bone marrow mesenchymal stem cells are shown in FIG. 2.
As shown in the attached figure 2, the positive rate of CD90 (a characteristic marker of the surface of the mesenchymal stem cells) is as high as 99.76%, which indicates that the purification degree of the mesenchymal stem cells is good. However, the positive rate of CD45 (lymphocyte marker) is 2.74%, and the positive rate of CD34 (hematopoietic stem cell marker) is 3.55%, which indicates that the impurity cells in the bone marrow mesenchymal stem cells obtained by culture are few, further indicating that the bone marrow mesenchymal stem cells are highly purified.
Example 3
A method for infecting mesenchymal stem cells (TSP4-BMSC) with Plv-Easy-GFP-TSP4 lentivirus.
(1) Inoculating the bone marrow mesenchymal stem cells into a cell culture bottle, and culturing in a DMEM/F12+ 10% FBS + 1% double antibody culture medium at 37 ℃ in a cell culture box until the density of the bone marrow mesenchymal stem cells is 80% to obtain a first culture product;
(2) replacing the culture medium of the first culture product with a culture medium containing DMEM/F-12 and 5% FBS, and culturing at 37 ℃ for 2 hours to obtain a second culture product;
(3) replacing the culture medium of the second culture product with a lentivirus culture medium, and culturing for 6 hours at 37 ℃ to obtain a third culture product;
(4) and replacing the culture medium of the third culture product with a culture medium containing DMEM/F-12, 5% FBS and 1% o GM, and culturing for 72 hours to obtain the lentivirus-infected mesenchymal stem cells (TSP 4-BMSC).
The infection efficiency of GFP (green fluorescent protein) positive cells is detected, the percentage is 76.95% + -0.0278, as shown in figure 3, the bone marrow mesenchymal stem cells before infection have no GFP, and obvious and uniformly distributed GFP can be observed in the bone marrow mesenchymal stem cells after lentivirus infection, which indicates that the infection is successful.
Example 4
Measurement of angiogenesis effect of Plv-Easy-GFP-TSP4 lentivirus infected bone marrow mesenchymal stem cells (TSP4-BMSC) on rat MCAO (middle cerebral artery occlusion) model ischemic area.
Three groups of rats (MCAO group, BMSC + MCAO group, TSP4-BMSC + MCAO group) were individually subjected to paraffin-embedded section in cerebral ischemic areas, and then subjected to von Willebrand factor vWF immunohistochemical staining to determine whether TSP4-BMSC could promote angiogenesis in the ischemic areas of MCAO rats.
Selecting rats (n ≧ 3) of different experimental groups respectively, carrying out intraperitoneal injection (3.0ml/kg) anesthesia by using 10% chloral hydrate, and carrying out heart perfusion on the rats by using 0.9% physiological saline and 4% paraformaldehyde.
② taking rat brain, cutting brain tissue with the size of about 1 × 2cm in the ischemic peripheral area, embedding in paraffin, and preparing 5um continuous coronal sections.
Thirdly, putting the slices into a 60 ℃ oven to be baked for 2h, taking out the slices, putting the slices into dimethylbenzene to dewax for three times while the slices are hot, wherein each time is 10min, absolute ethyl alcohol is soaked for 10min, 90% ethyl alcohol is soaked for 5min, and 80% ethyl alcohol is soaked for 3 min.
And fourthly, soaking the slices in PBS, and washing for 3 times, 3min each time.
Preparing 1X citric acid repairing solution, and soaking the slices in the antigen repairing solution for 240 ℃ for 3 min.
Sixthly, naturally cooling the antigen repairing solution to the temperature lower than 50 ℃, soaking the slices in PBS, and washing for 3 times, 2min each time.
Seventhly, circle is drawn by an immunohistochemical pen, tissues are placed in the circle, 50ul of 3% H2O2 is dripped into the circle to be incubated for 5min so as to remove endogenous catalase, and then the slices are soaked in PBS and washed for 3 times, 2min each time.
