CN111763747B - Universal single primer, kit and identification method suitable for identifying common giant clam species in south sea area - Google Patents
Universal single primer, kit and identification method suitable for identifying common giant clam species in south sea area Download PDFInfo
- Publication number
- CN111763747B CN111763747B CN202010675134.9A CN202010675134A CN111763747B CN 111763747 B CN111763747 B CN 111763747B CN 202010675134 A CN202010675134 A CN 202010675134A CN 111763747 B CN111763747 B CN 111763747B
- Authority
- CN
- China
- Prior art keywords
- tridacna
- sample
- detected
- primer
- species
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 238000000034 method Methods 0.000 title claims abstract description 20
- 241000512272 Tridacna Species 0.000 claims abstract description 94
- 238000003752 polymerase chain reaction Methods 0.000 claims abstract description 12
- 241000512273 Tridacnidae Species 0.000 claims abstract description 10
- 238000000137 annealing Methods 0.000 claims abstract description 5
- 238000006243 chemical reaction Methods 0.000 claims description 8
- 238000012408 PCR amplification Methods 0.000 claims description 7
- 238000000246 agarose gel electrophoresis Methods 0.000 claims description 5
- 230000003321 amplification Effects 0.000 claims description 5
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 5
- 238000011144 upstream manufacturing Methods 0.000 claims description 4
- 238000004925 denaturation Methods 0.000 claims description 3
- 230000036425 denaturation Effects 0.000 claims description 3
- 238000012257 pre-denaturation Methods 0.000 claims description 3
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 3
- 108010006785 Taq Polymerase Proteins 0.000 claims description 2
- 239000003153 chemical reaction reagent Substances 0.000 claims description 2
- 239000008223 sterile water Substances 0.000 claims description 2
- 241000894007 species Species 0.000 abstract description 11
- 238000007403 mPCR Methods 0.000 abstract description 7
- 229910019142 PO4 Inorganic materials 0.000 abstract description 3
- NBIIXXVUZAFLBC-UHFFFAOYSA-K phosphate Chemical compound [O-]P([O-])([O-])=O NBIIXXVUZAFLBC-UHFFFAOYSA-K 0.000 abstract description 3
- 239000010452 phosphate Substances 0.000 abstract description 3
- 230000002860 competitive effect Effects 0.000 abstract description 2
- 235000020639 clam Nutrition 0.000 description 24
- 239000013641 positive control Substances 0.000 description 24
- 108020004414 DNA Proteins 0.000 description 16
- 241000237519 Bivalvia Species 0.000 description 14
- 238000001962 electrophoresis Methods 0.000 description 7
- 239000002773 nucleotide Substances 0.000 description 6
- 125000003729 nucleotide group Chemical group 0.000 description 6
- 239000000047 product Substances 0.000 description 5
- 230000018109 developmental process Effects 0.000 description 4
- 239000000203 mixture Substances 0.000 description 4
- 241001600160 Tridacna derasa Species 0.000 description 3
- 241001600159 Tridacna maxima Species 0.000 description 3
- 241000637221 Tridacna noae Species 0.000 description 3
- 241001600158 Tridacna squamosa Species 0.000 description 3
- 239000003550 marker Substances 0.000 description 3
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 2
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 2
- 241001600175 Hippopus Species 0.000 description 2
- 241001600174 Hippopus hippopus Species 0.000 description 2
- 238000004458 analytical method Methods 0.000 description 2
- PHTQWCKDNZKARW-UHFFFAOYSA-N isoamylol Chemical compound CC(C)CCO PHTQWCKDNZKARW-UHFFFAOYSA-N 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 235000015170 shellfish Nutrition 0.000 description 2
- 239000006228 supernatant Substances 0.000 description 2
- 108020004465 16S ribosomal RNA Proteins 0.000 description 1
- 235000014653 Carica parviflora Nutrition 0.000 description 1
- 241000243321 Cnidaria Species 0.000 description 1
- 108010067770 Endopeptidase K Proteins 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 108020005196 Mitochondrial DNA Proteins 0.000 description 1
- 241000237852 Mollusca Species 0.000 description 1
- 238000009004 PCR Kit Methods 0.000 description 1
- OAICVXFJPJFONN-UHFFFAOYSA-N Phosphorus Chemical compound [P] OAICVXFJPJFONN-UHFFFAOYSA-N 0.000 description 1
- 241000237542 Veneroida Species 0.000 description 1
- 239000011543 agarose gel Substances 0.000 description 1
