CN111808857A - Polygonum cuspidatum PcMYB1 gene promoter as well as amplification method and application thereof - Google Patents

Abstract

The invention discloses a polygonum cuspidatum PcMYB1 gene promoter as well as an amplification method and application thereof, belonging to the technical field of genetic engineering, wherein the sequence of the PcMYB1 gene promoter is shown in a sequence table SEQ NO.1, and 35 'end deletion fragments of the PcMYB1 gene promoter are obtained by cloning, and the activities of the 5' end deletion fragments of the PcMYB1 gene promoter and the PcMYB1 gene promoter are verified by transgenic technology and GUS histochemical staining. The invention not only clones the PcMYB1 gene promoter of the giant knotweed for the first time, but also clones 3 active PcMYB1 gene promoters with shorter sequences of 5' end deletion fragments, can reduce the operation difficulty of gene recombination and genetic transformation, has important value on the expression of MYB transcription factors in plants, and simultaneously provides a specific primer and a sequence thereof which are adopted by amplifying the PcMYB1 gene promoter of the giant knotweed by utilizing HITAIL-PCR.

Description

Polygonum cuspidatum PcMYB1 gene promoter as well as amplification method and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a polygonum cuspidatum PcMYB1 gene promoter as well as an amplification method and application thereof.

Background

Polygonum cuspidatum (Polygonum cuspidatum Sieb. et Zucc.) is a perennial herb of Polygonaceae, has a thick and strong rhizome, a vertical stem, a height of 2m, a hollow shape, a wide leaf, an oval shape or an oval shape, a cuticle shape, no hair on two sides, a pointed top end, a wide wedge-shaped base, a truncated shape or a nearly circular shape, a leaf-supporting sheathing membrane material, a cone inflorescence, a parthenocarpy, a male and female heterostrain and an axillary; the bract is funnel-shaped, the flower quilt is light green, the lean fruit is egg-shaped, the fruit is glossy and black brown, the fruit blooms in 8-9 months, and the fruit can bear in 9-10 months. The root or rhizome is used as medicine and is rich in resveratrol, flavonoid and other effective components.

The MYB transcription factor family is one of the largest transcription factor families in plant genomes, and participates in regulating and controlling the synthesis of medicinal plant effective components, and the salvia miltiorrhiza SmMYB39 influences the synthesis of rosmarinic acid by regulating and controlling the expression of key enzyme genes in phenylpropanoid metabolic pathway. After the bHLH and WP40 transcription factors in the saussurea medusa Maxim form a binary complex, the binary complex and MYB transcription factors jointly regulate and control the expression of structural genes in a flavonoid synthesis way. The accumulation of flavone in the cotyledons in the germination process of the tartary buckwheat seeds is regulated and controlled by FtMyb2 and FtMyb 3. Under the stress conditions of ultraviolet rays, damage, pathogenic bacteria and the like, the grapes VvMYB14 and VvMYB15 regulate the expression of resveratrol synthase genes, and further influence the synthesis of resveratrol.

At present, the study on MYB gene transcription factors is relatively extensive and thorough, but the related study on MYB gene promoters of polygonum cuspidatum is not reported yet. Related researches show that the MYB family gene promoter sequence contains basic components such as promoters TATA-box and CAAT-box, and also contains certain specific cis-acting elements related to hormone, stress resistance, tissue organ development and the like, and the MYB family gene promoter sequence is supposed to play a role in regulating and controlling the activation and induction of MYB transcription factors.

Disclosure of Invention

The invention aims to amplify a polygonum cuspidatum PcMYB1 gene promoter based on a polygonum cuspidatum PcMYB1 gene cDNA sequence, and clone 5' end deletion fragments of 3 PcMYB1 gene promoters.

In order to achieve the purpose, the technical scheme of the invention is as follows:

the promoter has a sequence shown in a sequence table SEQ NO. 1.

A5' end deletion fragment of a promoter is respectively P2, P3 and P4, wherein the sequence of P2 is shown as a sequence table SEQ NO.2, the sequence of P3 is shown as a sequence table SEQ NO.3, and the sequence of P4 is shown as a sequence table SEQ NO. 4.

The promoter or the 5' end deletion fragment of the promoter is applied to activating and inducing the expression of the PcMYB1 gene of the giant knotweed.

A vector comprising the promoter or a 5' deleted fragment of the promoter.

A genetically engineered bacterium comprises the vector.

The amplification method of the promoter is a hitAIL-PCR method, and comprises the following specific steps:

s1, performing first round of PCR amplification by adopting PCR buffer solution, dNTP, giant knotweed genomic DNA, ExTaq-DNA polymerase and primers LAD1-1, LAD1-2, LAD1-3, LAD1-4 and SP0-1, wherein the sequence of the primer SP0-1 is shown as a sequence table SEQ NO. 5;

s2, diluting the product obtained in the step S1 to be used as a template, and performing second round of PCR amplification by adopting PCR buffer solution, dNTP, ExTaq-DNA polymerase and primers AC1 and SP1-1, wherein the sequence of the primer SP1-1 is shown as a sequence table SEQ NO. 6;

s3, diluting the product obtained in the step S2 to be used as a template, and performing third PCR amplification by adopting PCR buffer solution, dNTP, ExTaq-DNA polymerase and primers AC1 and SP2-1, wherein the sequence of the primer SP2-1 is shown in a sequence table SEQ NO. 7;

s4, recovering the product obtained in the step S3, connecting the product to a vector, converting the vector into a competent cell, and picking a recombinant for sequencing to obtain the sequence of the promoter.

