CN111826394A - Construction and application of plant transient expression vector - Google Patents

Abstract

The invention relates to the field of biotechnology, in particular to construction and application of a plant transient expression vector. The invention adopts the artificially synthesized sequence to improve the transcription amount of the vector, and simultaneously improves the translation level and the stability of the target protein by selectively adding the amino acid sequence, thereby finally achieving the effect of improving the accumulation amount of the target protein in plant leaf cells on the whole.

Description

Construction and application of plant transient expression vector

Technical Field

The invention relates to the field of biotechnology, in particular to construction and application of a plant transient expression vector.

Background

The plant expression system is a biological protein expression reactor with wide application prospect, as well as a mammalian cell expression system and a microbial fermentation system. The mammalian cell expression system has the advantages of high yield, system maturity, similarity to human cells and the like, is generally popularized, but the running price is relatively expensive; the microbial fermentation system is quite complete in technology, high in yield and low in price, but due to the difference of cell types, the microbial fermentation system cannot well express target proteins needing specific protein modification. The plant expression system has inherent advantages, such as less biomass limit of plants, fast growth, low cost and mammalian expression system, and simultaneously, plant cells can carry out various post-translational modifications on proteins, can make up the defects of a microbial fermentation system and an insect expression system, has good production prospect, and is a popular research direction for commercial application.

The expression of target protein in plants is very important, and an effective plant foreign protein expression vector is important. At the present stage, the domestic plant exogenous protein expression vector is mainly applied in the field of basic scientific research, and the exploration of an application vector capable of carrying out high-efficiency commercial production is very little. The international plant recombinant protein expression enterprises, Medicago and IiconGenetic, developed unique expression vectors according to basic research and self-research progress. Therefore, the expression efficiency of the plant exogenous expression vector is improved and improved by means of genetic engineering, so that the plant exogenous expression vector can meet the requirement of commercial production of target protein, and has important practical significance.

Disclosure of Invention

In view of this, the present invention provides the construction and application of plant transient expression vectors. The invention adopts the artificially synthesized sequence to improve the transcription amount of the vector, and simultaneously improves the translation level and the stability of the target protein by selectively adding the amino acid sequence, thereby finally achieving the effect of improving the accumulation amount of the target protein in plant leaf cells on the whole.

In order to achieve the above object, the present invention provides the following technical solutions:

the present invention provides plant transient expression vectors comprising a 5' UTR region, an MCS region and a SEKDEL sequence.

In some embodiments of the invention, the 5' UTR region, MCS region and SEKDEL sequence have the sequences shown in SEQ ID No. 1.

In some embodiments of the invention, the plant transient expression vector has as its basic backbone the plant expression vector pEAQ.

In some embodiments of the present invention, the plant transient expression vector further comprises a target gene, wherein the target gene has a PacI cleavage site at the N-terminal and an XhoI cleavage site at the C-terminal.

In some embodiments of the present invention, in the method for constructing a plant transient expression vector, the sequence shown in SEQ ID No.1 is amplified by using an upstream primer shown in SEQ ID No.2 and a downstream primer shown in SEQ ID No. 3.

In some embodiments of the invention, the amplified amplification system comprises 22. mu.l ddH₂O, 25. mu.l KOD OneTM PCRMasterMix, 1. mu.l 10. mu.M upstream primer shown as SEQ ID No.2, 1. mu.l 10. mu.M downstream primer shown as SEQ ID No.3, and 1. mu.l 100 ng/. mu.l plasmid template containing the artificially synthesized sequence SEQ ID No. 1.

In some embodiments of the invention, the procedure for amplification is: 30 seconds at 98 ℃; 28 cycles: 10 seconds at 98 ℃; 30 seconds at 55 ℃; 68 ℃ for 10 seconds; 5 minutes at 68 ℃; 10 minutes at 4 ℃.

The invention also provides application of the plant transient expression vector in expressing foreign protein.

In some embodiments of the invention, the exogenous protein comprises GFP.

On the basis of the research, the invention also provides a method for expressing the foreign protein by the plant transient expression vector, which comprises the following steps:

step 1: constructing the plant transient expression vector;

step 2: inserting a gene of a foreign protein into the plant transient expression vector prepared in the step 1; obtaining a recombinant plasmid;

and step 3: and (3) transforming the recombinant plasmid prepared in the step (2) into host competence, culturing, collecting bacterial liquid, infiltrating plant leaves, and extracting protein.

The expression quantity of the plant exogenous protein expression vector is improved at the present stage mainly from two aspects, namely, the transcription quantity of a target gene expressed by the vector in a plant cell is improved, and the translation quantity and the accumulation quantity of the protein are improved by some methods. The invention adopts the artificially synthesized sequence to improve the transcription amount of the vector, and simultaneously improves the translation level and the stability of the target protein by selectively adding the amino acid sequence, thereby finally achieving the effect of improving the accumulation amount of the target protein in plant leaf cells on the whole.

The modified pEAQ vector provided by the invention is named as pEAQE, and has obvious improvement on the capability of expressing foreign proteins compared with the original pEAQ vector. The promotion is mainly realized by enhancing the transcription level of the vector to target genes in cells and simultaneously promoting the accumulation amount of proteins in the cells. Particularly aiming at some foreign proteins which may be less stable to be expressed in plant cells, the selective fusion expression of SEKDEL can help the target protein to be more stably expressed and accumulated in the plant cells. Can provide a high-quality expression vector platform foundation for the development of commercial protein expression in the later period. Meanwhile, the clever enzyme cutting site design of the pEAQE plant expression vector provides a very simple cloning method for protein operation needing to add fusion expression SEKDEL peptide segment. Saving the labor time and reagent cost of laboratory operations on molecular cloning.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 shows a map of a plasmid with inserted GFP;

FIG. 2 is a photograph showing the comparison of UV fluorescence with the difference in GFP fluorescence of different vectors;

FIG. 3 shows the data comparing the difference in transcription level of GFP mRNA in different vectors by Q-PCR;

FIG. 4 shows the comparison of the difference between the expression data of GFP protein in different vectors by WB.

Detailed Description

The invention discloses construction and application of a plant transient expression vector, and a person skilled in the art can realize the construction by appropriately improving process parameters by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

The raw materials and reagents used in the construction and application of the plant transient expression vector provided by the invention can be purchased from the market.