- 230000009089 cytolysis Effects 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 239000003085 diluting agent Substances 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 235000013305 food Nutrition 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- 239000000499 gel Substances 0.000 description 1
- 238000003384 imaging method Methods 0.000 description 1
- 230000000366 juvenile effect Effects 0.000 description 1
- TWRXJAOTZQYOKJ-UHFFFAOYSA-L magnesium chloride Substances [Mg+2].[Cl-].[Cl-] TWRXJAOTZQYOKJ-UHFFFAOYSA-L 0.000 description 1
- 229910001629 magnesium chloride Inorganic materials 0.000 description 1
- 230000029052 metamorphosis Effects 0.000 description 1
- 230000000877 morphologic effect Effects 0.000 description 1
- 235000016709 nutrition Nutrition 0.000 description 1
- 230000035764 nutrition Effects 0.000 description 1
- 230000000050 nutritive effect Effects 0.000 description 1
- 150000002989 phenols Chemical class 0.000 description 1
- 229910052698 phosphorus Inorganic materials 0.000 description 1
- 239000011574 phosphorus Substances 0.000 description 1
- 230000029553 photosynthesis Effects 0.000 description 1
- 238000010672 photosynthesis Methods 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 230000005855 radiation Effects 0.000 description 1
- 150000003839 salts Chemical class 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 229910021642 ultra pure water Inorganic materials 0.000 description 1
- 239000012498 ultrapure water Substances 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a universal single primer, a kit and an identification method suitable for identifying common giant clam species in the south sea area. The invention establishes a method for detecting and identifying 5 common tridacnidae species (non-phosphate tridacna, giant clam, nova tridacna and trioyster) in the south sea area of China by utilizing a universal single-primer multiplex PCR (polymerase chain reaction) with multiple downstream primers for competitive annealing, and has the advantages of simple method, intuitive result, accuracy, effectiveness, no influence of environment and development period, low cost and the like through actual sample test.
Description
The technical field is as follows:
the invention belongs to the technical field of molecular identification in aquatic organisms, and particularly relates to a PCR kit for rapidly identifying common giant clam species in the south sea area of China by using a universal single-primer multiplex PCR technology and an identification method thereof.
Background art:
tridacna belongs to the phylum Mollusca (molussca), the class Lamellibranchia (Lamellibranchia), the order venerida (Veneroida) and the family tridacna (Tridacnidae), is a tropical large marine coral reef benthic shellfish and is also the largest bivalve shellfish in the ocean. The giant clams and other bivalve shells are mainly different in that a symbiotic relationship is established between giant clams and zooxanthellae in the stage of development and metamorphosis to the juvenile stage, most of nutrition required by growth of giant clams comes from photosynthesis of zooxanthellae, and the characteristics enable giant clams to directly utilize inorganic nutritive salts in tropical sea areas, so that giant clams have high ecological value. In addition, tridacna also belongs to high-economic-value species, is a material basis of tropical marine organisms and fishery economy, and provides resources such as aquarium appreciation, technical materials and aquatic food.
Characteristics such as the number and distribution of radiation ribs and the scales on shells and patterns of mantles are mainly compared among adults of different tridacna to identify, but the shells have strong plasticity, and have intermediate forms and intermediate habitats in the development process, so that different species of tridacna are difficult to distinguish. In addition, in the development stage of tridacna larvae, morphological characteristics are very similar and are more difficult to distinguish. At present, molecular biology mainly based on COI and 16S rDNA mitochondrial gene sequence differences is used for identifying giant clam species, but the gene sequences have small differences and are difficult to distinguish by simple methods such as electrophoresis. A simple and efficient method for carrying out large-scale species identification on common giant clam species in the south sea area of China is urgently needed.