The primer for amplifying the promoter or the 5' end deletion fragment of the promoter is shown in a sequence table SEQ NO.8, the upstream primer for amplifying P2 is shown in a sequence table SEQ NO.9, the upstream primer for amplifying P3 is shown in a sequence table SEQ NO.10, the upstream primer for amplifying P4 is shown in a sequence table SEQ NO.11, the downstream primers for amplifying the promoter, P2, P3 and P4 are the same, and the sequence of the downstream primer is shown in a sequence table SEQ NO. 12.

A method of inducing expression of a gene of interest, the method comprising:

s1, transforming the vector into agrobacterium;

s2, infecting giant knotweed tissue cells with the agrobacterium obtained in the step S1;

s3, culturing the infected giant knotweed tissue cells in the step S2 to express the target gene in the giant knotweed tissue cells.

The invention has the beneficial effects that:

(1) the invention clones the promoter of the polygonum cuspidatum PcMYB1 gene for the first time, clones 5 'end deletion fragments of 3 PcMYB1 gene promoters, and verifies the activity of the 5' end deletion fragments of the PcMYB1 gene promoter and the PcMYB1 gene promoter through transgenic technology and GUS histochemical staining.

(2) The 5' -end deletion fragments of the 3 PcMYB1 gene promoters obtained by cloning are relatively short in sequence and active, so that the difficulty in gene recombination and genetic transformation operation is reduced, and the method has important value on expression of MYB transcription factors in plants.

(3) The invention provides a specific primer and a sequence thereof for amplifying a polygonum cuspidatum PcMYB1 gene promoter by utilizing hitAIL-PCR.

(4) The PcMYB1 gene promoter contains some specific cis-acting elements related to hormone, stress resistance, tissue organ development and the like, and the cis-acting elements are presumed to play a role in regulating and controlling the activation and induction of MYB transcription factors.

Drawings

FIG. 1 is a schematic diagram showing the fusion of the PcMYB1 gene promoter and its 5 '-deleted fragment with GUS gene in example 2 of the present invention, in which the legend of each cis-acting element has been labeled in the lower left corner, +1 is the ATG position, and the negative value indicates the 5' -terminal sequence from the translation initiation codon, and TATA-box, CAAT-box, etc. basic constituent elements have been omitted;

FIG. 2 is GUS histochemical staining analysis of transgenic hairy roots in example 3 of the present invention;

Detailed Description

The technical solutions of the present invention will be described clearly and completely with reference to the following embodiments of the present invention, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1 cloning of the Polygonum cuspidatum PcMYB1 promoter

Extraction of giant knotweed genome total DNA by CTAB method

(1) Taking 0.1g of giant knotweed rhizome young and tender leaves, grinding the young and tender leaves into powder in liquid nitrogen, and transferring the powder into a 1.5mL centrifuge tube; adding 750 μ L CTAB extracting solution preheated at 65 deg.C, quickly vortex and mixing; water bath at 65 deg.C, cracking for 45min, and gently shaking once every 15 min;

(2) taking out after cracking, cooling, adding equal volume of chloroform isoamyl alcohol (24:1) into a fume hood, gently inverting and mixing, standing for 10min, and centrifuging at 12000rpm and 4 ℃ for 10 min;

(3) centrifuging, adding equal volume of isopropanol pre-cooled at-20 deg.C, mixing, placing on ice for 30min to obtain white flocculent precipitate, and centrifuging at 12000rpm and 4 deg.C for 10 min;

(4) centrifuging, removing supernatant, rinsing with 75% ethanol for 2-3 times, rinsing with 1mL of absolute ethanol once to obtain precipitate, and drying the precipitate in a metal bath at the temperature of below 64 ℃ until the precipitate is semitransparent;

(5) dissolving the precipitate with 50 μ L TE or sterilized ultrapure water to obtain total DNA of rhizoma Polygoni Cuspidati genome, taking 1 μ L DNA concentration measured by nucleic acid analyzer, and standing at-20 deg.C for use.

Amplification of PcMYB1 Gene upstream sequence by HITAIL-PCR

(1) Designing a primer: the promoter sequence of the PcMYB1 gene was amplified by hitAIL-PCR based on the cDNA sequence of the PcMYB1 gene (GenBank accession number KY 495789). Specific primers are designed for PCR amplification by using software Primer Premier 5.0, and the sequences of the primers are shown in Table 1 and SEQ NO.5-7 of the sequence table.

(2) The hitAIL-PCR method comprises the following steps of:

s1, first round PCR amplification: the reaction system is as follows: 10 XPCR buffer 2 uL, dNTP 1.6 uL, primer LAD (LAD1-1, LAD1-2, LAD1-3 and LAD1-4 are mixed, the sequence details are shown in Table 1)2 uL, primer SP0-1(SEQ NO.5)0.6 uL, ExTaq-DNA polymerase 0.1 uL, genome DNA1 uL, ddH₂O12.7 mu L; the amplification conditions were: pre-denaturation at 94 ℃ for 3 min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 1min, extension at 72 ℃ for 3min, and 10 cycles; denaturation at 94 ℃ for 30s, annealing at 25 ℃ for 2min, extension at 72 ℃ for 3min, and 2 cycles; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 1min, extension at 72 ℃ for 3min, and 23 cycles; finally, the temperature is kept for 5min at 72 ℃.