The invention is further illustrated by the following examples:

EXAMPLE 1 construction of the pEAQE vector

(1) Taking a plant expression vector pEAQ as a basic framework, carrying out enzyme digestion for 2 hours by using two enzyme digestion sites of PacI and XhoI, and then recovering a 9200bp fragment by DNA gel electrophoresis;

(2) synthesizing an artificial sequence shown as SEQ ID No.1, wherein the artificial sequence comprises a 5' UTR region, an MCS region and an SEKDEL sequence;

(3) designing an amplification primer for amplifying the artificial sequence gene segment, wherein an upstream primer is shown as SEQ ID No.2, and a downstream primer is shown as SEQ ID No. 3;

(4) TOYOBO KOD One^TMCarrying out amplification reaction by using the PCRMasterMix, wherein the amplification system is as follows: 22ul ddH₂O、25ulKOD One^TMPCRMasterMix, 1ul 10uM upstream primer, 1ul 10uM downstream primer, and 1ul 100ng/ul plasmid template containing an artificially synthesized sequence SEQ ID No. 1. PCR amplification procedure: 98 degrees for 30 seconds; 28 cycles: 98 degrees for 10 seconds; 55 degrees for 30 seconds; 68 degrees for 10 seconds; finally 68 ℃ for 5 minutes; 10 minutes at 4 ℃;

(5) and a PacI enzyme cutting site is added at the N end of the finally amplified gene fragment, and an XhoI enzyme cutting site is added at the C end. Gel electrophoresis is carried out to cut the gel and recover fragments; carrying out single-fragment homologous recombination with Infusion enzyme of Novowed to link a vector skeleton and an amplified fragment;

(6) and performing heat shock transformation on DH5 alpha competence, coating a Kana resistance culture medium, performing colony PCR verification on the next day, selecting positive clone, shaking bacteria, extracting corresponding plasmid and sequencing. And (3) storing the plasmid with completely correct sequencing result, wherein the sequence is shown as SEQ ID No. 6.

Synthetic Artificial sequence of SEQ ID No.1

CAGTGAATTGTTAATTAAGAATTCGAGCTCCACCGCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGAGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGTTTaAAGAGtCGCAcCCAaAACGCTCaAACcCAATtatTCaACATcTATTtAAgGTCcCTAAAAATGGCCACCCCCGGGAGTGAAAAAGACGAATTATAGCTCGAGGCCTTTAACTCTGGT

SEQ ID No.2 amplification artificial sequence upstream primer

CAGTGAATTGTTAATTAAGGAAACCTC

SEQ ID No.3 amplification artificial sequence downstream primer

ACCAGAGTTAAAGGCCTCGAGCTAGTG

Example 2 insertion of GFP Gene into pEAQE vector

(1) Taking a plant expression vector pEAQE as a basic framework, carrying out enzyme digestion for 2 hours by using SmaI enzyme digestion sites, and then recovering a 10469bp fragment by DNA gel electrophoresis;

(2) designing an amplification primer for amplifying the artificial sequence gene segment, wherein an upstream primer is SEQ ID No.4, and a downstream primer is SEQ ID No. 5;

(3) TOYOBO KOD One^TMCarrying out amplification reaction by using the PCRMasterMix, wherein the amplification system is as follows: 22ul ddH₂O、25ulKOD One^TMPCRMasterMix, 1ul 10uM upstream primer, 1ul 10uM downstream primer, 1ul 100ng/ul plasmid template containing GFP. PCR amplification procedure: 98 degrees for 30 seconds; 28 cycles: 98 degrees for 10 seconds; 55 degrees for 30 seconds; 68 degrees for 10 seconds; finally 68 ℃ for 5 minutes; 10 minutes at 4 ℃;

(4) gel electrophoresis is carried out on the finally amplified gene segment to cut the gel and recover the segment; carrying out single-fragment homologous recombination with Infusion enzyme of Novowed to link a vector skeleton and an amplified fragment;

(5) and coating a kanamycin resistance culture medium after heat shock transformation of DH5 alpha competence, carrying out colony PCR verification on the next day, selecting positive clone, shaking bacteria, extracting corresponding plasmid and sequencing. And (3) storing the plasmid with completely correct sequencing result, wherein the sequence is shown as SEQ ID No.6, and the plasmid spectrogram is shown in figure 1.