In the general single primer multiplex polymerase chain reaction (CSP-M-PCR), a general primer and a plurality of specific primers are added into a PCR system, only the sequence matched with the specific primers can be amplified, and the species can be identified by agarose gel electrophoresis separation and then comparison with the size of a standard fragment. The universal single primer multiplex PCR has the characteristics of high efficiency, rapidness, saving and very reliable identification result, and is widely applied to species identification.
The invention content is as follows:
the invention aims to provide a universal single primer, a multiplex PCR kit and a method thereof, which are suitable for identifying common tridacnidae species tridacna, giant clam, tridacna triva and trioyster in south sea areas. According to the method, 40 individuals of non-phosphate giant clams, tridacna, giant clams, nova tridacna and trioyster are analyzed, and the identification effect is remarkable.
The invention discloses a universal single primer suitable for identifying common tridacnidae species, namely phosphorus-free tridacna, tridacna, giant clam, nova tridacna and trioyster in south sea areas, which comprises the following specific steps:
an upstream primer F1: ATTGTAGAGCATCATTCAGG, the nucleotide sequence of which is shown as SEQ ID NO. 1;
a downstream primer R1: TCCAACTGTAAATAAACCAAC, the nucleotide sequence of which is shown as SEQ ID NO. 2;
a downstream primer R2: TAATGGAAATGGGCTACTACG, the nucleotide sequence of which is shown as SEQ ID NO. 3;
a downstream primer R3: TAAGTGGCCCCTCAACTGAAG, the nucleotide sequence of which is shown as SEQ ID NO. 4;
a downstream primer R4: CGTGGCATGCCTGACAGA, the nucleotide sequence of which is shown as SEQ ID NO. 5;
the nucleotide sequence of the downstream primer R5: TATCTACGTCTAACCCTACC is shown as SEQ ID NO. 6.
The second purpose of the invention is to provide a kit for rapidly identifying common tridacnidae species tridacna, tridacna, nova tridacna and trioyster in the south sea area, which comprises the universal single primer and a PCR reaction reagent.
The third purpose of the invention is to provide an identification method for rapidly identifying common tridacnidae species tridacna, tridacna, nova tridacna and trioyster in the south sea area, which comprises the following steps:
extracting genome DNA of a sample to be detected, carrying out PCR amplification by using the universal single primer to obtain an amplification product, carrying out agarose gel electrophoresis on the amplification product, amplifying a 144bp strip of the sample to be detected, and judging the sample to be detected as trioyster; amplifying a 212bp strip of the sample to be detected, and judging the sample to be detected to be tridacna; amplifying a 285bp strip of the sample to be detected, and judging the sample to be detected as tridacna without scales; amplifying a 367bp strip of the sample to be detected, and judging tridacna; and amplifying 545bp bands of the sample to be detected, and judging the sample to be tridacna.
Preferably, the total volume of the PCR reaction system is 25. mu.L, and the PCR reaction system comprises dNTP mix 4. mu.l, 10 × buffer 2.5. mu.l and MgCl 21 ul, forward primer F12 ul, reverse primers R1-R2 and R4-R50.5. mu.l, downstream primer R31. mu.l, template DNA 3.8. mu.l, Taq enzyme 0.5. mu.l, ddH2O8.2. mu.l. The final concentration of each component is as follows: 50ng of DNA template, 10mM of Buffer, 0.05mM of each of upstream primer F10.2 mM, downstream primers R1-R2 and R4-R5, 30.1mM of each of downstream primers, 0.2mM of dNTP, and Mg2+2.0mM, 1U Taq DNA polymerase, made up to 25. mu.L with sterile water.
The PCR reaction program is as follows:
the three steps of pre-denaturation at 94 ℃ for 2min, denaturation at 94 ℃ for 20s, annealing at 56 ℃ for 30s, and extension at 68 ℃ for 45s are repeated for 30 times, and extension at 68 ℃ for 7 min.
The PCR amplification product was typed by electrophoresis on a 2% agarose gel.