Preparing primary anti-working solution (1: 200), dripping 60ul of the primary anti-working solution on the tissue, and incubating overnight at 4 ℃.
Ninthly, soaking the slices in PBS, and washing for 3 times, 3min each time. Preparing a secondary antibody working solution with corresponding resistance, dripping 60ul of the secondary antibody working solution on the tissue, and incubating for 10min at room temperature.
The slices were soaked in PBS and washed 3 times 3min each time. A3, 3' -diaminobenzidine (DAB; Dako) indicator solution was prepared and the color change was observed without deep dyeing.
Figure BDA0002031005450000191
The nuclei were counterstained with hematoxylin and the sections were rinsed with tap water.
Figure BDA0002031005450000192
Soaking in 80% ethanol for 3min, soaking in 90% ethanol for 5min, and soaking in anhydrous ethanol for 10 min.
Figure BDA0002031005450000193
Images were taken using an inverted phase contrast microscope (Axio Observer3, Carl Zeiss AG).
Immunohistochemical analysis was performed on tissue sections of ischemic brain areas of rats 28 days after the operation, and as shown in fig. 4, the results showed that the positive expression rate of vWF, a vascular endothelial cell marker, was significantly higher in the TSP4-BMSC + MCAO group than in the MCAO group and BMSC + MCAO group (. p < 0.01). As shown in figure 5, the vascular endothelial cell marker vWF of the TSP4-BMSC + MCAO group is significantly increased in number, maximal in density, high in angiogenesis efficiency and indicative of a large number of blood vessels, and the TSP4-BMSC can promote angiogenesis in cerebral ischemic areas of MCAO rats.
Example 5
The result of measurement of the nerve function recovery promoting effect of Plv-Easy-GFP-TSP4 lentivirus infected mesenchymal stem cells (TSP4-BMSC) on rat MCAO middle cerebral artery occlusion model.
Dividing experimental rats into four groups (MCAO group, BMSC + MCAO group, TSP4-BMSC + MCAO group and sham operation group), respectively selecting rats successfully modeled on the first day after operation, determining experimental group, and uniformly injecting 2 x 10 in tail vein into BMSC + MCAO group and TSP4-BMSC + MCAO group6Each of BMSCs and TSP4-BMSCs, MCAO group injected with equal amount of 0.9% physiological saline, and sham group only incised skin without ligation of blood vessel.
Four groups of rats were scored for neurological function using the Garcia JH score scale on days 1, 3, 7, 14, and 28 post-surgery, respectively, in example 4. As shown in figure 6, the sham operated group had normal nerve function and the highest score for nerve function, and the higher the bar bars in the experimental group, the closer the nerve function was to normal, and the more obvious the effect of promoting recovery of nerve function. The neurological score of TSP4-BMSC + MCAO group was increased from day 7 compared to both MCAO group and BMSC + MCAO group and continued until day 28 (. sp. <0.01,. sp. < 0.05). Shows that TSP4-BMSC treatment can obviously promote the recovery of rat nerve function.
The above results fully indicate that the mesenchymal stem cells over-expressed by TSP4 provided by the embodiments of the present invention can be applied to the drugs for treating ischemic stroke diseases, and can significantly promote the angiogenesis function of ischemic areas of stroke, and improve the angiogenesis efficiency of ischemic areas, thereby promoting the recovery of neurological function of ischemic stroke.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.
SEQUENCE LISTING
<110> Shenzhen Luhu regional people hospital
<120> method for promoting overexpression of mesenchymal stem cell TSP4, preparation and application thereof
<130>2019.4.10
<160>2
<170>PatentIn version 3.3
<210>1
<211>21
<212>DNA
<213> upstream primer
<400>1
cgggatccat gccggcccca c 21
<210>2
<211>24
<212>DNA
<213> downstream primer
<400>2
ccgctcgaga ttatccaagc ggtc 24