SEQ ID No.4 GFP amplification upstream primer

AAAATGGCCACCCCCATGGTGAGCAAGGGCGAGGAG

SEQ ID No.5 GFP downstream primer amplification

CTTTTTCACTCCCTTACTTGTACAGCTCGTCCATGCCG

Plasmid sequence of pEAQE-GFP of SEQ ID No.6

AGCGGTGAGTTCGCGGGGCGCACGCATGACGGTGCGGCTTGCGATGGTTTCGGCATCCTCGGCGGAAAACCCCGCGTCGATCAGTTCTTGCCTGTATGCCTTCCGGTCAAACGTCCGATTCATTCACCCTCCTTGCGGGATTGCCCCGACTCACGCCGGGGCAATGTGCCCTTATTCCTGATTTGACCCGCCTGGTGCCTTGGTGTCCAGATAATCCACCTTATCGGCAATGAAGTCGGTCCCGTAGACCGTCTGGCCGTCCTTCTCGTACTTGGTATTCCGAATCTTGCCCTGCACGAATACCAGCGACCCCTTGCCCAAATACTTGCCGTGGGCCTCGGCCTGAGAGCCAAAACACTTGATGCGGAAGAAGTCGGTGCGCTCCTGCTTGTCGCCGGCATCGTTGCGCCACATCTAGGTACTAAAACAATTCATCCAGTAAAATATAATATTTTATTTTCTCCCAATCAGGCTTGATCCCCAGTAAGTCAAAAAATAGCTCGACATACTGTTCTTCCCCGATATCCTCCCTGATCGACCGGACGCAGAAGGCAATGTCATACCACTTGTCCGCCCTGCCGCTTCTCCCAAGATCAATAAAGCCACTTACTTTGCCATCTTTCACAAAGATGTTGCTGTCTCCCAGGTCGCCGTGGGAAAAGACAAGTTCCTCTTCGGGCTTTTCCGTCTTTAAAAAATCATACAGCTCGCGCGGATCTTTAAATGGAGTGTCTTCTTCCCAGTTTTCGCAATCCACATCGGCCAGATCGTTATTCAGTAAGTAATCCAATTCGGCTAAGCGGCTGTCTAAGCTATTCGTATAGGGACAATCCGATATGTCGATGGAGTGAAAGAGCCTGATGCACTCCGCATACAGCTCGATAATCTTTTCAGGGCTTTGTTCATCTTCATACTCTTCCGAGCAAAGGACGCCATCGGCCTCACTCATGAGCAGATTGCTCCAGCCATCATGCCGTTCAAAGTGCAGGACCTTTGGAACAGGCAGCTTTCCTTCCAGCCATAGCATCATGTCCTTTTCCCGTTCCACATCATAGGTGGTCCCTTTATACCGGCTGTCCGTCATTTTTAAATATAGGTTTTCATTTTCTCCCACCAGCTTATATACCTTAGCAGGAGACATTCCTTCCGTATCTTTTACGCAGCGGTATTTTTCGATCAGTTTTTTCAATTCCGGTGATATTCTCATTTTAGCCATTTATTATTTCCTTCCTCTTTTCTACAGTATTTAAAGATACCCCAAGAAGCTAATTATAACAAGACGAACTCCAATTCACTGTTCCTTGCATTCTAAAACCTTAAATACCAGAAAACAGCTTTTTCAAAGTTGTTTTCAAAGTTGGCGTATAACATAGTATCGACGGAGCCGATTTTGAAACCACAATTATGGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACAGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTACGTCACTTAAAAAACTCAGGCCGCAGTCGGTAACTATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGGGCCCCCGGCGCCAGATCTGGGGAACCCTGTGGTTGGCATGCACATACAAATGGACGAACGGATAAACCTTTTCACGCCCTTTTAAATATCCGATTATTCTAATAAACGCTCTTTTCTCTTAGGTTTACCCGCCAATATATCCTGTCAAACACTGATAGTTTGTGAACCATCACCCAAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTTAATTAAGAATTCGAGCTCCACCGCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGAGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGTTTaAAGAGtCGCAcCCAaAACGCTCaAACcCAATtatTCaACATcTATTtAAgGTCcCTAAAAATGGCCACCCCCatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaaGGGAGTGAAAAAGACGAATTATAGCTCGAGGCCTTTAACTCTGGTTTCATTAAATTTTCTTTAGTTTGAATTTACTGTTATTCGGTGTGCATTTCTATGTTTGGTGAGCGGTTTTCTGTGCTCAGAGTGTGTTTATTTTATGTAATTTAATTTCTTTGTGAGCTCCTGTTTAGCAGGTCGTCCCTTCAGCAAGGACACAAAAAGATTTTAATTTTATTAAAAAAAAAAAAAAAAAAAAGACCGGGAATTCGATATCAAGCTTATCGACCTGCAGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCTCTAGAGTCTCAAGCTTGGCGCGCCAGCTTGGCGTAATCATGGTCATAGCTGTTGCGATTAAGAATTCGAGCTCGGTACCCCCCTACTCCAAAAATGTCAAAGATACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCAACAAAGGGTAATTTCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCGAAAGGACAGTAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCATTCAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGACATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACAGCCCAAGCTTCGACTCTAGAGGATCCCCTTAAATCGATATGGAACGAGCTATACAAGGAAACGACGCTAGGGAACAAGCTAACAGTGAACGTTGGGATGGAGGATCAGGAGGTACCACTTCTCCCTTCAAACTTCCTGACGAAAGTCCGAGTTGGACTGAGTGGCGGCTACATAACGATGAGACGAATTCGAATCAAGATAATCCCCTTGGTTTCAAGGAAAGCTGGGGTTTCGGGAAAGTTGTATTTAAGAGATATCTCAGATACGACAGGACGGAAGCTTCACTGCACAGAGTCCTTGGATCTTGGACGGGAGATTCGGTTAACTATGCAGCATCTCGATTTTTCGGTTTCGACCAGATCGGATGTACCTATAGTATTCGGTTTCGAGGAGTTAGTATCACCGTTTCTGGAGGGTCTCGAACTCTTCAGCATCTCTGTGAGATGGCAATTCGGTCTAAGCAAGAACTGCTACAGCTTGCCCCAATCGAAGTGGAAAGTAATGTATCAAGAGGATGCCCTGAAGGTACTCAAACCTTCGAAAAAGAAAGCGAGTAAGTCGAGGGCGAGCTCGAATTCGGTACGCTGAAATCACCAGTCTCTCTCTACAAATCTATCTCTCTCTATTTTCTCCATAAATAATGTGTGAGTAGTTTCCCGATAAGGGAAATTAGGGTTCTTATAGGGTTTCGCTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGTATTTGTAAAATACTTCTATCAATAAAATTTCTAATTCCTAAAACCAAAATCCAGTACTAAAATCCAGATCTCCTAAAGTCCCTATAGATCTTTGTCGTGAATATAAACCAGACACGAGACGACTAAACCTGGAGCCCAGACGCCGTTCGAAGCTAGAAGTACCGCTTAGGCAGGAGGCCGTTAGGGAAAAGATGCTAAGGCAGGGTTGGTTACGTTGACTCCCCCGTAGGTTTGGTTTAAATATGATGAAGTGGACGGAAGGAAGGAGGAAGACAAGGAAGGATAAGGTTGCAGGCCCTGTGCAAGGTAAGAAGATGGAAATTTGATAGAGGTACGCTACTATACTTATACTATACGCTAAGGGAATGCTTGTATTTATACCCTATACCCCCTAATAACCCCTTATCAATTTAAGAAATAATCCGCATAAGCCCCCGCTTAAAAATTGGTATCAGAGCCATGAATAGGTCTATGACCAAAACTCAAGAGGATAAAACCTCACCAAAATACGAAAGAGTTCTTAACTCTAAAGATAAAAGATGGCGCGTGGCCGGCCATGAGCGGAGAATTAAGGGAGTCACGTTATGACCCCCGCCGATGACGCGGGACAAGCCGTTTTACGTTTGGAACTGACAGAACCGCAACGTTGAAGGAGCCACTCAGCCGCGGGTTTCTGGAGTTTAATGAGCTAAGCACATACGTCAGAAACCATTATTGCGCGTTCAAAAGTCGCCTAAGGTCACTATCAGCTAGCAAATATTTCTTGTCAAAAATGCTCCACTGACGTTCCATAAATTCCCCTCGGTATCCAATTAGAGTCTCATATTCACTCTCAATCCAAATAATCTGCACCGGATCTGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGATGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACGGGATCTCTGCGGAACAGGCGGTCGAAGGTGCCGATATCATTACGACAGCAACGGCCGACAAGCACAACGCCACGATCCTGAGCGACAATATGATCGCGGCGTCCACATCAACGGCGTCGGCGGCGACTGCCCAGGCAAGACCGAGATGCACCGCGATATCTTGCTGCGTTCGGATATTTTCGTGGAGTTCCCGCCACAGACCCGGATGATCCCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGGGGCCGGCCCTCACTGGTGAAAAGAAAAACCACCCCAGTACATTAAAAACGTCCGCAATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCCTGCCACCAGCCAGCCAACAGCTCCCCGACCGGCAGCTCGGCACAAAATCACCACTCGATACAGGCAGCCCATCAGTCCGGGACGGCGTCAGCGGGAGAGCCGTTGTAAGGCGGCAGACTTTGCTCATGTTACCGATGCTATTCGGAAGAACGGCAACTAAGCTGCCGGGTTTGAAACACGGATGATCTCGCGGAGGGTAGCATGTTGATTGTAACGATGACAGAGCGTTGCTGCCTGTGATCAAATATCATCTCCCTCGCAGAGATCCGAATTATCAGCCTTCTTATTCATTTCTCGCTTAACCGTGACAGAGTAGACAGGCTGTCTCGCGGCCGAGGGGCGCAGCCCCTGGGGGGATGGGAGGCCCGCGTTAGCGGGCCGGGAGGGTTCGAGAAGGGGGGGCACCCCCCTTCGGCGTGCGCGGTCACGCGCACAGGGCGCAGCCCTGGTTAAAAACAAGGTTTATAAATATTGGTTTAAAAGCAGGTTAAAAGACAGGTTAGCGGTGGCCGAAAAACGGGCGGAAACCCTTGCAAATGCTGGATTTTCTGCCTGTGGACAGCCCCTCAAATGTCAATAGGTGCGCCCCTCATCTGTCAGCACTCTGCCCCTCAAGTGTCAAGGATCGCGCCCCTCATCTGTCAGTAGTCGCGCCCCTCAAGTGTCAATACCGCAGGGCACTTATCCCCAGGCTTGTCCACATCATCTGTGGGAAACTCGCGTAAAATCAGGCGTTTTCGCCGATTTGCGAGGCTGGCCAGCTCCACGTCGCCGGCCGAAATCGAGCCTGCCCCTCATCTGTCAACGCCGCGCCGGGTGAGTCGGCCCCTCAAGTGTCAACGTCCGCCCCTCATCTGTCAGTGAGGGCCAAGTTTTCCGCGAGGTATCCACAACGCCGGCGGCCGCGGTGTCTCGCACACGGCTTCGACGGCGTTTCTGGCGCGTTTGCAGGGCCATAGACGGCCGCCAGCCCAGCGGCGAGGGCAACCAGCCCGGTGAGCGTCGGAAAGGCGCTCGGTCTTGCCTTGCTCGTCGGTGATGTACACTAGTCGCTGGCTGCTGAACCCCCAGCCGGAACTGACCCCACAAGGCCCTAGCGTTTGCAATGCACCAGGTCATCATTGACCCAGGCGTGTTCCACCAGGCCGCTGCCTCGCAACTCTTCGCAGGCTTCGCCGACCTGCTCGCGCCACTTCTTCACGCGGGTGGAATCCGATCCGCACATGAGGCGGAAGGTTTCCAGCTTGAGCGGGTACGGCTCCCGGTGCGAGCTGAAATAGTCGAACATCCGTCGGGCCGTCGGCGACAGCTTGCGGTACTTCTCCCATATGAATTTCGTGTAGTGGTCGCCAGCAAACAGCACGACGATTTCCTCGTCGATCAGGACCTGGCAACGGGACGTTTTCTTGCCACGGTCCAGGACGCGGAAGCGGTGCAGCAGCGACACCGATTCCAGGTGCCCAACGCGGTCGGACGTGAAGCCCATCGCCGTCGCCTGTAGGCGCGACAGGCATTCCTCGGCCTTCGTGTAATACCGGCCATTGATCGACCAGCCCAGGTCCTGGCAAAGCTCGTAGAACGTGAAGGTGATCGGCTCGCCGATAGGGGTGCGCTTCGCGTACTCCAACACCTGCTGCCACACCAGTTCGTCATCGTCGGCCCGCAGCTCGACGCCGGTGTAGGTGATCTTCACGTCCTTGTTGACGTGGAAAATGACCTTGTTTTGCAGCGCCTCGCGCGGGATTTTCTTGTTGCGCGTGGTGAACAGGGCAGAGCGGGCCGTGTCGTTTGGCATCGCTCGCATCGTGTCCGGCCACGGCGCAATATCGAACAAGGAAAGCTGCATTTCCTTGATCTGCTGCTTCGTGTGTTTCAGCAACGCGGCCTGCTTGGCCTCGCTGACCTGTTTTGCCAGGTCCTCGCCGGCGGTTTTTCGCTTCTTGGTCGTCATAGTTCCTCGCGTGTCGATGGTCATCGACTTCGCCAAACCTGCCGCCTCCTGTTCGAGACGACGCGAACGCTCCACGGCGGCCGATGGCGCGGGCAGGGCAGGGGGAAGCCAGTTGCACGCTGTCGCGCTCGATCTTGGCCGTAGCTTGCTGGACCATCGAGCCGACGGACTGGAAGGTTTCGCGGGGCGCACGCATGACGGTGCGGCTTGCGATGGTTTCGGCATCCTCGGCGGAAAACCCCGCGTCGATCAGTTCTTGCCTGTATGCCTTCCGGTCAAACGTCCGATTCATTCACCCTCCTTGCGGGATTGCCCCGACTCACGCCGGGGCAATGGGCCCTTATTCCTGATTTGACCCGCCTGGGGGCTTGGGTGTCCAGAA

