CN110669763B

CN110669763B - MSCs bracket for bone defect repair and preparation thereof

Info

Publication number: CN110669763B
Application number: CN201910915285.4A
Authority: CN
Inventors: 郑成云; 姜杨
Original assignee: Second Hospital of Shandong University
Current assignee: Second Hospital of Shandong University
Priority date: 2019-09-26
Filing date: 2019-09-26
Publication date: 2020-05-19
Anticipated expiration: 2039-09-26
Also published as: CN110669763A

Abstract

The invention provides a MSCs bracket for bone defect repair and a preparation method thereof. Packaging and preparing lentivirus by siPDCD4 plasmid with a tagged gene, then infecting MSCs cells, and obtaining a stable transgenic cell line siPDCD4-MSCs after resistance screening; and (3) mixing and culturing the scaffold material and a siPDCD4-MSCs cell line to obtain the MSCs scaffold material with PDCD4 gene deletion. The invention provides a preparation method of a composite material of a PDCD 4-knocked down MSCs bracket, which is used for treating and repairing bone defects and provides application of the method in treating and repairing the bone defects. The cell-scaffold composite material provided by the invention has the advantages of simple preparation method, good histocompatibility and bone repair function, and wide application prospect in the fields of bone tissue engineering and regenerative medicine.

Description

MSCs bracket for bone defect repair and preparation thereof

Technical Field

The invention belongs to the field of bone tissue engineering and regenerative medicine, particularly relates to a MSCs-stent material, and particularly relates to a PDCD4 gene-knocked-down MSCs stent compound and a preparation method thereof.

Background

Failure of bone healing can ultimately lead to malformed healing, delayed healing, nonunion, or osteomyelitis. Improving the repair of bone defects facilitates bone healing, reduces the occurrence of deformities and related complications, and significantly improves the quality of life of patients. However, severe bone defects are difficult to heal and repair by themselves and must be effectively restored by some assistance. Currently, there are three main methods for the clinical auxiliary treatment of bone defect repair: autologous bone grafting, allogeneic bone grafting and bone tissue engineering. Autologous bone grafting often causes additional physical trauma to the patient and does not meet the need for a wide range of bone defects. The allogeneic bone is difficult to be widely applied due to the donor limitation, rejection reaction, infection and infection of diseases, complication and other risks. Therefore, finding a new, safe method to assist in bone defect repair is a major task of current research.

The bone tissue engineering method can avoid the defects of autologous bone and allogeneic bone transplantation, and has the advantages of simple and convenient source, capability of being massively copied in vitro, no rejection and inflammatory reaction, and the like. At present, the research on bone tissue engineering mainly focuses on the research on biological scaffold materials, seed cells and factors. At present, research on promotion of bone injury repair by Mesenchymal Stem Cells (MSCs) as seed cells is receiving more and more attention. MSCs are adult stem cells derived from mesoderm, having multipotentiality and self-renewal ability, and can differentiate in the direction of osteoblasts and chondroblasts, and when damaged, can chemotactic to damaged tissues to promote tissue repair, secrete cytokines, exert immunoregulatory function, and promote angiogenesis. The recruitment, proliferation and differentiation of bone injury part MSCs into osteoblasts play an important role in the bone repair process, and the recruitment of a sufficient number of MSCs in the injury part is a precondition and a cytological basis for bone injury repair. However, the capacity of a single seed cell is limited, which is not enough to meet clinical needs, so that genetic modification of the seed cell and combination of a biological scaffold material become important means for solving the problems at present.

