CN111758496B - Pure culture mycelium of fleshy black spore fungus and application of pure culture mycelium in artificial domestication and cultivation - Google Patents
Pure culture mycelium of fleshy black spore fungus and application of pure culture mycelium in artificial domestication and cultivation Download PDFInfo
- Publication number
- CN111758496B CN111758496B CN202010551792.7A CN202010551792A CN111758496B CN 111758496 B CN111758496 B CN 111758496B CN 202010551792 A CN202010551792 A CN 202010551792A CN 111758496 B CN111758496 B CN 111758496B
- Authority
- CN
- China
- Prior art keywords
- culture
- mycelium
- fungus
- fleshy
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G18/00—Cultivation of mushrooms
- A01G18/40—Cultivation of spawn
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G18/00—Cultivation of mushrooms
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G18/00—Cultivation of mushrooms
- A01G18/20—Culture media, e.g. compost
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Mycology (AREA)
- Environmental Sciences (AREA)
- Mushroom Cultivation (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a pure culture mycelium of fleshy black spore fungus and application thereof in artificial domestication and cultivation. The pure culture mycelium of the fleshy black spore fungus is preserved in the common microorganism center of China Committee for culture Collection of microorganisms with the number as follows: CGMCC No. 18584. The pure culture mycelium of the fleshy black spore polyporus fungus can adopt a corn flour culture medium for plate subculture propagation, can adopt a millet granule culture medium for preparing a culture strain, and can adopt a corncob culture material and clinker bag cultivation mode for obtaining a fruiting body. The invention provides a pure culture mycelium of wild edible and medicinal fungi and an artificial culture method, and the mycelium is of a high-temperature type, is suitable for artificial culture in summer and autumn in high-temperature seasons, provides a new variety for edible fungi industry, and has important significance for protecting the diversity of wild mushroom fungi.
Description
Technical Field
The invention belongs to the field of edible fungus cultivation, and particularly relates to a pure culture mycelium of fleshy black spore fungus and application thereof in artificial domestication cultivation.
Background
The strain of Fomitopsis cinerea (Amylosporus succinutes) belongs to the genus Fomitopsis, which was established in 1973 by Ryvarden, and its model species is Fomitopsis canescens (A. campbellii). Wild fleshy phellinus igniarius is mainly distributed in tropical regions, fruiting bodies are annual, fresh fruiting bodies are fleshy, and dry products are suberin. The fruiting body pileus is round, the edge is thin and wavy, and the surface color is white or light pink; the fungus pleat is porous, the shape of the hole opening is polygonal, the color is light yellow, and the fungus pleat is easy to break. The spores are oval and colorless, and have thick cell walls and rough surfaces. The discovery of the fleshy black spore fungus is late, and the research on the biological characteristics and domestication and cultivation of the fleshy black spore fungus is only rarely reported so far. In 2018, Huangfuchang et al reported another species of the genus Sphaerotheca fuliginosus, i.e., Sphaerotheca striatellus (Amylosporium fuliginosum), studied artificial domestication and cultivation and fruiting body nutrition conditions of the Sphaerotheca striatellus, and considered that the Sphaerotheca striatellus can be developed and utilized as a new edible fungus species. The Histoporus striatus and the Hypocrea fleshy are two independent species of the genus Histoporus in taxonomy. In 2017, in 8 months, when the inventor conducts wild large-scale fungus resource investigation in Yanshan mountain areas in Hebei province, the collected fungus sporophores are separated to obtain pure culture mycelia, and domestication cultivation research is conducted.
Disclosure of Invention
The invention aims to provide a pure culture mycelium of fleshy black spore fungus and application thereof in artificial domestication and cultivation.
The technical scheme adopted for realizing the purpose of the invention is as follows: firstly, obtaining a pure culture mycelium of the fleshy black spore fungus and identifying the authenticity of the pure culture mycelium; after the pure culture mycelium is successfully obtained, if the first step of artificial domestication cultivation is realized, a culture medium which is most suitable for growth is screened to realize strain propagation, and then artificial domestication cultivation is carried out according to the characteristics of the living environment, wherein the specific steps are as follows:
(1) obtaining and identifying pure culture mycelium of fleshy black spore fungus
Taking collected wild fleshy black spore sporocarp as a material, taking tissue blocks with the specification of 2 multiplied by 2mm from the middle part of sporocarp pileus by a tissue separation technology, inoculating the tissue blocks onto a conventional PDA test tube slant culture medium, carrying out dark culture in an incubator at 20-25 ℃, obtaining mycelium which fully grows in the test tube slant culture medium after 10-15 days, and storing the mycelium in a refrigerator at 4 ℃ for later use.
The obtained mycelia were subjected to ITS identification, and the mycelia-derived fruit bodies were also subjected to ITS identification. Respectively preparing mycelium DNA and sporocarp DNA by adopting a fungus DNA extraction kit, then respectively establishing a PCR amplification system containing ITS primers by taking 2 DNAs as templates, sequencing the obtained amplification product, performing BLAST comparison analysis on ITS sequences obtained by sequencing in a database of NCBI (national center for information technology information) to finally determine that the obtained ITS sequences of the mycelium and the sporocarp are the same, and proving that the mycelium is derived from the sporocarp; and the ITS sequence of the obtained mycelium is highly homologous with the ITS sequence of the fleshy black spore fungus in the database, so that the obtained pure cultured mycelium and fruiting body are identified as the fleshy black spore fungus.