EXAMPLE 3 infiltration

(1) The plasmid pEAQE-GFP is introduced into the agrobacterium competence by an electric shock method and smeared on a kanamycin and rifampicin double-resistant culture medium.

(2) Selecting culture medium for monoclone, and shaking to OD₆₀₀When the concentration was 0.8, the mixture was centrifuged at 8000rpm for 2 minutes, and the precipitated bacterial solution was treated with an infiltration buffer (10mM MES, 10mM Mgcl)₂1uM acetosyringone) were resuspended and OD adjusted₆₀₀＝0.6。

(3) And infiltrating the bacterial liquid into the tobacco leaves by using a negative pressure vacuum pump, and observing fluorescence after 2 days.

Example 4 fluorescence imaging

The leaf-soaked areas were illuminated with a hand-held uv fluorescent lamp and a photograph taken under a yellow filter (see figure 2). In the areas infiltrated with and expressed by pEAQE-GFP, bright green color was observed in the leaves, whereas in the areas not infiltrated with pEAQE-GFP, the leaves appeared red.

As can be seen from the data in the figure, three sets of repeated experiments we performed maintained good stability and consistency, the fluorescence of peaxe was found to be stronger than pEAQ by data Students T-test, and this difference was significant.

Example 5Q-PCR

(1) And extracting RNA. 0.1g of the infiltrated leaf was ground with liquid nitrogen, 1ml of TRIZOL and 300ul of chloroform were added thereto and mixed well, and then allowed to stand at room temperature for 10 minutes. The mixture was centrifuged at 15000rpm for 5 minutes, and the supernatant was transferred to a new centrifuge tube, and an equal volume of isopropanol was added thereto, and after standing at room temperature for 10 minutes, the mixture was centrifuged at 15000rpm for 5 minutes. After washing twice with 70% ethanol, the precipitate was air-dried and dissolved in 100ul of DEPC water.

(2) And carrying out reverse transcription by using an RT-PCR QuickMasterMix kit of TOYOBO to obtain cDNA.

(3) The Q-PCR reaction system comprises SYBRMIX 10ul, Forwardprimer 0.8ul, Reverse primer0.8ul, DNA template 2ul and ddH₂O6.4 ul. Reaction conditions are as follows: PCR cycling parameters: pre-denaturation at 95 ℃ for 3 min; then 30 cycles of denaturation at 95 ℃ for 30s, low-temperature annealing at 55 ℃ for 45s and extension at 72 ℃ for 30 s; and (3) selecting a melting curve according to instrument operation instructions for analysis: 95 ℃ for 15s, 60 ℃ for 15s and 95 ℃ for 15 s.

The results are shown in FIG. 3. The expression of the pEAQ and pEAQE vectors was analyzed for GFP at the transcriptional level. The difference in the amount of accumulation of mRNA of GFP expressed by each of the two vectors was compared by RT-qPCR. Data analysis shows that the mRNA content of GFP expressed by pEAQE is 120% of that of pEAQ, and Students T-test shows that the mRNA content of pEAQE GFP is obviously higher than that of pEAQ.

Example 6SDS-PAGE gels and WB manipulation

(1) And taking 0.1g of leaves in the infiltration area, grinding the leaves by using liquid nitrogen, adding 200ul of protein extraction buffer solution, centrifuging the mixture at 15000rpm for 10 minutes, taking 200ul of supernatant, and adding 50ul of protein loading. Boiled at 100 ℃ for 10 minutes and then cooled on ice.

(2) 10ul of sample is taken and is applied, and after half an hour of 80V electrophoresis, 100V electrophoresis is carried out for 1 hour.

(3) The gel concentrate was removed and placed in transfer buffer. And shearing a Nitrocellulose (NC) membrane with the same size as the gel and clean filter paper, and wetting in a transfer buffer solution for 5-10 min. And opening the electrotransfer clamp, keeping the cathode black side down, wetting the spongy cushion, the filter paper, the gel, the NC membrane, the filter paper and the spongy cushion in sequence, then horizontally placing the spongy cushion, removing bubbles between the middle layers, clamping the electrotransfer clamp, and rotating the membrane for 60min by adopting constant voltage 100V.

(4) After the NC membrane is rinsed by PBST buffer solution, the NC membrane is immersed into the sealing solution and incubated for 1h at room temperature; immersing the membrane into a GFP primary antibody diluent, slowly shaking the membrane on a horizontal shaking table, and incubating the membrane for 1 to 2 hours at normal temperature; washing the membrane with PBST for 3 times, transferring the membrane into a diluent of a required secondary antibody, and slowly shaking for reaction for 1-2 h at room temperature; washing the membrane with PBST for 5min for 4 times, and removing Tween-20 on the membrane surface by using PBS;

(5) alkaline Phosphatase (AP) color development: and adding 66 mu L of LNBT and 33 mu L of BCIP into 10mL of color development buffer solution respectively, and immersing the membrane into the color development solution to carry out dark reaction until the specific strip is clear and the non-specific strip and the background are low, wherein 3-30 min is generally needed. The fully developed membrane was placed in deionized water to stop the reaction.

(6) Coomassie brilliant blue staining: SDS-PAGE gels were stained with Coomassie Brilliant blue stain (40% methanol; 10% acetic acid; 0.25% Coomassie Brilliant blue G250) for 30min on a shaker; bands were visualized clearly with destaining solution (40% methanol; 10% acetic acid).

As shown in fig. 4. The accumulation of the pEAQ-GFP and pEAQE-GFP expressed GFP proteins was compared by SDS-PAGE gel staining and WB. It can be known that the expression level of the pEAQE-GFP is higher than that of the pEAQ-GFP, and Students T-test can know that P is less than 0.001, which indicates that the increase difference of the expression level is very significant.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Zhejiang Huazhi Dai pharmaceutical industry group medicine development Co., Ltd

Construction and application of <120> plant transient expression vector

<130>MP2012471

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>472

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

cagtgaattg ttaattaaga attcgagctc caccgcggaa acctcctcgg attccattgc 60

ccagctatct gtcactttat tgagaagata gtggaaaagg aaggtggctc ctacaaatgc 120

catcattgcg ataaaggaaa ggccatcgtt gaagatgcct ctgccgacag tggtcccaaa 180

gatggacccc cacccacgag gagcatcgtg gaaaaagaag acgttccaac cacgtcttca 240

aagcaagtgg attgatgtga tatctccact gacgtaaggg atgacgcaca atcccactat 300

ccttcgcaag acccttcctc tatataagga agttcatttc atttggagag gtttaaagag 360

tcgcacccaa aacgctcaaa cccaattatt caacatctat ttaaggtccc taaaaatggc 420

cacccccggg agtgaaaaag acgaattata gctcgaggcc tttaactctg gt 472

<210>2

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

cagtgaattg ttaattaagg aaacctc 27

<210>3

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

accagagtta aaggcctcga gctagtg 27

<210>4

<211>36

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

aaaatggcca cccccatggt gagcaagggc gaggag 36

<210>5

<211>38

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ctttttcact cccttacttg tacagctcgt ccatgccg 38