Programmed cell death 4 (PDCD 4) is a classical cancer-inhibiting and protein translation inhibiting gene, can also inhibit gene transcription, and plays a certain role in inhibiting cancers in various solid tumors. In recent years, PDCD4 has been found to play a role not only in oncogene inhibition, but also in regulation of immune response, thereby participating in the mechanism of development of autoimmune or inflammatory reactive diseases. The PDCD4 is the most main downstream target gene of miR-21, and miRNA is specifically combined with 3' -UTR of target mRNA to degrade or translationally inhibit the target mRNA. Relevant researches show that miRNA-21 is highly expressed in bone marrow stromal cells, and inhibition of the expression of the miRNA-21 can obviously reduce the activity of osteoclasts and promote the formation of bone; however, related researches report that the over-expression of miRNA-21 can promote the differentiation of MSCs into osteoblasts or adipocytes, and thus, no clear conclusion about the role of miRNA-21 in the osteogenesis process exists.

the PRP is firstly applied to clinic as a biological gel and a barrier membrane, and mainly has the function of improving the hemostatic effect.

In bone tissue engineering, the preparation of cell-scaffold composite material is a key link, the adhesion, growth and proliferation of cells on the surface of the scaffold are restricted by various factors, and the biocompatibility of the composite material and tissues is also an important factor influencing the repair effect of bone defect. Therefore, it is desirable to provide a cell-scaffold composite material having good growth properties to improve bone defect repair.

Disclosure of Invention

Aiming at the problems of poor adhesion, growth and proliferation and poor bone defect repair effect of the existing cell-scaffold composite material, the invention provides the PDCD4 gene-knocked-down MSCs scaffold composite material, which has good cell growth and proliferation and can effectively improve the bone defect repair efficiency.

In order to achieve the purpose, the invention adopts the following technical scheme.

A target sequence of the siRNA for PDCD4 gene knockdown is shown in SEQ ID 1 or SEQ ID 2.

The Genbank accession number of the mRNA of the PDCD4 gene is NM-014456.

Preferably, the siRNA comprises the nucleic acid sequence shown as SEQ ID 3 and SEQ ID 4 or SEQ ID 5 and SEQ ID 6.

In order to transfer the siRNA into the vector plasmid, the 5' -ends of both strands of the siRNA also include a cleavage site to obtain a sticky end, such as Age I cleavage site (ccgg) or EcoR I cleavage site (ttaa), respectively. Specifically, the nucleic acid sequence of the siRNA is shown as SEQ ID 7 and SEQ ID 8 or SEQ ID 9 and SEQ ID 10.

The siRNA can be applied to the preparation of medicines or materials for treating bone injury.

A method for preparing PDCD4 gene-knocked-down MSCs stent material by using the siRNA comprises the following steps:

(1) packaging and preparing lentivirus by using siRNA-PDCD4(siPDCD4) target plasmid, then infecting MSCs (mesenchymal cells), and obtaining stable transgenic cell lines siPDCD4-MSCs after screening;

(2) and (3) mixing and culturing the scaffold material and a siPDCD4-MSCs cell line to obtain the MSCs scaffold material with PDCD4 gene deletion.

The MSCs cells may be of human bone marrow, umbilical cord or adipose origin, preferably of umbilical cord origin.

The scaffold material is selected from hydroxyapatite, tricalcium phosphate, alumina bioceramics, polylactic acid, polymethyl methacrylate, polyglycolic acid, collagen, and PRP (platelet rich plasma) gel. PRP gel is preferred.

Further, the preparation method of the MSCs-PRP scaffold comprises the following steps: PRP and siPDCD4-MSCs cell line are mixed and added with thrombin to obtain PDCD4 gene-deleted MSCs-PRP stent material.

The target plasmid carries a marker gene and a reporter gene. The reporter gene may be a Luc (luciferase) gene or a GFP (green fluorescent protein) gene; the marker gene may be one or more of antibiotic resistance genes. Preferably, the antibiotic resistance gene is a puromycin resistance gene or/and an ampicillin resistance gene.

A MSCs scaffold material obtained by the above process.

An application of the MSCs bracket material as a bone injury repair material.

The invention has the following advantages:

the invention provides a preparation method of a PDCD 4-knocked down MSCs stent composite material, which is used for treating and repairing bone defects and is combined with an embodiment to explain the application of the method in the treatment and repair of the bone defects. The cell-scaffold composite material provided by the invention has the advantages of simple preparation method, good histocompatibility and bone repair function, and wide application prospect in the fields of bone tissue engineering and regenerative medicine.