Comparing the analysis results of the sample to be detected and the positive control, amplifying a 144bp strip of the sample to be detected and the positive control at the same time, and judging to be trioyster; amplifying a 212bp strip of the sample to be detected and the positive control at the same time, and judging the sample to be tridacna; amplifying a 285bp strip of the sample to be detected and the positive control at the same time, and judging the sample to be tridacna without scale; amplifying a 367bp strip of the sample to be detected and the positive control at the same time, and judging tridacna; and amplifying the 545bp strip of the sample to be detected and the positive control at the same time, and judging the sample as tridacna nova.
The invention establishes a method for detecting and identifying 5 common tridacnidae species (non-phosphate tridacna, giant clam, nova tridacna and trioyster) in the south sea area of China by utilizing a universal single-primer multiplex PCR (polymerase chain reaction) with multiple downstream primers for competitive annealing, and has the advantages of simple method, intuitive result, accuracy, effectiveness, no influence of environment and development period, low cost and the like through actual sample test.
Drawings
FIG. 1 is an electrophoresis diagram of universal single-primer multiplex PCR amplification products of a positive control of a standard substance and a tridacna sample, wherein: 1. trioyster positive control (Hippopus); 2. tridacna positive control (Tridacna maxima); 3. tridacna-free positive control (Tridacna derasa); 4. tridacna positive control (Tridacna squamosa); 5. triva giant clam positive control (Tridacna noae); 6. mixed samples of tridacna and tridacna; 7. mixed samples of trioys and tridacna without scales; 8. mixed samples of trioys and tridacna; 9. mixed samples of trioyster and Nora tridacna; 10. mixed samples of tridacna and nova tridacna; 11. mixed samples of tridacna grown and tridacna without scales; 12. mixed samples of tridacna without scales and tridacna with scales; 13. mixed samples of tridacna and tridacna; 14. mixed samples of tridacna without scales and tridacna nova; 15. mixed samples of tridacna and nova tridacna; m, 100bp Marker.
Detailed Description
The following examples are further illustrative of the present invention and are not intended to be limiting thereof.
Example 1:
referring to fig. 1, a small amount of tissue is cut from phosphate-free giant clams, tridacna, giant clams, nova giant clams and trioyster mantle by using sterilized tweezers and small scissors respectively. Mu.l of lysis solution and 10. mu.l of proteinase K (10mg/ml) were added to the centrifuge tube containing the mantle tissue, mixed well on a shaker, and digested in a water bath at 55 ℃ until the tissue was completely dissolved to obtain the first solution. Adding a mixture of saturated phenol (200 μ l) and chloroform/isoamyl alcohol (24:1) (200 μ l) in equal volume, extracting three times, centrifuging at 10000rpm for 10-15min each time, and sucking the supernatant with a pipette. 1mL of precooled absolute ethanol was added to the centrifuge tube containing the supernatant and precipitated overnight. Finally, the mixture is washed by 70 percent alcohol, dried at room temperature and dissolved in 200 mu L of ultrapure water. DNA concentration and purity were determined by UV spectrophotometer and DNA integrity was checked by 1% agarose gel electrophoresis. Therefore, the genome DNA of non-phosphorus giant clams, tridacna, giant tridacna, nova tridacna and trioyster is obtained. And extracting parts from five kinds of tridacna DNA diluent, mixing the extracted parts in pairs, and using the mixture as a template to perform species identification.
Five kinds of tridacna genome DNA and mixed templates of the genomes of the tridacna genome DNA and the tridacna genome DNA are used for carrying out PCR amplification reaction. The total volume of the PCR reaction system was 25. mu.L, wherein the contents of the respective components in the PCR system are shown in the following table.