<210>6

<211>10472

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

agcggtgagt tcgcggggcg cacgcatgac ggtgcggctt gcgatggttt cggcatcctc 60

ggcggaaaac cccgcgtcga tcagttcttg cctgtatgcc ttccggtcaa acgtccgatt 120

cattcaccct ccttgcggga ttgccccgac tcacgccggg gcaatgtgcc cttattcctg 180

atttgacccg cctggtgcct tggtgtccag ataatccacc ttatcggcaa tgaagtcggt 240

cccgtagacc gtctggccgt ccttctcgta cttggtattc cgaatcttgc cctgcacgaa 300

taccagcgac cccttgccca aatacttgcc gtgggcctcg gcctgagagc caaaacactt 360

gatgcggaag aagtcggtgc gctcctgctt gtcgccggca tcgttgcgcc acatctaggt 420

actaaaacaa ttcatccagt aaaatataat attttatttt ctcccaatca ggcttgatcc 480

ccagtaagtc aaaaaatagc tcgacatact gttcttcccc gatatcctcc ctgatcgacc 540

ggacgcagaa ggcaatgtca taccacttgt ccgccctgcc gcttctccca agatcaataa 600

agccacttac tttgccatct ttcacaaaga tgttgctgtc tcccaggtcg ccgtgggaaa 660

agacaagttc ctcttcgggc ttttccgtct ttaaaaaatc atacagctcg cgcggatctt 720

taaatggagt gtcttcttcc cagttttcgc aatccacatc ggccagatcg ttattcagta 780

agtaatccaa ttcggctaag cggctgtcta agctattcgt atagggacaa tccgatatgt 840

cgatggagtg aaagagcctg atgcactccg catacagctc gataatcttt tcagggcttt 900

gttcatcttc atactcttcc gagcaaagga cgccatcggc ctcactcatg agcagattgc 960

tccagccatc atgccgttca aagtgcagga cctttggaac aggcagcttt ccttccagcc 1020

atagcatcat gtccttttcc cgttccacat cataggtggt ccctttatac cggctgtccg 1080

tcatttttaa atataggttt tcattttctc ccaccagctt atatacctta gcaggagaca 1140

ttccttccgt atcttttacg cagcggtatt tttcgatcag ttttttcaat tccggtgata 1200

ttctcatttt agccatttat tatttccttc ctcttttcta cagtatttaa agatacccca 1260

agaagctaat tataacaaga cgaactccaa ttcactgttc cttgcattct aaaaccttaa 1320

ataccagaaa acagcttttt caaagttgtt ttcaaagttg gcgtataaca tagtatcgac 1380

ggagccgatt ttgaaaccac aattatgggt gatgctgcca acttactgat ttagtgtatg 1440

atggtgtttt tgaggtgctc cagtggcttc tgtttctatc agctgtccct cctgttcagc 1500

tactgacggg gtggtgcgta acggcaaaag caccgccgga catcagcgct atctctgctc 1560

tcactgccgt aaaacatggc aactgcagtt cacttacacc gcttctcaac ccggtacgca 1620

ccagaaaatc attgatatgg ccatgaatgg cgttggatgc cgggcaacag cccgcattat 1680

gggcgttggc ctcaacacga ttttacgtca cttaaaaaac tcaggccgca gtcggtaact 1740

atgcggtgtg aaataccgca cagatgcgta aggagaaaat accgcatcag gcgctcttcc 1800

gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct 1860

cactcaaagg cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg 1920

tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc 1980

cataggctcc gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga 2040

aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct 2100

cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg 2160

gcgctttctc atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag 2220

ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat 2280

cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagg taacctcgcg 2340

catacagccg ggcagtgacg tcatcgtctg cgcggaaatg gacgggcccc cggcgccaga 2400

tctggggaac cctgtggttg gcatgcacat acaaatggac gaacggataa accttttcac 2460

gcccttttaa atatccgatt attctaataa acgctctttt ctcttaggtt tacccgccaa 2520

tatatcctgt caaacactga tagtttgtga accatcaccc aaatcaagtt ttttggggtc 2580

gaggtgccgt aaagcactaa atcggaaccc taaagggagc ccccgattta gagcttgacg 2640

gggaaagccg gcgaacgtgg cgagaaagga agggaagaaa gcgaaaggag cgggcgccat 2700

tcaggctgcg caactgttgg gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc 2760

tggcgaaagg gggatgtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt 2820

cacgacgttg taaaacgacg gccagtgaat tgttaattaa gaattcgagc tccaccgcgg 2880

aaacctcctc ggattccatt gcccagctat ctgtcacttt attgagaaga tagtggaaaa 2940

ggaaggtggc tcctacaaat gccatcattg cgataaagga aaggccatcg ttgaagatgc 3000

ctctgccgac agtggtccca aagatggacc cccacccacg aggagcatcg tggaaaaaga 3060

agacgttcca accacgtctt caaagcaagt ggattgatgt gatatctcca ctgacgtaag 3120

ggatgacgca caatcccact atccttcgca agacccttcc tctatataag gaagttcatt 3180

tcatttggag aggtttaaag agtcgcaccc aaaacgctca aacccaatta ttcaacatct 3240

atttaaggtc cctaaaaatg gccaccccca tggtgagcaa gggcgaggag ctgttcaccg 3300

gggtggtgcc catcctggtc gagctggacg gcgacgtaaa cggccacaag ttcagcgtgt 3360

ccggcgaggg cgagggcgat gccacctacg gcaagctgac cctgaagttc atctgcacca 3420

ccggcaagct gcccgtgccc tggcccaccc tcgtgaccac cctgacctac ggcgtgcagt 3480

gcttcagccg ctaccccgac cacatgaagc agcacgactt cttcaagtcc gccatgcccg 3540

aaggctacgt ccaggagcgc accatcttct tcaaggacga cggcaactac aagacccgcg 3600

ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat cgagctgaag ggcatcgact 3660