Drawings

FIG. 1 is a schematic diagram of siRNA structure;

FIG. 2 shows the identification of PDCD4 in mRNA and protein expression in PDCD 4-knocked-down MSCs stably transfected cell line;

FIG. 3 is a graph of the effect of PDCD4 knockdown on the phenotype of MSCs;

FIG. 4 shows the migration, in vitro osteogenesis, adipogenesis, chondrogenesis induced differentiation results of Mock and PDCD 4-knocked-down MSCs;

fig. 5 is a micro-CT image of different MSCs-PRP scaffold composites for rabbit bone defect repair.

Detailed Description

The present invention will be further described with reference to the following examples and drawings, but the present invention is not limited to the following examples.

Example 1 construction and identification of PDCD 4-knockdown stable transgenic cell lines of MSCs

Construction of PDCD 4-knockdown MSCs Steady Transit cell line

1.1. Separation, culture and amplification of human umbilical cord MSCs

Collecting umbilical cord tissue of newborn (the parturient has signed an informed consent), adding a small amount of DMEM/F12 complete medium (10% FBS, 0.272g/L L-glutamine, 10ng/mL bFGF, 100U/mL penicillin, 100mg/mL streptomycin), and sterile-cutting with sterile scissors in a sterile operating tableCutting tissue as much as possible, digesting with 0.125% pancreatin and 1% collagenase II for half an hour, collecting liquid, centrifuging at 1500rpm for 10min in a 15mL centrifuge tube, discarding supernatant, adding cell precipitate into the DMEM/F12 complete culture solution for resuspension, transferring to a cell culture flask, placing in an incubator, and incubating at saturated humidity, 37 deg.C and 5% CO₂Incubate under conditions, aspirate supernatant on day 3, remove nonadherent cells and tissue debris, add fresh medium, and replace fresh medium every other day thereafter. When the cell density is 80%, sucking off the supernatant, washing the cells once with PBS, adding 0.25% pancreatin for digestion, adding a complete culture medium after the cells become round and float, stopping the reaction, collecting the liquid, centrifuging, then passaging 1 bottle of cells into 3 bottles of cells, adding a fresh culture medium for continuous culture, and using the fourth generation cells for experiments.

1.2 genetic modification of MSCs and establishment of Stable transgenic cell lines

293T cells (ATCC CRL-3216) were used as tool cells, and three-plasmid systems were as follows, according to Mock-GV248 or siPDCD4-GV248 (Kjekay Gentechnology Co., Ltd., Shanghai): psPAX 2: pmd2.g ═ 4:3:1, added Lipofectamine 3000 transfection reagent to assist in packaging lentivirus, virus supernatants were collected after 3 days, and virus was concentrated by ultracentrifuge centrifugation. The titer is determined by infecting 293T cells with concentrated virus, the virus titer is 3X 10⁸TU/mL or more can be used. MSCs were counted, resuspended in opti-MEM, and plated at 2X 10⁵The concentration of each well is 6-well plate, Mock and siPDCD4 lentivirus are added according to MOI of 40, the medium is changed into complete culture medium after 12h, the infection efficiency is observed by a fluorescence microscope after 3 days, and 1 × 10 is taken from the digestive cells⁵And (4) detecting the percentage of GFP positive by using a flow cytometer for each cell, wherein the percentage of GFP positive is the virus infection positive rate. Adding puromycin with the final concentration of 2 mug/mL into the cells, dying and floating uninfected cells after 2 days, obtaining the surviving cells as positive cells, and continuously culturing and amplifying to obtain a PDCD 4-knocked down MSCs stable cell line; the sequences of siRNA and Mock for PDCD4 knockdown are shown in table 1.