Claims (10)

1. A method for promoting overexpression of mesenchymal stem cell TSP4 by lentivirus infection, comprising the steps of:
obtaining pCMV6-Thbs4 plasmid, designing an amplification primer of TSP4 according to the gene coding region sequence of the pCMV6-Thbs4 plasmid, and carrying out polymerase chain reaction amplification to obtain oligonucleotide chain;
obtaining pENTR11 plasmid vector, adopting XhoI and BamHI to carry out double enzyme digestion on the pENTR11 plasmid vector, and obtaining pENTR11 plasmid vector with viscous tail end; carrying out DNA connection reaction on the pENTR11 plasmid vector with the cohesive tail end and the oligonucleotide chain to obtain pENTR11-TSP4 expression plasmid;
obtaining a Plv-Easy-T plasmid, and connecting the Plv-Easy-T plasmid with the pENTR11-TSP4 expression plasmid to obtain a Plv-Easy-GFP-TSP4 lentivirus expression plasmid;
co-transfecting the Plv-Easy-GFP-TSP4 lentivirus expression plasmid with a lentivirus packaging plasmid psPAX2 and pMD.2G to obtain Plv-Easy-GFP-TSP4 lentivirus;
obtaining mesenchymal stem cells, and infecting the mesenchymal stem cells by the Plv-Easy-GFP-TSP4 lentivirus to obtain the mesenchymal stem cells with TSP4 over-expression.
2. The method for promoting overexpression of mesenchymal stem cell TSP4 by lentiviral infection as recited in claim 1, wherein the step of ligation comprises:
obtaining a TE buffer solution and an LR clonase II enzyme Mix culture medium, adding a plasmid Plv-Easy-T, pENTR11-TSP4 and a TE buffer solution into the LR clonase II enzyme Mix culture medium according to the concentration that the dosage of the plasmid Plv-Easy-T is 150-200 ng/ul, the dosage of the pENTR11-TSP4 expression plasmid is 50-150 ng/reactant and the TE buffer solution is 8-10 ul/ul.culture medium, and reacting for 12-24 hours at the temperature of 25-30 ℃;
then adding 1-2 ul/ul of proteinase K solution in a culture medium, and reacting for 10-20 minutes at the temperature of 35-40 ℃ to obtain the Plv-Easy-GFP-TSP4 lentivirus expression plasmid.
3. The method for promoting overexpression of mesenchymal stem cell TSP4 by lentiviral infection as recited in claim 1, wherein the primers comprise an upstream primer and a downstream primer, and the sequences of the upstream primer and the downstream primer are as follows:
the upstream primer is 5 'CGGGATCCATGCCGGCCCCAC 3',
downstream primer 5 'CCGCTCGAGATTATCCAAGCGGTC 3'.
4. The method for promoting overexpression of mesenchymal stem cell TSP4 by lentiviral infection as recited in claim 1, wherein the DNA ligation reaction system comprises:
Figure FDA0002031005440000021
5. the method for promoting overexpression of the mesenchymal stem cell TSP4 by lentiviral infection as recited in any one of claims 1 to 4, wherein the mesenchymal stem cell is selected from the group consisting of: bone marrow mesenchymal stem cells, umbilical cord mesenchymal stem cells, placental mesenchymal stem cells or adipose mesenchymal stem cells.
6. The method for promoting overexpression of mesenchymal stem cell TSP4 by lentiviral infection as recited in claim 5, wherein the mesenchymal stem cell is selected from the group consisting of: mesenchymal stem cells of the third to sixth generations.
7. The method for promoting overexpression of mesenchymal stem cell TSP4 by lentiviral infection as recited in claim 1 or 6, wherein the step of infecting the mesenchymal stem cells with the Plv-Easy-GFP-TSP4 lentivirus comprises:
inoculating the mesenchymal stem cells into a cell culture bottle containing a first culture medium, and culturing in a cell culture box at the temperature of 35-40 ℃ until the density of the mesenchymal stem cells is 75-85% to obtain a first culture product, wherein the first culture medium is a DMEM/F12 culture medium containing FBS and a double antibody, the mass percentage of the FBS accounts for 10% of the total mass of the first culture medium, and the mass percentage of the double antibody accounts for 1% of the total mass of the first culture medium;
replacing the culture medium of the first culture product with a second culture medium, and culturing for 2-4 hours at 35-40 ℃ to obtain a second culture product, wherein the second culture medium is DMEM/F12 medium containing FBS, and the mass percentage of the FBS accounts for 5% of the total mass of the second culture medium;
replacing the culture medium of the second culture product with a lentivirus culture medium, and culturing for 5-8 hours at 35-40 ℃ to obtain a third culture product;
and replacing the culture medium of the third culture product with a third culture medium, and culturing for 48-72 hours to obtain the TSP4 overexpressed mesenchymal stem cells, wherein the third culture medium is a DMEM/F12 culture medium containing FBS and GM, the mass percentage of the FBS accounts for 5% of the total mass of the third culture medium, and the mass percentage of the GM accounts for 1% of the total mass of the third culture medium.
8. The method for promoting overexpression of mesenchymal stem cell TSP4 by lentiviral infection according to claim 7, wherein the culture medium of the lentivirus is DMEM/F-12 medium containing FBS, polybrene and supernatant of Plv-Easy-GFP-TSP4 lentivirus, wherein the FBS accounts for 5% by mass of the total mass of the lentivirus culture medium, the polybrene has a concentration of 8ng/ml culture medium, and the supernatant of the Plv-Easy-GFP-TSP4 lentivirus has a concentration of (0.5-1) ml/ml culture medium.
9. A lentivirally-infected mesenchymal stem cell preparation, comprising: TSP4 overexpressed mesenchymal stem cells produced by the method of any one of claims 1 to 8.
10. The use of the lentivirus-infected mesenchymal stem cells, which are the mesenchymal stem cells over-expressed by TSP4 prepared by the preparation method as described in any one of claims 1 to 8, or the lentivirus-infected mesenchymal stem cell preparation as described in claim 9 in the preparation of medicines for treating ischemic stroke.
CN201910309552.3A 2019-04-17 2019-04-17 Method for promoting overexpression of mesenchymal stem cell TSP4, and preparation and application thereof Pending CN111826399A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910309552.3A CN111826399A (en) 2019-04-17 2019-04-17 Method for promoting overexpression of mesenchymal stem cell TSP4, and preparation and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910309552.3A CN111826399A (en) 2019-04-17 2019-04-17 Method for promoting overexpression of mesenchymal stem cell TSP4, and preparation and application thereof