S2, second round PCR amplification: diluting the product obtained by the first round of PCR amplification by 40 times, and taking the diluted product as a template of the second round of reaction; the reaction system is as follows: 2.5. mu.L of 10 XPCR buffer, 2. mu.L of dNTP, 0.75. mu.L of primer AC1 (detailed sequence in Table 1), 0.75. mu.L of primer SP1-1(SEQ NO.6), 0.1. mu.L of ExTaq-DNA polymerase, 1. mu.L of template, ddH₂O17.9 μ L; the amplification conditions were: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 1min, extension at 72 ℃ for 3min, and 35 cycles; finally, the temperature is kept for 5min at 72 ℃.

S3, third round PCR amplification: diluting the product obtained by the second round of PCR amplification by 10 times to be used as a template of the third round of reaction; the reaction system is as follows: 2.5. mu.L of 10 XPCR buffer, 2. mu.L of dNTP, 10.75. mu.L of primer AC, 0.75. mu.L of primer SP2-1(SEQ NO.7), 0.1. mu.L of ExTaq-DNA polymerase, 1. mu.L of template, ddH₂O17.9. mu.L. The amplification conditions were: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 1min, extension at 72 ℃ for 3min, and 35 cycles; finally, the temperature is kept for 5min at 72 ℃.

S4, recovering the third round of PCR product, connecting the recovered product to a T vector, transforming the T vector to an escherichia coli competent cell, selecting a recombinant for sequencing, wherein the sequence of the PcMYB1 gene promoter is shown as a sequence table SEQ NO. 1.

S5, analyzing the sequencing result by using DNAstar software, and naming the recombinant as pMD18-T-PcMYB 1. The obtained upstream promoter sequence of the polygonum cuspidatum PcMYB1 gene is analyzed by using online promoter sequence analysis software PlantCARE and PLACE, and potential transcription regulatory elements in a conserved region of the promoter are searched, wherein the predicted sites and functions of cis-acting elements of the PcMYB1 gene promoter are shown in Table 2.

Cloning of deletion fragment at 5' end of PcMYB1 gene promoter

(1) According to a predicted cis-acting element of a PcMYB1 gene promoter, the 5 'end of the PcMYB1 gene promoter sequence is deleted into 4 sequences P1, P2, P3 and P4 with different lengths, wherein P1 is the full length (2884bp) of the PcMYB1 gene promoter, the sequence of P2 is shown in a sequence table SEQ NO.2 (2259bp), the sequence of P3 is shown in a sequence table SEQ NO.3 (1807bp), the sequence of P4 is shown in a sequence table SEQ NO. 4(1361bp), a primer corresponding to the 5' end deletion promoter is designed, the primer sequences are shown in a table 1 and sequence tables SEQ NO.8-12 (P1-F, P2-F, P3-F and P4-F are respectively upstream primers corresponding to P1-P4), the downstream primers of P1-P4 are the same, and the name of the primers is pro-R). In the sequences of P1-F, P2-F, P3-F and P4-F, AAAA at the 5 'end is a protective base, CTGCAG is an enzyme cutting site of PstI, CGC at the 5' end in the pro-R sequence is a protective base, and GGATCC is an enzyme cutting site of BamHI.

(2) PCR amplification is respectively carried out by using Taq enzyme by taking pMD18-T-PcMYB1 plasmid as a template;

wherein the PCR reaction system is as follows: 2.5. mu.L of 10 XExTaq Buffer, 2.5mM dNTP 2. mu.L, 0.5. mu.L of primer pro-R (10. mu. mol/L), 0.5. mu.L of primer P1-F or P2-F or P3-F or P4-F (10. mu. mol/L), 0.2. mu.L of ExTaq DNA polymerase, 1. mu.L of template, ddH₂O18.3. mu.L. PCR amplification conditions: pre-denaturation at 94 ℃ for 2 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 1min, extension at 72 ℃ for 1min, and 35 cycles; extension at 72 ℃ for 5 min.

Note: the DNA extraction kit used in this example was purchased from Tiangen Biochemical technology (Beijing) Ltd; restriction enzymes were purchased from TaKaRa, Japan (Shanghai).

TABLE 1 primer sequences

Table 2 predicted cis-acting element sites and functions of PcMYB1 gene promoter

Example 2 construction of Polygonum cuspidatum PcMYB1 promoter plant expression vector

1. Construction and validation of expression vectors

According to the sequence of the PcMYB1 promoter and the characteristics of the plant expression vector, the plant expression vector 1300G is selected, is a binary vector and contains a GUS gene system and a CaMV35S promoter. In order to research the function of the PcMYB1 gene promoter, the promoter is used for replacing a CaMV35S promoter in a plant expression vector 1300G, and is fused with a GUS reporter gene (the fusion schematic diagram of the fragments P1, P2, P3 and P4 and the GUS gene is shown in the attached figure 1, wherein +1 is an ATG position, negative values represent a 5' end sequence from a translation initiation codon, and basic components such as TATA-box and CAAT-box are omitted in the figure), so that the plant expression vector is constructed, and the specific method is as follows:

s1, carrying out two-step enzyme digestion on the P1, P2, P3 and P4 fragments obtained by PCR amplification by using PstI and BamHI restriction enzymes respectively: wherein the enzyme cutting system in the first step is as follows: the PCR purified product 43.5. mu.L, BamHI 1.5. mu.L, 10 XBamHI Buffer 5. mu.L, was purified after digestion at 37 ℃ for 2 h; the second step of enzyme cutting system is as follows: carrying out enzyme digestion at 37 ℃ for 1h and then purifying the enzyme digestion product of the first step, wherein the enzyme digestion product of the first step is 44 mu L, PstI is 1 mu L, and 10 XOBuffer is 5 mu L;