TABLE 1 DNA sequences for siRNA and Mock production

the preparation process of Mock-GV248 or siPDCD4-GV248 comprises the steps of annealing paired single-stranded DNA to form siRNA (shown in figure 1), carrying out double enzyme digestion by AgeI and EcoR I, connecting to a linear GV248 plasmid subjected to the same double enzyme digestion by T4 ligase, then transforming competent Escherichia coli DH5 α, extracting a plasmid from a positive colony, and preferably preparing a siPDCD4-MSCs stable transfer cell line by siPDCD4-2 after successful verification.

Identification of PDCD 4-knockdown MSCs Steady Transit cell lines

Identification of PDCD4 expression in PDCD 4-knocked-down MSCs stably transfected cell line

Two stable transfectant cell lines of Mock and siPDCD4-MSCs are subjected to amplification culture, 0.25 percent of pancreatin is used for digesting the cells, counting is carried out, and 1 multiplied by 10 is taken⁶mRNA of each cell is extracted according to the kit instructions, and the mRNA is reversely transcribed into cDNA. The Real time PCR method detects the expression of PDCD4 at the mRNA level, and the primer sequence is as the upstream: 5'-ACAGGTGTATGATGTGGAGGA-3' (SEQ ID NO:11), downstream: 5'-TTCTCAAATGCCCTTTCATCCAA-3' (SEQ ID NO:12), the product size is 114 bp; taking glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as an internal reference gene, and taking a primer sequence as an upstream: 5'-AACGGATTTGGTCGTATTGGG-3' (SEQ ID NO:13), downstream: 5'-CCTGGAAGATGGTGATGGGAT-3' (SEQ ID NO:14), with a product size of 211 bp; the amplification product was subjected to electrophoresis using 2% agarose gel.

The three groups of cells are 1 × 10⁶the cell is cracked by RIPA lysate, a protein sample is prepared, expression of PDCD4 in the protein level is detected by Western blot electrophoresis, β -actin (actin) is used as reference protein, the protein concentration of the protein sample is determined by a BCA method, the protein sample with the same amount is transferred to a PVDF membrane by a membrane transfer instrument after being subjected to SDS-PAGE gel electrophoresis separation, the PVDF membrane is sealed at 5% BSA room temperature for 1h, an anti-mouse PDCD4 antibody is added, the temperature is kept overnight at 4 ℃, a TBST washing membrane is added, a horseradish peroxidase-labeled secondary antibody is added, the TBST washing membrane is incubated at room temperature for 1h, and development is carried out by the action of a chemiluminescence substrate, and the nucleic acid and protein electrophoresis result is shown in figure 2, namely PDCD4 in a stable cell line of siPDCD4-MSCs is obviously inhibited in the expression of mRNA and the protein level, and the knock-down efficiency is more than.

Identification of PDCD 4-knockdown MSCs Steady-Transit cell line phenotype

The cell lines of Mock and siPDCD4-MSCs were transfected with 0.25% pancreatin and counted, 1.8X 10 cells each⁶Each cell is divided into 9 tubes, each tube is 2X 10⁵The cells were washed once with PBS, and the two groups of 9-tube cells were resuspended in 100. mu.L PBS, isotype IgG, PerCP-labeled CD73, PerCP-labeled CD90, PE-labeled CD105, APC-labeled CD45, PE-labeled HLA-DR, APC-labeled CD34, APC-labeled CD19, and PE-labeled CD11b were added, incubated at room temperature in the dark for 20min, washed once with 1mL PBS, resuspended in 400. mu.L PBS, and examined on a flow cytometer. The results are shown in FIG. 3: the knockdown of PDCD4 did not affect the phenotype of MSCs, positive markers CD73, CD90 and CD105, negative markers CD45, HLA-DR, CD34, CD19 and CD11 b.