Wherein the primer sequence is as follows:
upstream primer F1: ATTGTAGAGCATCATTCAGG
Downstream primer R1 (for T. derasa): TCCAACTGTAAATAAACCAAC
Downstream primer R2 (for T. squamosa): TAATGGAAATGGGCTACTACG
Downstream primer R3 (for T. maxima): TAAGTGGCCCCTCAACTGAAG
Downstream primer R4 (for T. noae): CGTGGCATGCCTGACAGA
Downstream primer R5 (for H. hippopus) TATCTACGTCTAACCCTACC
The reaction procedure is as follows: the three steps of pre-denaturation at 94 ℃ for 2min, denaturation at 94 ℃ for 20s, annealing at 56 ℃ for 30s, and extension at 68 ℃ for 45s are repeated for 30 times, and extension at 68 ℃ for 7 min. The PCR amplification product is placed in 2% agarose gel electrophoresis for typing, and 100bp Marker is used as a standard molecular reference. Electrophoresis was performed at 150v for 10 minutes and then at 100v for 20 minutes. The electrophoresis results were analyzed with a UV gel imaging system. Comparing the electrophoresis result with the positive control, as shown in fig. 1, the electrophoresis detection result shows that: 1. hippopus positive control (h.hippopus); 2. tridacna positive control (t.maxima); 3. tridacna-free positive control (t.derasa); 4. tridacna positive control (t. squamosa); 5. norva tridacna positive control (t.noae); 6. tridacna samples and tridacna samples; 7. tridacna samples and tridacna samples without scales; 8. tridacna samples and tridacna samples; 9. tridacna samples and tridacna samples; 10. giant clams and nova giant clam samples; 11. giant clams and scale-free giant clam samples; 12. tridacna without scales and tridacna samples; 13. giant clams and tridacna samples; 14. tridacna without scales and tridacna nova samples; 15. tridacna and nova tridacna samples; m, 100bp Marker.
Comparing the analysis results of the sample to be detected and the positive control, amplifying bands of about 144bp simultaneously between the sample to be detected and the positive control, and judging to be trioyster; amplifying a strip of about 212bp simultaneously from the sample to be detected and the positive control, and judging the sample to be tridacna; amplifying a band of about 285bp simultaneously from the sample to be detected and the positive control, and judging the sample to be tridacna absent; amplifying a band of about 367bp simultaneously from the sample to be detected and the positive control, and judging tridacna; and amplifying the sample to be detected and the positive control at the same time to obtain a strip of about 545bp, and judging the giant tridacna as nova.
Sequence listing
<110> Nanhai ocean institute of Chinese academy of sciences
<120> general single primer, kit and identification method suitable for identifying common tridacna species in south sea area
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
attgtagagc atcattcagg 20
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tccaactgta aataaaccaa c 21
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
taatggaaat gggctactac g 21
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
taagtggccc ctcaactgaa g 21
<210> 5
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cgtggcatgc ctgacaga 18
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tatctacgtc taaccctacc 20
Claims (5)
1. A primer group suitable for identifying common tridacnidae species of tridacna, tridacna, giant clam, nova tridacna and trioyster in south China is characterized by comprising the following specific components:
an upstream primer F1: ATTGTAGAGCATCATTCAGG;
a downstream primer R1: TCCAACTGTAAATAAACCAAC;
a downstream primer R2: TAATGGAAATGGGCTACTACG;
a downstream primer R3: TAAGTGGCCCCTCAACTGAAG;
a downstream primer R4: CGTGGCATGCCTGACAGA;
the downstream primer R5: TATCTACGTCTAACCCTACC.
2. A kit for rapidly identifying common tridacnidae species, namely phosphorus-free tridacna, giant clam, nova tridacna and trioyster in south China sea areas is characterized by comprising the primer group and a PCR (polymerase chain reaction) reagent in claim 1.
3. An identification method for rapidly identifying common tridacnidae species, namely phosphorus-free tridacna, giant clam, nova tridacna and trioyster in south China sea areas is characterized by comprising the following steps:
extracting genome DNA of a tridacna sample to be detected, carrying out PCR amplification by using the primer group in claim 1 to obtain an amplification product, carrying out agarose gel electrophoresis on the amplification product, amplifying a 144bp strip of the sample to be detected, and judging the sample to be trioyster; amplifying a 212bp strip of the sample to be detected, and judging the sample to be detected to be tridacna; amplifying a 285bp strip of the sample to be detected, and judging the sample to be detected as tridacna without scales; amplifying a 367bp strip of the sample to be detected, and judging tridacna; and amplifying 545bp bands of the sample to be detected, and judging the sample to be tridacna.
4. The method of claim 3, wherein the PCR amplification reaction system comprises a total volume of 25. mu.L, 50ng of DNA template, 10mM of Buffer, 10.2 mM of forward primer F10, 0.05mM of each of the downstream primers R1-R2, R4-R5, 30.1mM of the downstream primer R30, 0.2mM of dNTP, Mg2+ 2.0mM, 1U Taq DNA polymerase, made up to 25. mu.L with sterile water.