s2, carrying out double enzyme digestion reaction on the 1300G vector. A double enzyme digestion system: 10 × BamHI Buffer 5 μ L, PstI 1 μ L, BamHI 1 μ L, 1300G vector plasmid 20 μ L, ddH₂O23. mu.L. After 2h of cleavage at 37 ℃ the process is repeatedSeparating the enzyme-digested fragments by agarose gel electrophoresis, and recovering the target fragment by using a gel recovery kit. Then, the recovered 1300G expression vector and the P1, P2, P3 and P4 fragments obtained in the step S1 are mixed in a ratio of about 1:20 according to the ratio of T₄DNA ligase Specification, ligation reaction was performed using a PCR instrument. Wherein the connection reaction system is as follows: 1300G expression vector fragment 3 uL, PcMYB1 gene promoter fragment (P1 or P2 or P3 or P4)1 uL, 10 XT₄DNA Ligase Buffer 1.0μL，T₄DNA Ligase 0.2μL，ddH₂O5. mu.L was reacted at 22 ℃ for 1h and then at 65 ℃ for 10 min. And finally, sequencing the positive plasmids with correct PCR identification and double enzyme digestion verification, and after determining that no basic group mutation exists, naming the positive plasmids as 1300G-P1, 1300G-P2, 1300G-P3 and 1300G-P4, namely the PcMYB1 gene plant expression recombinant vector.

2. Expression vector transformation of agrobacterium

The expression vector is transferred into agrobacterium ATCC15834 by an electric transfer method, and plasmid of the positive bacteria is extracted for enzyme digestion identification after PCR preliminary identification, and the specific operation method is as follows:

s1, taking out the electric shock cup which is placed in 75% alcohol for a long time, soaking and washing the electric shock cup for 3 times by using absolute ethyl alcohol, placing the electric shock cup on a clean bench for drying, performing ultraviolet treatment for half an hour, and then placing the electric shock cup on ice for precooling.

S2, taking out the agrobacterium tumefaciens competent cells ATCC15834 from a refrigerator at the temperature of-80 ℃, unfreezing the agrobacterium tumefaciens competent cells on ice, adding 10 mu L of the plasmid (1300G-P1, 1300G-P2, 1300G-P3 or 1300G-P4) into 100 mu L of the unfrozen competent cells, gently whipping the mixture by using a spearhead, uniformly mixing the mixture, and transferring the mixture into a pre-cooled electric shock cup.

S3, turning on a power switch of the electric rotating instrument, adjusting the voltage to 1800V, placing the electric shock cup into the electric rotating instrument for electric shock, taking out the electric shock cup after hearing a sound of buzzing, adding 800 mu L of precooled non-antibiotic YMB liquid culture medium into the electric shock cup, slightly pumping and uniformly mixing, transferring the electric shock cup into a 1.5mL sterile centrifuge tube by using a pipette, and carrying out shading and shaking culture for 3-4 h at 180rpm in a shaking table at 28 ℃.

S4, sucking 50 mu L of the bacterial liquid obtained in the step S3, uniformly coating the bacterial liquid on a YMB (containing 50mg/L Kan) plate culture medium by using a sterile coating rod, and culturing the YMB plate culture medium in an inverted manner at the constant temperature of 28 ℃ for 2-3 days under the dark condition.

S5, selecting single colony, culturing in dark at 28 deg.C for 2-3d, and performing PCR identification, wherein the positive clone can be used for converting folium Polygoni Cuspidati, or adding glycerol with final concentration of 20%, and storing in-80 deg.C ultra-low temperature refrigerator.

Note: the agrobacterium competence ATCC15834 and the expression vector 1300G used in this example were experimentally stored by the university of the Yangtze river at the institute of Life sciences; t is₄DNA ligase and ExTaq enzyme were purchased from TaKaRa, Japan (Dalian).

Example 3 analysis of PcMYB1 Gene promoter for loss of function in transgenic Polygonum cuspidatum hairy roots

The method comprises the following steps of respectively transforming giant knotweed leaves by using an agrobacterium-mediated method and taking an agrobacterium ATCC15834 empty strain as a negative control and a strain 1300G containing a CaMV35S promoter as a positive control, and carrying out GUS transient expression identification, wherein the method comprises the following specific steps:

s1, the successfully transformed positive agrobacterium liquid, the agrobacterium ATCC15834 empty strain and the strain containing the CaMV35S promoter 1300G vector obtained in the example 2 are dipped with a small amount of liquid by an inoculating loop after burning sterilization and cooling, and are respectively inoculated on TY solid culture medium plates without Kan and with 50mg/L Kan, and then are inversely cultured for 2-3d at the temperature of 28 ℃ under the dark condition.

S2, selecting a single colony with a proper size, inoculating the single colony in a TY liquid culture medium which does not contain Kan and contains 50mg/L Kan, and placing the single colony in a dark condition at a constant temperature of 28 ℃ for shake culture for 24-36 h.

S3, inoculating the bacterial liquid cultured in the step S2 into TY non-resistant liquid culture medium according to the ratio of 1:50, carrying out shake culture at 28 ℃, 200rpm and keeping out of the sun, and carrying out secondary activation. Bacterium solution D₆₀₀When the concentration is 0.6 to 0.8, the shaking culture is stopped.