Identification of function of PDCD 4-knocked-down MSCs stably transfected cell line

3.1 identification of the migration function of PDCD 4-knocked-down stable transgenic cell lines of MSCs the stable transgenic cell lines of Mock and siPDCD4-MSCs were digested with 0.25% of pancreatin, counted, and 1X 10 cells each were taken⁵The cells are resuspended by using a complete medium of 1% FBS, a transwell chamber 24-hole plate with the aperture of 8 mu m is adopted, 600 mu L of the complete medium of 30% FBS is added into the lower layer, two kinds of resuspended stable cell lines are added into the upper layer, the cells on the inner wall of the chamber are wiped off by using a cotton stick after 24h, the cells on the outer wall are fixed for 20min by using 4% paraformaldehyde after being washed in the hole plate by using PBS, the cells are washed for 2 times by using PBS, the cells are dyed for 30min by using 0.1% crystal violet solution at room temperature, the cells are washed for 3 times by using PBS, and the cells are. The results are shown in FIG. 4A, and the cell migration ability of the siPDCD4-MSCs stable cell line is obviously enhanced.

3.2 identification of PDCD 4-knocked-down MSCs Steady-Transit cell line differentiation function

The cell lines of Mock and siPDCD4-MSCs were transfected with 0.25% pancreatin, counted and 4X 10 cells each⁴A cell size of 2X 10⁴Inoculating each cell/well in 6-well plate, making culture medium for inducing osteogenesis and adipogenic differentiation after overnight adherence, and taking 2 × 10⁵After resuspending the individual cells in 500. mu.L chondrogenic differentiation medium, the cells were inoculated into a 15mL centrifuge tube and centrifuged to form spheres, which were then placed at 37 ℃ in 5% CO₂And (5) standing and culturing in an incubator. Inducing according to the specification of osteogenesis, adipogenesis and chondrogenesis differentiation kits (Seikaga) respectively, changing liquid every 2-3 days, and inducing for 2-4 weeks. And (3) when the osteogenesis and adipogenesis differentiation induction culture is finished, removing culture supernatant, washing the cells twice by using PBS, and fixing the cells for 20min at room temperature by using 4% paraformaldehyde. The fixation solution is discarded, PBS is washed for 2 times, and 1 mL/hole of alizarin red and oil red O staining solution is respectively added for staining for 15 min. Alizarin red/oil red O staining solution was discarded and washed 3 times with PBS. Observed under a microscope and photographed. Osteogenic differentiation calcium crystals were red colored, and adipogenic differentiation lipid was dropped red colored. And (3) when the chondroblast differentiation induction culture is finished, removing culture supernatant, washing the cells twice by PBS, fixing the cells for 1h at room temperature by 4% paraformaldehyde, removing fixing liquid, washing for 2 times by PBS, dehydrating, embedding in paraffin and slicing. Dewaxing and rehydrating the slices, dyeing with an alisin blue dye solution for 30min, washing with running water for 5min, dehydrating, sealing with transparent and neutral gum, observing under a microscope, and taking a picture. Chondrogenic differentiation acid mucopolysaccharides are blue-colored. The results are shown in FIGS. 4B-D, and siPDCD4-MSCs have obviously increased osteogenic differentiation capacity of the stable cell line, and no obvious change in adipogenic differentiation capacity and chondrogenic differentiation capacity.

Example 2 preparation of PDCD4 knockdown MSCs-PRP scaffold composites

Extraction of PRP

Using a 10mL syringe filled with 2mL of 10% sodium citrate anticoagulant in advance to extract 8mL of blood from the central artery of a rabbit ear, turning upside down and mixing uniformly, transferring the blood into a centrifuge tube, centrifuging for 10min at 200g, separating the blood into three layers of plasma at the upper layer, platelet white cells at the middle layer and red cells at the lower layer, sucking all the plasma at the upper layer, the red cells at the middle layer and the red cells at the lower layer with the height of about 1mm into another centrifuge tube, centrifuging for 10min at 250g, separating the plasma into Platelet Poor Plasma (PPP) at the upper layer, PRP at the middle layer and a small amount of red cells at the lower layer, discarding the PPP at the upper layer, sucking about 1.5mL of liquid at the middle layer, shaking uniformly to obtain.