5. The identification method according to claim 3, wherein the PCR amplification comprises the following PCR reaction procedures: the three steps of pre-denaturation at 94 ℃ for 2min, denaturation at 94 ℃ for 20s, annealing at 56 ℃ for 30s, and extension at 68 ℃ for 45s are repeated for 30 times, and extension at 68 ℃ for 7 min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010675134.9A CN111763747B (en) | 2020-07-14 | 2020-07-14 | Universal single primer, kit and identification method suitable for identifying common giant clam species in south sea area |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010675134.9A CN111763747B (en) | 2020-07-14 | 2020-07-14 | Universal single primer, kit and identification method suitable for identifying common giant clam species in south sea area |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111763747A CN111763747A (en) | 2020-10-13 |
| CN111763747B true CN111763747B (en) | 2022-04-29 |
Family
ID=72725355
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010675134.9A Active CN111763747B (en) | 2020-07-14 | 2020-07-14 | Universal single primer, kit and identification method suitable for identifying common giant clam species in south sea area |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111763747B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106399548A (en) * | 2016-10-28 | 2017-02-15 | 海南大学 | Tridacna mitochondrion 16S gene amplification primer and application thereof |
| EP3315612A1 (en) * | 2015-06-24 | 2018-05-02 | Universidad De Chile | Set of primers and method for detecting and identifying mussel species of the genusmytilus |
| CN108103211A (en) * | 2018-01-31 | 2018-06-01 | 中国科学院南海海洋研究所 | A kind of identification Tridacna (chamestrachea) maxima (R ding), the micro-satellite primers and identification method of Nova giant clam |
| CN108950017A (en) * | 2018-08-08 | 2018-12-07 | 中国科学院南海海洋研究所 | A kind of southern china sea area Tridacnidae species mitochondria 16S rRNA gene universal amplification primer and its screening technique |
| CN110760595A (en) * | 2019-11-06 | 2020-02-07 | 中国科学院南海海洋研究所 | Identification primer and method suitable for tridacna species common in trioyster and south China sea and hybridized species of tridacna species |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB0410052D0 (en) * | 2004-05-05 | 2004-06-09 | Bioelf Ltd | Metabolic test |
| CN106978490B (en) * | 2017-04-07 | 2020-12-22 | 中国海洋大学 | DNA barcode standard detection method for identifying tridacna and application thereof |
| CN110499371B (en) * | 2019-07-30 | 2022-09-02 | 河南科技学院 | Microsatellite primer, kit and identification method for identifying epinephelus coioides, malaba epinephelus malabaricus and first filial generation thereof |
-
2020
- 2020-07-14 CN CN202010675134.9A patent/CN111763747B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3315612A1 (en) * | 2015-06-24 | 2018-05-02 | Universidad De Chile | Set of primers and method for detecting and identifying mussel species of the genusmytilus |
| CN106399548A (en) * | 2016-10-28 | 2017-02-15 | 海南大学 | Tridacna mitochondrion 16S gene amplification primer and application thereof |
| CN108103211A (en) * | 2018-01-31 | 2018-06-01 | 中国科学院南海海洋研究所 | A kind of identification Tridacna (chamestrachea) maxima (R ding), the micro-satellite primers and identification method of Nova giant clam |
| CN108950017A (en) * | 2018-08-08 | 2018-12-07 | 中国科学院南海海洋研究所 | A kind of southern china sea area Tridacnidae species mitochondria 16S rRNA gene universal amplification primer and its screening technique |
| CN110760595A (en) * | 2019-11-06 | 2020-02-07 | 中国科学院南海海洋研究所 | Identification primer and method suitable for tridacna species common in trioyster and south China sea and hybridized species of tridacna species |
Non-Patent Citations (3)
| Title |
|---|
| "Multiplex species-specific PCR identification of native giant clams in the South China Sea: A useful tool for application in giant clam stock management and forensic identification";Haitao Ma et al.;《Aquaculture》;20200928;第531卷;第1-5页 * |