S4, respectively taking 8mL of the bacterial liquid cultured in the step S3 and 30mL of 1/2MS liquid to culture in a sterile culture bottle, and uniformly mixing for later use, wherein the mixed liquid is the infection liquid used for infecting the polygonum cuspidatum leaves.

S5, selecting strong giant knotweed aseptic tissue culture seedling leaves, cutting the strong giant knotweed aseptic tissue culture seedling leaves into leaf blocks of about 1cm by using a sharp aseptic surgical blade, and discarding the midrib.

S6, respectively placing the leaf blocks prepared in the step S5 in the agrobacterium infection liquid prepared in the step S4, shading and soaking for 10min, and slightly shaking the tissue culture bottle in the process to enable the leaf blocks to be fully contacted with the infection liquid.

S7, taking out the leaf blocks, placing the leaf blocks on sterile filter paper to suck redundant bacterial liquid, transferring the infected leaf blocks to a 1/2MS culture medium, placing the back of each leaf block downwards, and performing inversion dark culture at 25 ℃ for 2-3 days.

4 plant expression recombinant vectors 1300G-P1, 1300G-P2, 1300G-P3 and 1300G-P4 of PcMYB1 genes are subjected to giant knotweed genetic transformation by an agrobacterium-mediated leaf disc method, and GUS staining is performed on the obtained transgenic hairy roots, and the result is shown in figure 2. Wherein CK^-CK as a negative control (i.e., unable to induce GUS gene expression and unable to stain)⁺For positive control (strong promoter CaMV35S can induce GUS gene expression, and successful staining can be achieved), P1, P2, P3 and P4 correspond to 4 recombinant vectors. The result shows that after the PcMYB1 gene promoter fragments P1, P2, P3 and P4 are used for replacing a CaMV35S promoter, and a recombinant vector is constructed, all finally obtained hairy roots can be dyed blue, namely the 4 PcMYB1 gene promoter fragments all have activity, and the P4(1361bp) of the minimum fragment still keeps the function of the PcMYB1 promoter.

Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.

Sequence listing

<110> university of Yangtze river

<120> Polygonum cuspidatum PcMYB1 gene promoter, and amplification method and application thereof

<160>12

<170>SIPOSequenceListing 1.0

<210>1

<211>2884

<212>DNA

<213> Polygonum cuspidatum (Polygonum cuspidatum Sieb. et Zucc.)