Preparation of PDCD4 gene-deleted MSCs-PRP stent composite material

5000U of bovine thrombin is added into 5mL of sterile 10% calcium chloride solution to be dissolved and mixed evenly for standby. 0 was used for transfected Mock-MSCs and siPDCD4-MSCs siPDCD4-MSCs cells.Digesting with 25% pancreatin, counting, and resuspending with physiological saline to obtain the final cell concentration of 1.0 × 10⁷And (2) taking 100 mu L of cell suspension, uniformly mixing the cell suspension with 100 mu L of PRP, and adding 20 mu L of bovine thrombin to coagulate into gel, namely the PDCD4 gene-deleted MSCs-PRP stent gel. PRP Stent control A gel was prepared by adding 20. mu.L of bovine thrombin to 200. mu.L of PRP.

Example 3 application of PDCD4 to knockdown of MSCs-PRP stent composite

1. Establishment of bone defect repair model

Injecting 20% urethane by intravenous injection at the ear margin of a rabbit at 1g/kg for anesthesia, performing unhairing treatment on unhairing cream at the knee joint, performing local disinfection to cut the skin of the knee joint, separating fascia, removing patella, exposing the upper end of a tibia, disinfecting a drill bit with the diameter of 4mm, drilling a hole at the upper end of the tibia by an electric drill to prepare a circular defect with the diameter of 4mm, and repeatedly flushing the circular defect with sterile physiological saline and antibiotics. Filling the prepared cell-scaffold composite material with the size equivalent to that of the bone defect part into the bone defect part, and dividing the cell-scaffold composite material into 4 groups: (1) control negative control group was not filled; (2) PRP scaffold control group was filled with PRP gel; (3) Mock-MSCs-PRP scaffold complex group; (4) siPDCD4-MSCs-PRP scaffold complex group. Resetting patella, suturing fascia and skin layer by layer, and sterilizing.

2. Assessment of bone defect repair

Each group of animals was sacrificed by 6 months post-operative ear margin intravenous air, and the operative side tibia was cut for the following observations: (1) general observation: separating and removing muscles and soft tissues around the specimen, observing the bone formation repair condition of the bone defect area by naked eyes, and comparing the difference between the defect repair area and the original bone hardness of the periphery by forceps and forceps jaws; (2) and (3) observing by a small animal CT imager: and carrying out CT imaging photographing on the defect repair area, and observing the condition of the defect repair area from three planes, namely a sagittal plane, a coronal plane and a transverse plane. (3) And (3) histological observation: removing peripheral bone, reserving bone defect repairing area, fixing the specimen with 4% paraformaldehyde overnight, soaking in decalcifying solution, and changing solution every other day until bone is softened. Dehydrating bone tissues, embedding paraffin, preparing continuous paraffin sections, performing HE staining, Masson staining and safranin O staining, and observing the staining conditions of the bone tissues and the cartilage tissues under a light microscope. The small animal CT imager scans the bone defect repair area as shown in fig. 5: the bone defect repair area can be obviously seen from three planes of a sagittal plane, a coronal plane and a transverse plane, the defect repair degree is clearly shown in the sagittal plane, and the result shows that the siPDCD4-MSCs-PRP stent compound has the best repair effect on the bone defects.

Sequence listing

<110> secondary Hospital of Shandong university

<120> MSCs bracket for bone defect repair and preparation thereof

<130>20190828

<160>16

<170>PatentIn version 3.5

<210>1

<211>19

<212>DNA

<213>Homo sapiens

<400>1

accattactg tagaccaaa 19

<210>2

<211>19

<212>DNA

<213>Homo sapiens

<400>2

tttggatgaa agggcattt 19

<210>3

<211>54

<212>DNA

<213>Artificial Sequence

<220>

<223>siRNA1-F'

<400>3

ctaccattac tgtagaccaa actcgagttt ggtctacagt aatggtagtt tttg 54

<210>4

<211>54

<212>DNA

<213>Artificial Sequence

<220>

<223>siRNA1-R'