Publications (1)

Publication Number Publication Date
CN111826399A true CN111826399A (en) 2020-10-27

Family

ID=72914300

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910309552.3A Pending CN111826399A (en) 2019-04-17 2019-04-17 Method for promoting overexpression of mesenchymal stem cell TSP4, and preparation and application thereof

Country Status (1)

Country Link
CN (1) CN111826399A (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101497876A (en) * 2009-02-03 2009-08-05 北京大学人民医院 Recombinant adenovirus for expressing targetedly proliferating recombinant adenovirus for expressing proapoptosis gene and use thereof
CN104250655A (en) * 2014-08-29 2014-12-31 杭州市萧山区中医院 BMP(bone morphogenetic protein)-2/VEGF(vascular endothelial growth factor)165 double gene modified bone marrow mesenchymal stem cells and preparation method thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101497876A (en) * 2009-02-03 2009-08-05 北京大学人民医院 Recombinant adenovirus for expressing targetedly proliferating recombinant adenovirus for expressing proapoptosis gene and use thereof
CN104250655A (en) * 2014-08-29 2014-12-31 杭州市萧山区中医院 BMP(bone morphogenetic protein)-2/VEGF(vascular endothelial growth factor)165 double gene modified bone marrow mesenchymal stem cells and preparation method thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
QIAN ZHANG等: "Promoting therapeutic angiogenesis of focal cerebral ischemia using thrombospondin‑4(TSP4) gene‑modified bone marrow stromal cells (BMSCs) in a rat model", 《JOURNAL OF TRANSLATIONAL MEDICINE》 *
徐寒梅主编: "《抗肿瘤药物药理学实验指南：符合CFDA临床研究申报要求的试验方法》", 31 October 2015, 中国医药科技出版社 *
陶永光主编: "《肿瘤分子生物学与细胞生物学实验手册》", 30 November 2014, 湖南科学技术出版社 *

Similar Documents

Publication Publication Date Title
CN105154407B (en) Preparation method and application of human adipose-derived stem cells with improved skin repair function
JP2023120412A (en) Non-integrating viral delivery systems and methods related thereto
CN107794280B (en) Targeted cell-penetrating peptide gene vector and application thereof
CN106167791B (en) MSC-TNF alpha-AB stem cell and preparation method and application thereof
CN108753730A (en) The umbilical cord mesenchymal stem cells and its construction method of a kind of NTF4 genetic modifications and application
CN110656087B (en) MANF gene modified umbilical cord mesenchymal stem cell and preparation method and application thereof
CN108465108B (en) Specific gene target for preventing or treating brain glioma
CN111826399A (en) Method for promoting overexpression of mesenchymal stem cell TSP4, and preparation and application thereof
CN111840327B (en) Mesenchymal stem cell preparation for treating diabetic foot and application thereof
CN111733161B (en) Application of circ6148 and recombinant vector thereof in promoting angiogenesis
CN110669763B (en) MSCs bracket for bone defect repair and preparation thereof
CN109266684B (en) Method for constructing animal model with pathogen infection sensitivity
CN112458095B (en) LMO3 gene for regulating and controlling ADSCs osteogenic differentiation and tissue regeneration and application thereof
CN105018524A (en) Preparation method and kit of human stem cell with prolonged service life and enhanced angiogenesis
CN115094090B (en) Cell modified by specific heparan sulfate modified enzyme gene, construction method and application thereof
CN111549033B (en) Lentiviral-infected human epidermal keratinocyte strain and construction method and application thereof
WO2012045286A1 (en) Recombinant vector and fibroin membrane modified by transgenic bone stromal cell, and application thereof
CN114507677B (en) Application of Ndefs 1 gene in treating heart failure after myocardial infarction and related products
CN114941013B (en) Recombinant mesenchymal stem cells for treating diabetic pneumonia
CN116716302B (en) Nucleic acid molecule for reducing NEK2 gene expression in esophageal cancer cells
CN113817733B (en) LncRNA transcribed from 34kb region upstream of MYB gene, expression vector and application thereof
CN103301474B (en) Usage and related drugs of human RNF40 gene
CN117398403A (en) Use of LMO7 inhibitor in preparation of glioma treatment products
CN106267208A (en) The purposes of RPS15A gene and related drugs thereof
CN112111515A (en) ND4 gene recombinant adeno-associated virus vector and preparation method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20201027

RJ01 Rejection of invention patent application after publication