<400>1

gatggactcc agagcggccg cgcggtatcc aaaggtacta tcttccgata tttttacaaa 60

gcatttccga aaaggagata cgttagatgt ggaaaaccga tatactgcca tgtgcaacta 120

ttgtcccacg atttaccaat agaaatgagg aggaggttat ggcaccttga cgaagcatat 180

gaaccaaaaa cacaaagaca agttgggcat gatgcaagga caatcacagc ttgccgggtt 240

tgcatcttct tcctgtcaaa atcctcattt atttcgttat gatcatgaac gtagtgttta 300

tgctttgttc gaatccatat gcgttgatca tttggcattt taattttctg aaaatttggg 360

ttttaataat tggctcacta attatgtgca acccacttat aaaccatgtt ctagaaaaac 420

aattaggaaa aatgtgataa gagcatatca tactcgtaag caagctttga attggttttt 480

ttctcaaaat gatatttgtg tttctatttg tagtgatatt tggagtgatc attttcaaac 540

tcattcatac atgagcatta catgtcattt tattgatgat caatttaaca tgcaaaaaag 600

agttttgtct tatagggaat ttggcgagtc tcataccgtc caaaatattt gtaacattat 660

acgtactatt ctagaagagt atataatcct tcatagagtt tttctattta atttgatatt 720

gcggctaata acaccgcttc tattagtgat ttgattcaag tttgtgaacc gacttttaga 780

aacaaatttt ttcatgtatg atgtgtttgc catgttttaa acttatgtgt tcaagatggt 840

ttaagggttt tgtccgaatt acttcaacct attaaatatg ttattagata tatttggtta 900

aaatcaaaga ctacaaaaga atggaagaat ttttataagg accgtagctt taaaccaaga 960

cgtttttcaa aagacgtcgg tcatcgttgg agctctactt ataaattact tcatcaataa 1020

ttagtttaca aagatttttt gtcttctttt ttcgctcaac atgttccgaa ctcgtcaacg 1080

attagacccg tttgggacca atattacgac attattgtaa ttttaaaagt tttcaattat 1140

gcaacttata cttttagtca tgtttatgca ccatcttctc atatgtttac ttttaaagct 1200

ttgaaattgg cgggtgcctt tagtaaaggg cttaataacc ccgaatttta tgaggctatt 1260

gtagttatga agaggaagtg gttaaactat tataaagtta ttttcgatat ttatcttgtt 1320

gcttgcgttt tttatcctag atgtaaaatt gaaggtttgc aaaaatcatt agatacatac 1380

catgagttat tgcaattaga atttaatgat caagattata atgttacaca aattttgctt 1440

cgtattagaa ctcttattga tgatttgtat aaggcttatc attctagcac gggtggtgat 1500

gatgcgcatt cttcgcctca attacctcca tcctccttgt cccgtagatc gtttatagga 1560

acgggttctc gtctattaca aaatcttact aaaagaccaa ggcattcgag ctcacatacg 1620

gagttcaata cttatctaac aactactttt gagtttgtag ttgtagatga ccattttgat 1680

gttttagatt ggtggttgaa acacaagaag acgttcctaa cattagcaaa gatcgtcact 1740

caacttctcg tcgttcccgc ctcaacggta gaggtggagc aaactttcag ctaaggtggg 1800

cacatccttg acgagaagag atcaagattg gcgcccgaag cattgaaagc tcaagtttgc 1860

gtcaacgatt ggaagagggt gaaacttaga caacaaacat ttaactatac ggattcatcg 1920

tatgatctac ttggcgacga cacatgtggt actcccagtc cttccggtgg ttccaaaggt 1980

tcgtcttaag taagtggggt ttcggaaagg taagagaact atgtgggctt tgattcctct 2040

aaaaccccga gaggatacgt aggtaactta atattaagtt caagcccttt aatactcttc 2100

ttttttttaa aagagtatac attaactata ttagttaggc taatctagaa ctttaagcta 2160

ttatcatggt caaattgtgg ttgtaatttt gttgttcacg ttatttgatt tagttaaact 2220

cttgtaatcg aaattatttc ttattgtatc caaaaatgtc tcgtaactcc cgttcgaata 2280

attataaaat attaatcttg catttttttt tttaaattta aaaatttttt tttaaacaaa 2340

atatcggtcc gaaactgaaa ccagtcaaaa ccggaaccga aaccaagaca tggccagttc 2400

gagttccggt tccaccattc tgtggaaccg taaccaccgt tcacagaacc ggcacacgtc 2460

taccttactt tacacctact tgaagattac ctctctttct ttctcacttt tctcttttta 2520

tttggttgta tgttgatata tgatcaccaa aaagattttt ttttaaaaaa aaaacaaaaa 2580

gcccaccatc cactcctctc ttacctgtct caccaactca catctagaag caaaatttct 2640

ctctctctct acacgcaaaa aaaaccctat ataatcccat tcagatccaa aagacgggct 2700

tagctagcct tcttattact tactcacaag aagaaaaaaa cccataaacc caaaaaaaac 2760

atgagctaac tcctaattcc aaaggaccaa ctactcgtct tcctcctctg catcaatttt 2820

ccttgagtaa tttgaatttg ggaataggaa aagagaccca attgagattg gtaagtttcg 2880

agaa 2884

<210>2

<211>2259

<212>DNA

<213> Polygonum cuspidatum (Polygonum cuspidatum Sieb. et Zucc.)