tcaaggagga cggcaacatc ctggggcaca agctggagta caactacaac agccacaacg 3720

tctatatcat ggccgacaag cagaagaacg gcatcaaggt gaacttcaag atccgccaca 3780

acatcgagga cggcagcgtg cagctcgccg accactacca gcagaacacc cccatcggcg 3840

acggccccgt gctgctgccc gacaaccact acctgagcac ccagtccgcc ctgagcaaag 3900

accccaacga gaagcgcgat cacatggtcc tgctggagtt cgtgaccgcc gccgggatca 3960

ctctcggcat ggacgagctg tacaagtaag ggagtgaaaa agacgaatta tagctcgagg 4020

cctttaactc tggtttcatt aaattttctt tagtttgaat ttactgttat tcggtgtgca 4080

tttctatgtt tggtgagcgg ttttctgtgc tcagagtgtg tttattttat gtaatttaat 4140

ttctttgtga gctcctgttt agcaggtcgt cccttcagca aggacacaaa aagattttaa 4200

ttttattaaa aaaaaaaaaa aaaaaaagac cgggaattcg atatcaagct tatcgacctg 4260

cagatcgttc aaacatttgg caataaagtt tcttaagatt gaatcctgtt gccggtcttg 4320

cgatgattat catataattt ctgttgaatt acgttaagca tgtaataatt aacatgtaat 4380

gcatgacgtt atttatgaga tgggttttta tgattagagt cccgcaatta tacatttaat 4440

acgcgataga aaacaaaata tagcgcgcaa actaggataa attatcgcgc gcggtgtcat 4500

ctatgttact agatctctag agtctcaagc ttggcgcgcc agcttggcgt aatcatggtc 4560

atagctgttg cgattaagaa ttcgagctcg gtacccccct actccaaaaa tgtcaaagat 4620

acagtctcag aagaccaaag ggctattgag acttttcaac aaagggtaat ttcgggaaac 4680

ctcctcggat tccattgccc agctatctgt cacttcatcg aaaggacagt agaaaaggaa 4740

ggtggctcct acaaatgcca tcattgcgat aaaggaaagg ctatcattca agatgcctct 4800

gccgacagtg gtcccaaaga tggaccccca cccacgagga gcatcgtgga aaaagaagac 4860

gttccaacca cgtcttcaaa gcaagtggat tgatgtgaca tctccactga cgtaagggat 4920

gacgcacaat cccactatcc ttcgcaagac ccttcctcta tataaggaag ttcatttcat 4980

ttggagagga cagcccaagc ttcgactcta gaggatcccc ttaaatcgat atggaacgag 5040

ctatacaagg aaacgacgct agggaacaag ctaacagtga acgttgggat ggaggatcag 5100

gaggtaccac ttctcccttc aaacttcctg acgaaagtcc gagttggact gagtggcggc 5160

tacataacga tgagacgaat tcgaatcaag ataatcccct tggtttcaag gaaagctggg 5220

gtttcgggaa agttgtattt aagagatatc tcagatacga caggacggaa gcttcactgc 5280

acagagtcct tggatcttgg acgggagatt cggttaacta tgcagcatct cgatttttcg 5340

gtttcgacca gatcggatgt acctatagta ttcggtttcg aggagttagt atcaccgttt 5400

ctggagggtc tcgaactctt cagcatctct gtgagatggc aattcggtct aagcaagaac 5460

tgctacagct tgccccaatc gaagtggaaa gtaatgtatc aagaggatgc cctgaaggta 5520

ctcaaacctt cgaaaaagaa agcgagtaag tcgagggcga gctcgaattc ggtacgctga 5580

aatcaccagt ctctctctac aaatctatct ctctctattt tctccataaa taatgtgtga 5640

gtagtttccc gataagggaa attagggttc ttatagggtt tcgctcatgt gttgagcata 5700

taagaaaccc ttagtatgta tttgtatttg taaaatactt ctatcaataa aatttctaat 5760

tcctaaaacc aaaatccagt actaaaatcc agatctccta aagtccctat agatctttgt 5820

cgtgaatata aaccagacac gagacgacta aacctggagc ccagacgccg ttcgaagcta 5880

gaagtaccgc ttaggcagga ggccgttagg gaaaagatgc taaggcaggg ttggttacgt 5940

tgactccccc gtaggtttgg tttaaatatg atgaagtgga cggaaggaag gaggaagaca 6000

aggaaggata aggttgcagg ccctgtgcaa ggtaagaaga tggaaatttg atagaggtac 6060

gctactatac ttatactata cgctaaggga atgcttgtat ttatacccta taccccctaa 6120

taacccctta tcaatttaag aaataatccg cataagcccc cgcttaaaaa ttggtatcag 6180

agccatgaat aggtctatga ccaaaactca agaggataaa acctcaccaa aatacgaaag 6240

agttcttaac tctaaagata aaagatggcg cgtggccggc catgagcgga gaattaaggg 6300

agtcacgtta tgacccccgc cgatgacgcg ggacaagccg ttttacgttt ggaactgaca 6360

gaaccgcaac gttgaaggag ccactcagcc gcgggtttct ggagtttaat gagctaagca 6420

catacgtcag aaaccattat tgcgcgttca aaagtcgcct aaggtcacta tcagctagca 6480

aatatttctt gtcaaaaatg ctccactgac gttccataaa ttcccctcgg tatccaatta 6540

gagtctcata ttcactctca atccaaataa tctgcaccgg atctggatcg tttcgcatga 6600

ttgaacaaga tggattgcac gcaggttctc cggccgcttg ggtggagagg ctattcggct 6660

atgactgggc acaacagaca atcggctgct ctgatgccgc cgtgttccgg ctgtcagcgc 6720

aggggcgccc ggttcttttt gtcaagaccg acctgtccgg tgccctgaat gaactgcagg 6780

acgaggcagc gcggctatcg tggctggcca cgacgggcgt tccttgcgca gctgtgctcg 6840

acgttgtcac tgaagcggga agggactggc tgctattggg cgaagtgccg gggcaggatc 6900

tcctgtcatc tcaccttgct cctgccgaga aagtatccat catggctgat gcaatgcggc 6960

ggctgcatac gcttgatccg gctacctgcc cattcgacca ccaagcgaaa catcgcatcg 7020

agcgagcacg tactcggatg gaagccggtc ttgtcgatca ggatgatctg gacgaagagc 7080

atcaggggct cgcgccagcc gaactgttcg ccaggctcaa ggcgcgcatg cccgacggcg 7140

atgatctcgt cgtgacccat ggcgatgcct gcttgccgaa tatcatggtg gaaaatggcc 7200

gcttttctgg attcatcgac tgtggccggc tgggtgtggc ggaccgctat caggacatag 7260

cgttggctac ccgtgatatt gctgaagagc ttggcggcga atgggctgac cgcttcctcg 7320

tgctttacgg tatcgccgct cccgattcgc agcgcatcgc cttctatcgc cttcttgacg 7380

agttcttctg agcgggactc tggggttcga aatgaccgac caagcgacgc ccaacctgcc 7440

atcacgagat ttcgattcca ccgccgcctt ctatgaaagg ttgggcttcg gaatcgtttt 7500

ccgggacgcc ggctggatga tcctccagcg cggggatctc atgctggagt tcttcgccca 7560

cgggatctct gcggaacagg cggtcgaagg tgccgatatc attacgacag caacggccga 7620

caagcacaac gccacgatcc tgagcgacaa tatgatcgcg gcgtccacat caacggcgtc 7680

ggcggcgact gcccaggcaa gaccgagatg caccgcgata tcttgctgcg ttcggatatt 7740

ttcgtggagt tcccgccaca gacccggatg atccccgatc gttcaaacat ttggcaataa 7800

agtttcttaa gattgaatcc tgttgccggt cttgcgatga ttatcatata atttctgttg 7860

aattacgtta agcatgtaat aattaacatg taatgcatga cgttatttat gagatgggtt 7920

tttatgatta gagtcccgca attatacatt taatacgcga tagaaaacaa aatatagcgc 7980