| "Sequence Variation in the Ribosomal DNA Internal Transcribed Spacer of Tridacna crocea";Eizadora T.Yu et al.;《Mar. Biotechnol.》;20001231;第2卷;第511-516页 * |
| "基于新开发微卫星标记评价番红砗磲两个野生群体的遗传多样性及近缘种通用性检测";高红梅等;《水产学报》;20200327;第44卷(第2期);第187-194页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111763747A (en) | 2020-10-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108103211B (en) | Microsatellite primer and identification method for tridacna elongata and tridacna nova | |
| CN109055571B (en) | Specific primer of yellow fin spine porgy microsatellite marker and application | |
| US11085075B2 (en) | DNA barcoding primer for identifying cephalopoda and use thereof | |
| CN112048572B (en) | LAMP technology-based shrimp health system visual rapid detection kit | |
| CN108950017B (en) | Universal amplification primer for mitochondria 16S rRNA gene of tridacnidae species in southern China and screening method thereof | |
| CN110106256A (en) | A kind of molecular labeling primer and its application identifying egg-shaped pompano and Bu Shi silvery pomfret Scad | |
| CN110760595B (en) | Identification primer and method suitable for tridacna species common in trioyster and south China sea and hybridized species of tridacna species | |
| CN105624307B (en) | Microsatellite primers and identification method for identifying crassostrea hongkongensis, crassostrea gigas and crassostrea pacificus and hybrid species thereof | |
| CN111254202A (en) | Primer group, kit and detection method for detecting Atlantic salmon | |
| CN111304337A (en) | SRAP molecular marker, kit and method for identifying first filial generation of pelteobagrus fulvidraco, pelteobagrus vachelli and hybride and application | |
| CN111763748B (en) | Universal single primer, kit and identification method for identifying tridacna, tridacna without scales and trioyster | |
| CN108611405B (en) | Microsatellite fluorescent multiplex PCR (polymerase chain reaction) method for parent-child identification of culter alburnus | |
| Dooms et al. | Denaturing gradient gel electrophoresis (DGGE) as a tool for the characterisation of Brachionus sp. strains | |
| CN111763747B (en) | Universal single primer, kit and identification method suitable for identifying common giant clam species in south sea area | |
| CN111534603B (en) | Method for identifying aedes albopictus by using fluorescent RPA | |
| KR20190136647A (en) | Methode for detecting and absolute quantification of Alexandrium spp. using digital PCR | |
| CN102181554B (en) | The female special genomic DNA fragment of Cynoglossus semilaevis and application thereof | |
| JP5566018B2 (en) | Crab detection primer set | |
| Hong et al. | Ultra-fast PCR method for the distinguishing between Miichthys miiuy and Sciaenops ocellatus | |
| CN108220456B (en) | EST-SSR primer and identification method for identifying crassostrea hongkongensis, crassostrea sikamea and first filial generation thereof | |
| CN105603097B (en) | Microsatellite marker primer for identifying pinctada fucata microsatellite families as well as identification method and application | |
| CN113502334B (en) | Molecular marker C27449 for rapidly identifying genetic sex of Penaeus japonicus and application thereof | |
| CN105969907B (en) | Kit for detecting ST251 type pathogenic aeromonas hydrophila and application thereof | |
| CN108070663A (en) | Differentiate the molecular labeling primer and method of the penaeus penicillatus young and During Larvae Rearing of Penaeus Merguiensis De Man | |
| CN110616279B (en) | Kit for synchronously and quantitatively detecting 3 important shrimp pathogens |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20231016 Address after: No.1119 Haibin Road, Nansha District, Guangzhou City, Guangdong Province Patentee after: SOUTH CHINA SEA INSTITUTE OF OCEANOLOGY, CHINESE ACADEMY OF SCIENCES Patentee after: Sanya Marine Ecological Environment Engineering Research Institute Address before: No.1119 Haibin Road, Nansha District, Guangzhou City, Guangdong Province Patentee before: SOUTH CHINA SEA INSTITUTE OF OCEANOLOGY, CHINESE ACADEMY OF SCIENCES |
|
| TR01 | Transfer of patent right |