<400>2

gagtctcata ccgtccaaaa tatttgtaac attatacgta ctattctaga agagtatata 60

atccttcata gagtttttct atttaatttg atattgcggc taataacacc gcttctatta 120

gtgatttgat tcaagtttgt gaaccgactt ttagaaacaa attttttcat gtatgatgtg 180

tttgccatgt tttaaactta tgtgttcaag atggtttaag ggttttgtcc gaattacttc 240

aacctattaa atatgttatt agatatattt ggttaaaatc aaagactaca aaagaatgga 300

agaattttta taaggaccgt agctttaaac caagacgttt ttcaaaagac gtcggtcatc 360

gttggagctc tacttataaa ttacttcatc aataattagt ttacaaagat tttttgtctt 420

cttttttcgc tcaacatgtt ccgaactcgt caacgattag acccgtttgg gaccaatatt 480

acgacattat tgtaatttta aaagttttca attatgcaac ttatactttt agtcatgttt 540

atgcaccatc ttctcatatg tttactttta aagctttgaa attggcgggt gcctttagta 600

aagggcttaa taaccccgaa ttttatgagg ctattgtagt tatgaagagg aagtggttaa 660

actattataa agttattttc gatatttatc ttgttgcttg cgttttttat cctagatgta 720

aaattgaagg tttgcaaaaa tcattagata cataccatga gttattgcaa ttagaattta 780

atgatcaaga ttataatgtt acacaaattt tgcttcgtat tagaactctt attgatgatt 840

tgtataaggc ttatcattct agcacgggtg gtgatgatgc gcattcttcg cctcaattac 900

ctccatcctc cttgtcccgt agatcgttta taggaacggg ttctcgtcta ttacaaaatc 960

ttactaaaag accaaggcat tcgagctcac atacggagtt caatacttat ctaacaacta 1020

cttttgagtt tgtagttgta gatgaccatt ttgatgtttt agattggtgg ttgaaacaca 1080

agaagacgtt cctaacatta gcaaagatcg tcactcaact tctcgtcgtt cccgcctcaa 1140

cggtagaggt ggagcaaact ttcagctaag gtgggcacat ccttgacgag aagagatcaa 1200

gattggcgcc cgaagcattg aaagctcaag tttgcgtcaa cgattggaag agggtgaaac 1260

ttagacaaca aacatttaac tatacggatt catcgtatga tctacttggc gacgacacat 1320

gtggtactcc cagtccttcc ggtggttcca aaggttcgtc ttaagtaagt ggggtttcgg 1380

aaaggtaaga gaactatgtg ggctttgatt cctctaaaac cccgagagga tacgtaggta 1440

acttaatatt aagttcaagc cctttaatac tcttcttttt tttaaaagag tatacattaa 1500

ctatattagt taggctaatc tagaacttta agctattatc atggtcaaat tgtggttgta 1560

attttgttgt tcacgttatt tgatttagtt aaactcttgt aatcgaaatt atttcttatt 1620

gtatccaaaa atgtctcgta actcccgttc gaataattat aaaatattaa tcttgcattt 1680

ttttttttaa atttaaaaat ttttttttaa acaaaatatc ggtccgaaac tgaaaccagt 1740

caaaaccgga accgaaacca agacatggcc agttcgagtt ccggttccac cattctgtgg 1800

aaccgtaacc accgttcaca gaaccggcac acgtctacct tactttacac ctacttgaag 1860

attacctctc tttctttctc acttttctct ttttatttgg ttgtatgttg atatatgatc 1920

accaaaaaga ttttttttta aaaaaaaaac aaaaagccca ccatccactc ctctcttacc 1980

tgtctcacca actcacatct agaagcaaaa tttctctctc tctctacacg caaaaaaaac 2040

cctatataat cccattcaga tccaaaagac gggcttagct agccttctta ttacttactc 2100

acaagaagaa aaaaacccat aaacccaaaa aaaacatgag ctaactccta attccaaagg 2160

accaactact cgtcttcctc ctctgcatca attttccttg agtaatttga atttgggaat 2220

aggaaaagag acccaattga gattggtaag tttcgagaa 2259

<210>3

<211>1807

<212>DNA

<213> Polygonum cuspidatum (Polygonum cuspidatum Sieb. et Zucc.)

<400>3

acgattagac ccgtttggga ccaatattacgacattattg taattttaaa agttttcaat 60

tatgcaactt atacttttag tcatgtttat gcaccatctt ctcatatgtt tacttttaaa 120

gctttgaaat tggcgggtgc ctttagtaaa gggcttaata accccgaatt ttatgaggct 180

attgtagtta tgaagaggaa gtggttaaac tattataaag ttattttcga tatttatctt 240

gttgcttgcg ttttttatcc tagatgtaaa attgaaggtt tgcaaaaatc attagataca 300

taccatgagt tattgcaatt agaatttaat gatcaagatt ataatgttac acaaattttg 360

cttcgtatta gaactcttat tgatgatttg tataaggctt atcattctag cacgggtggt 420

gatgatgcgc attcttcgcc tcaattacct ccatcctcct tgtcccgtag atcgtttata 480

ggaacgggtt ctcgtctatt acaaaatctt actaaaagac caaggcattc gagctcacat 540

acggagttca atacttatct aacaactact tttgagtttg tagttgtaga tgaccatttt 600

gatgttttag attggtggtt gaaacacaag aagacgttcc taacattagc aaagatcgtc 660

actcaacttc tcgtcgttcc cgcctcaacg gtagaggtgg agcaaacttt cagctaaggt 720

gggcacatcc ttgacgagaa gagatcaaga ttggcgcccg aagcattgaa agctcaagtt 780

tgcgtcaacg attggaagag ggtgaaactt agacaacaaa catttaacta tacggattca 840

tcgtatgatc tacttggcga cgacacatgt ggtactccca gtccttccgg tggttccaaa 900

ggttcgtctt aagtaagtgg ggtttcggaa aggtaagaga actatgtggg ctttgattcc 960

tctaaaaccc cgagaggata cgtaggtaac ttaatattaa gttcaagccc tttaatactc 1020

ttcttttttt taaaagagta tacattaact atattagtta ggctaatcta gaactttaag 1080

ctattatcat ggtcaaattg tggttgtaat tttgttgttc acgttatttg atttagttaa 1140

actcttgtaa tcgaaattat ttcttattgt atccaaaaat gtctcgtaac tcccgttcga 1200

ataattataa aatattaatc ttgcattttt ttttttaaat ttaaaaattt ttttttaaac 1260

aaaatatcgg tccgaaactg aaaccagtca aaaccggaac cgaaaccaag acatggccag 1320

ttcgagttcc ggttccacca ttctgtggaa ccgtaaccac cgttcacaga accggcacac 1380

gtctacctta ctttacacct acttgaagat tacctctctt tctttctcac ttttctcttt 1440

ttatttggtt gtatgttgat atatgatcac caaaaagatt tttttttaaa aaaaaaacaa 1500

aaagcccacc atccactcct ctcttacctg tctcaccaac tcacatctag aagcaaaatt 1560

tctctctctc tctacacgca aaaaaaaccc tatataatcc cattcagatc caaaagacgg 1620

gcttagctag ccttcttatt acttactcac aagaagaaaa aaacccataa acccaaaaaa 1680

aacatgagct aactcctaat tccaaaggac caactactcg tcttcctcct ctgcatcaat 1740

tttccttgag taatttgaat ttgggaatag gaaaagagac ccaattgaga ttggtaagtt 1800

tcgagaa 1807

<210>4

<211>1361

<212>DNA

<213> Polygonum cuspidatum (Polygonum cuspidatum Sieb. et Zucc.)