gcaaactagg ataaattatc gcgcgcggtg tcatctatgt tactagatcg ggggccggcc 8040

ctcactggtg aaaagaaaaa ccaccccagt acattaaaaa cgtccgcaat gtgttattaa 8100

gttgtctaag cgtcaatttg tttacaccac aatatatcct gccaccagcc agccaacagc 8160

tccccgaccg gcagctcggc acaaaatcac cactcgatac aggcagccca tcagtccggg 8220

acggcgtcag cgggagagcc gttgtaaggc ggcagacttt gctcatgtta ccgatgctat 8280

tcggaagaac ggcaactaag ctgccgggtt tgaaacacgg atgatctcgc ggagggtagc 8340

atgttgattg taacgatgac agagcgttgc tgcctgtgat caaatatcat ctccctcgca 8400

gagatccgaa ttatcagcct tcttattcat ttctcgctta accgtgacag agtagacagg 8460

ctgtctcgcg gccgaggggc gcagcccctg gggggatggg aggcccgcgt tagcgggccg 8520

ggagggttcg agaagggggg gcacccccct tcggcgtgcg cggtcacgcg cacagggcgc 8580

agccctggtt aaaaacaagg tttataaata ttggtttaaa agcaggttaa aagacaggtt 8640

agcggtggcc gaaaaacggg cggaaaccct tgcaaatgct ggattttctg cctgtggaca 8700

gcccctcaaa tgtcaatagg tgcgcccctc atctgtcagc actctgcccc tcaagtgtca 8760

aggatcgcgc ccctcatctg tcagtagtcg cgcccctcaa gtgtcaatac cgcagggcac 8820

ttatccccag gcttgtccac atcatctgtg ggaaactcgc gtaaaatcag gcgttttcgc 8880

cgatttgcga ggctggccag ctccacgtcg ccggccgaaa tcgagcctgc ccctcatctg 8940

tcaacgccgc gccgggtgag tcggcccctc aagtgtcaac gtccgcccct catctgtcag 9000

tgagggccaa gttttccgcg aggtatccac aacgccggcg gccgcggtgt ctcgcacacg 9060

gcttcgacgg cgtttctggc gcgtttgcag ggccatagac ggccgccagc ccagcggcga 9120

gggcaaccag cccggtgagc gtcggaaagg cgctcggtct tgccttgctc gtcggtgatg 9180

tacactagtc gctggctgct gaacccccag ccggaactga ccccacaagg ccctagcgtt 9240

tgcaatgcac caggtcatca ttgacccagg cgtgttccac caggccgctg cctcgcaact 9300

cttcgcaggc ttcgccgacc tgctcgcgcc acttcttcac gcgggtggaa tccgatccgc 9360

acatgaggcg gaaggtttcc agcttgagcg ggtacggctc ccggtgcgag ctgaaatagt 9420

cgaacatccg tcgggccgtc ggcgacagct tgcggtactt ctcccatatg aatttcgtgt 9480

agtggtcgcc agcaaacagc acgacgattt cctcgtcgat caggacctgg caacgggacg 9540

ttttcttgcc acggtccagg acgcggaagc ggtgcagcag cgacaccgat tccaggtgcc 9600

caacgcggtc ggacgtgaag cccatcgccg tcgcctgtag gcgcgacagg cattcctcgg 9660

ccttcgtgta ataccggcca ttgatcgacc agcccaggtc ctggcaaagc tcgtagaacg 9720

tgaaggtgat cggctcgccg ataggggtgc gcttcgcgta ctccaacacc tgctgccaca 9780

ccagttcgtc atcgtcggcc cgcagctcga cgccggtgta ggtgatcttc acgtccttgt 9840

tgacgtggaa aatgaccttg ttttgcagcg cctcgcgcgg gattttcttg ttgcgcgtgg 9900

tgaacagggc agagcgggcc gtgtcgtttg gcatcgctcg catcgtgtcc ggccacggcg 9960

caatatcgaa caaggaaagc tgcatttcct tgatctgctg cttcgtgtgt ttcagcaacg 10020

cggcctgctt ggcctcgctg acctgttttg ccaggtcctc gccggcggtt tttcgcttct 10080

tggtcgtcat agttcctcgc gtgtcgatgg tcatcgactt cgccaaacct gccgcctcct 10140

gttcgagacg acgcgaacgc tccacggcgg ccgatggcgc gggcagggca gggggaagcc 10200

agttgcacgc tgtcgcgctc gatcttggcc gtagcttgct ggaccatcga gccgacggac 10260

tggaaggttt cgcggggcgc acgcatgacg gtgcggcttg cgatggtttc ggcatcctcg 10320

gcggaaaacc ccgcgtcgat cagttcttgc ctgtatgcct tccggtcaaa cgtccgattc 10380

attcaccctc cttgcgggat tgccccgact cacgccgggg caatgggccc ttattcctga 10440

tttgacccgc ctgggggctt gggtgtccag aa 10472

Claims (10)

1. A plant transient expression vector comprising a 5' UTR region, an MCS region and a SEKDEL sequence.

2. The plant transient expression vector of claim 1, wherein the sequence of said 5' UTR region, MCS region and SEKDEL sequence is as set forth in SEQ ID No. 1.

3. The plant transient expression vector of claim 1 or 2, which has as its basic backbone the plant expression vector pEAQ.

4. The plant transient expression vector of any one of claims 1 to 3, further comprising a target gene, wherein the target gene has a PacI cleavage site added at the N-terminal and an XhoI cleavage site added at the C-terminal.

5. The plant transient expression vector of any one of claims 2 to 4, wherein the sequence shown in SEQ ID No.1 is amplified by using the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No. 3.

6. The plant transient expression vector of claim 5, wherein said amplified amplification system comprises 22 μ lddH₂O, 25. mu.l KOD OneTM PCR MasterMix, 1. mu.l 10. mu.M upstream primer shown in SEQ ID No.2, 1. mu.l 10. mu.MA downstream primer shown as SEQ ID No.3, and 1ul of 100ng/ul of plasmid template containing an artificially synthesized sequence SEQ ID No. 1.

7. The plant transient expression vector of claim 5 or 6, wherein said amplification procedure is: 30 seconds at 98 ℃; 28 cycles: 10 seconds at 98 ℃; 30 seconds at 55 ℃; 68 ℃ for 10 seconds; 5 minutes at 68 ℃; 10 minutes at 4 ℃.

8. Use of the plant transient expression vector of any one of claims 1 to 7 for expressing a foreign protein.

9. The use of claim 8, wherein said foreign protein comprises GFP.

10. The method for expressing the foreign protein by the plant transient expression vector is characterized by comprising the following steps:

step 1: constructing a plant transient expression vector of claim 1;

step 2: inserting a gene of a foreign protein into the plant transient expression vector prepared in the step 1; obtaining a recombinant plasmid;

and step 3: and (3) transforming the recombinant plasmid prepared in the step (2) into host competence, culturing, collecting bacterial liquid, infiltrating plant leaves, and extracting protein.

Images