<400>4

gatggtaatg acatctggtt tgagctcaaa ccagatgtca ttaccatcaa aaac 54

<210>5

<211>54

<212>DNA

<213>Artificial Sequence

<220>

<223>siRNA2-F'

<400>5

cctttggatg aaagggcatt tctcgagaaa tgccctttca tccaaaggtt tttg 54

<210>6

<211>54

<212>DNA

<213>Artificial Sequence

<220>

<223>siRNA2-R'

<400>6

ggaaacctac tttcccgtaa agagctcttt acgggaaagt aggtttccaa aaac 54

<210>7

<211>58

<212>DNA

<213>Artificial Sequence

<220>

<223>siRNA1-F

<400>7

ccggctacca ttactgtaga ccaaactcga gtttggtcta cagtaatggt agtttttg 58

<210>8

<211>58

<212>DNA

<213>Artificial Sequence

<220>

<223>siRNA1-R

<400>8

gatggtaatg acatctggtt tgagctcaaaccagatgtca ttaccatcaa aaacttaa 58

<210>9

<211>58

<212>DNA

<213>Artificial Sequence

<220>

<223>siRNA2-F

<400>9

ccggcctttg gatgaaaggg catttctcga gaaatgccct ttcatccaaa ggtttttg 58

<210>10

<211>58

<212>DNA

<213>Artificial Sequence

<220>

<223>siRNA2-R

<400>10

ggaaacctac tttcccgtaa agagctcttt acgggaaagt aggtttccaa aaacttaa 58

<210>11

<211>54

<212>DNA

<213>Artificial Sequence

<220>

<223>Mock-F

<400>11

ccggttctcc gaacgtgtca cgtctcgaga cgtgacacgt tcggagaatt tttg 54

<210>12

<211>54

<212>DNA

<213>Artificial Sequence

<220>

<223>Mock-R

<400>12

aagaggcttg cacagtgcag agctctgcac tgtgcaagcc tcttaaaaac ttaa 54

<210>13

<211>21

<212>DNA

<213>Artificial Sequence

<220>

<223>PDCD4-F

<400>13

acaggtgtat gatgtggagg a 21

<210>14

<211>23

<212>DNA

<213>Artificial Sequence

<220>

<223>PDCD4-R

<400>14

ttctcaaatg ccctttcatc caa 23

<210>15

<211>21

<212>DNA

<213>Artificial Sequence

<220>

<223>GAPDH-F

<400>15

aacggatttg gtcgtattgg g 21

<210>16

<211>21

<212>DNA

<213>Artificial Sequence

<220>

<223>GAPDH-R

<400>16

cctggaagat ggtgatggga t 21

Claims

1. A PDCD4 gene-knocked-down MSCs scaffold.

2. A method for preparing PDCD4 gene-knocked-down MSCs stent material is characterized by comprising the following steps:

(1) packaging and preparing lentivirus by siPDCD4 target plasmid, then infecting MSCs cells, and obtaining stable transgenic cell lines siPDCD4-MSCs after resistance screening;

3. The method of claim 2, wherein the MSCs cells are selected from human bone marrow, umbilical cord or adipose-derived;

the scaffold material is selected from hydroxyapatite, tricalcium phosphate, alumina bioceramics, polylactic acid, polymethyl methacrylate, polyglycolic acid, collagen and PRP gel.

4. The method of claim 3, wherein the MSCs cells are of human umbilical cord origin; the scaffold material is PRP gel.

5. The method according to claim 2, wherein the plasmid of interest comprises a marker gene and a reporter gene; the reporter gene is selected from a Luc gene or a GFP gene; the marker gene is one or more than one antibiotic resistance gene.

6. The process according to claim 5, wherein the antibiotic resistance gene is a puromycin resistance gene or/and an ampicillin resistance gene.

7. Use of the MSCs scaffold material of claim 1 in the preparation of a bone injury repair material.