<400>4

acctccatcc tccttgtccc gtagatcgtt tataggaacg ggttctcgtc tattacaaaa 60

tcttactaaa agaccaaggc attcgagctc acatacggag ttcaatactt atctaacaac 120

tacttttgag tttgtagttg tagatgacca ttttgatgtt ttagattggt ggttgaaaca 180

caagaagacg ttcctaacat tagcaaagat cgtcactcaa cttctcgtcg ttcccgcctc 240

aacggtagag gtggagcaaa ctttcagcta aggtgggcac atccttgacg agaagagatc 300

aagattggcg cccgaagcat tgaaagctca agtttgcgtc aacgattgga agagggtgaa 360

acttagacaa caaacattta actatacgga ttcatcgtat gatctacttg gcgacgacac 420

atgtggtact cccagtcctt ccggtggttc caaaggttcg tcttaagtaa gtggggtttc 480

ggaaaggtaa gagaactatg tgggctttga ttcctctaaa accccgagag gatacgtagg 540

taacttaata ttaagttcaa gccctttaat actcttcttt tttttaaaag agtatacatt 600

aactatatta gttaggctaa tctagaactt taagctatta tcatggtcaa attgtggttg 660

taattttgtt gttcacgtta tttgatttag ttaaactctt gtaatcgaaa ttatttctta 720

ttgtatccaa aaatgtctcg taactcccgt tcgaataatt ataaaatatt aatcttgcat 780

tttttttttt aaatttaaaa attttttttt aaacaaaata tcggtccgaa actgaaacca 840

gtcaaaaccg gaaccgaaac caagacatgg ccagttcgag ttccggttcc accattctgt 900

ggaaccgtaa ccaccgttca cagaaccggc acacgtctac cttactttac acctacttga 960

agattacctc tctttctttc tcacttttct ctttttattt ggttgtatgt tgatatatga 1020

tcaccaaaaa gatttttttt taaaaaaaaa acaaaaagcc caccatccac tcctctctta 1080

cctgtctcac caactcacat ctagaagcaa aatttctctc tctctctaca cgcaaaaaaa 1140

accctatata atcccattca gatccaaaag acgggcttag ctagccttct tattacttac 1200

tcacaagaag aaaaaaaccc ataaacccaa aaaaaacatg agctaactcc taattccaaa 1260

ggaccaacta ctcgtcttcc tcctctgcat caattttcct tgagtaattt gaatttggga1320

ataggaaaag agacccaatt gagattggta agtttcgaga a 1361

<210>5

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

aaatttccac gcttgagatc agggc 25

<210>6

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

acgatggact ccagtccggc ccccacatcg aagaagtcca gcagct 46

<210>7

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

gctttctcac aacatggaga cctaccc 27

<210>8

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

aaaactgcag gatggactcc agagcggcc 29

<210>9

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

aaaactgcag gagtctcata ccgtccaa 28

<210>10

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

aaaactgcag acgattagac ccgtttgg 28

<210>11

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

aaaactgcag tacctccatc ctccttgt 28

<210>12

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

cgcggatcct tctcgaaact taccaatc 28

Claims (8)

1. The promoter is characterized in that the sequence of the promoter is shown as a sequence table SEQ NO. 1.

2. The 5' end deletion fragment of the promoter, according to claim 1, is P2, P3 and P4, wherein the sequence of P2 is shown as SEQ ID NO.2 of the sequence Listing, the sequence of P3 is shown as SEQ ID NO.3 of the sequence Listing, and the sequence of P4 is shown as SEQ ID NO.4 of the sequence Listing.

3. Use of the promoter of claim 1 or the 5' deleted fragment of the promoter of claim 2 for activating and inducing expression of the PcMYB1 gene and the GUS gene of Polygonum cuspidatum.

4. A vector comprising the promoter of claim 1 or the 5' deleted fragment of the promoter of claim 2.

5. A genetically engineered bacterium comprising the vector of claim 4.

6. The method for amplifying the promoter according to claim 1, wherein the method for amplifying the promoter is a hital-PCR method, and comprises the following specific steps:

s1, performing first round of PCR amplification by adopting PCR buffer solution, dNTP, giant knotweed genomic DNA, DNA polymerase and primers LAD1-1, LAD1-2, LAD1-3, LAD1-4 and SP0-1, wherein the sequence of the primer SP0-1 is shown as a sequence table SEQ NO. 5;

s2, diluting the product obtained in the step S1 to be used as a template, and performing second round PCR amplification by adopting PCR buffer solution, dNTP, DNA polymerase and primers AC1 and SP1-1, wherein the sequence of the primer SP1-1 is shown as a sequence table SEQ NO. 6;

s3, diluting the product obtained in the step S2 to be used as a template, and performing third PCR amplification by adopting PCR buffer solution, dNTP, DNA polymerase and primers AC1 and SP2-1, wherein the sequence of the primer SP2-1 is shown as a sequence table SEQ NO. 7;

s4, recovering the product obtained in the step S3, connecting the product to a vector, converting the vector into a competent cell, and picking a recombinant for sequencing to obtain the sequence of the promoter.

7. The primer for amplifying the promoter of claim 1 or the 5' end deletion fragment of the promoter of claim 2, wherein the upstream primer for amplifying the promoter is shown as SEQ NO.8 of the sequence table, the upstream primer for amplifying P2 is shown as SEQ NO.9 of the sequence table, the upstream primer for amplifying P3 is shown as SEQ NO.10 of the sequence table, the upstream primer for amplifying P4 is shown as SEQ NO.11 of the sequence table, the downstream primers for amplifying PcMYB1 gene promoter, P2, P3 and P4 are the same as the sequence table, and the sequence of the downstream primer is shown as SEQ NO. 12.

8. A method of inducing expression of a gene of interest, the method comprising:

s1, transforming the vector of claim 4 into Agrobacterium;

s2, infecting giant knotweed tissue cells with the agrobacterium obtained in the step S1;

s3, culturing the infected giant knotweed tissue cells in the step S2 to express the target gene in the giant knotweed tissue cells.

Images