The obtained pure cultured mycelium of the fleshy black spore fungus is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, and the preservation unit address is as follows: the institute of microbiology, national academy of sciences No. 3, Xilu No.1, Beijing, Chaoyang, Beijing. The preservation number is: CGMCC No. 18584. The preservation date is 2019, 10 months and 10 days, and the classification is named as: amylosporus succinutentus.
(2) Subculture propagation of mycelia
Selecting a mycelium block with the specification of 2 multiplied by 2mm from a slant culture medium of a succulent black spore mycelium test tube, inoculating the mycelium block on a PDA (personal digital Assistant) plate culture medium, performing 15-20d culture at 20-25 ℃, then punching a hole along the edge of a mycelium colony by using a circular puncher with the diameter of 0.7cm to obtain a mycelium sheet, inoculating the circular mycelium sheet on a corn flour culture medium plate for subculture and propagation, and obtaining a plate propagation strain full of mycelium after 15-20d culture at 20-25 ℃ in a dark culture condition. Realizing the subculture propagation of the mycelium.
(3) Domesticated culture strain preparation
Selecting 3-5 mycelium blocks with the diameter of 1.5-2 cm from the mycelium overgrowth propagation strain plate, inoculating the mycelium blocks into a sterilized millet culture medium, culturing in the dark at the temperature of 28-31 ℃, and obtaining the culture strain overgrowing with mycelium after 30-40 days.
(4) Seeding and spawn running culture
Under aseptic condition, the millet cultivated species are uniformly spread on the surface of a plastic bag filled with sterilized corncob culture material, and the inoculation amount is 10-15% of the weight of the culture material. And (4) after inoculation, tying the fungus bags, performing light-resistant culture in a fungus growing room at the temperature of 20-25 ℃, and obtaining the cultivation fungus bags full of mycelia after 20-25 days.
(5) Fruiting culture
Transferring the cultivation fungus bags into a mushroom shed, opening the bag opening, increasing the relative humidity of air in the mushroom shed to 85-90% through ground watering and space spraying, increasing ventilation and air exchange, increasing scattered light, increasing the day and night temperature difference stimulation, keeping the temperature of the mushroom shed at 25-33 ℃, and seeing the formation of primordium on the surface of a plastic bag material after 10-15 days; after the primordia are formed, continuously keeping the same humidity, reducing the stimulation of temperature difference between day and night, keeping the temperature at 25-26 ℃, simultaneously strengthening scattered light irradiation and ventilation and air exchange management, and gradually growing the primordia into sporocarp; and when the fungus sticks are soft, harvesting the sporocarp.
The PDA culture medium in the step (1) comprises the following components: 200g/L peeled potato, 20g/L glucose, 2.5g/L peptone, 3g/L potassium dihydrogen phosphate, 1.5g/L anhydrous magnesium sulfate, 20g/L agar powder and 1L water. The sterilization conditions of the PDA culture medium are as follows: sterilizing at 121 deg.C for 20 min.
The PDA culture medium formula in the step (2) is as follows: 200g/L peeled potatoes, 20g/L glucose, 20g/L agar powder and 1L, pH 5-6 water. The corn flour culture medium comprises the following components in parts by weight: 20g/L of corn flour, 20g/L of glucose, 2.5g/L of peptone, 3g/L of monopotassium phosphate, 1.5g/L of anhydrous magnesium sulfate, 20g/L of agar powder and 1L, pH 5-6 of water. The sterilization conditions of the PDA culture medium and the corn flour culture medium are as follows: sterilizing at 121 deg.C for 20 min.
The millet granule culture medium in the step (3) comprises the following components: the content of the small rice grains is 96-98%, the content of glucose is 1-2%, the content of gypsum is 1-2%, and the water content is 60-65%. The sterilization conditions of the millet granule culture medium are as follows: the autoclave is sterilized at 121 ℃ for 1.5 to 2 hours.
The formulation of the corncob culture medium in the step (4) is as follows: 78% of corncobs, 20% of bran, 1% of gypsum, 1% of sugar, 60-65% of water content and natural pH. The specification of the fungus bag is 14cm multiplied by 28cm multiplied by 0.05 cm, and the loading amount of the culture material is 300-400 g per bag (wet weight). The sterilization conditions of the corncob culture medium are as follows: the autoclave is sterilized for 2 hours at 121 ℃.
The invention has the following beneficial effects:
(1) the pure culture mycelium of the fleshy black spore fungus is not reported, can be used for domestication and cultivation of the fleshy black spore fungus as a strain, not only provides a new variety for the edible fungus industry, but also has important significance for protecting the diversity of the wild mushroom fungus.
(2) The related pure culture mycelium of the fleshy black spore polypore can grow in various culture mediums in the strain propagation culture and fruiting test, which shows that the obtained mycelium has stronger adaptability, and the culture mediums can be adopted for alternate use to avoid the strain aging and degeneration; the mycelium is a high-temperature strain, is suitable for artificial cultivation in summer, autumn and high-temperature seasons, and provides a new high-temperature edible and medicinal fungus variety and a cultivation method for the edible fungus industry.
Drawings
FIG. 1: the ITS sequence alignment of mycelium was isolated.
FIG. 2 is a drawing: growth conditions of the fleshy black spore fungus mycelia on different propagation plate culture media.
FIG. 3: the growth conditions of the mycelium of the Botrytis cinerea on different culture mediums.
FIG. 4 is a drawing: the growth conditions of the mycelium of the fleshy black spore fungus on different culture materials.
FIG. 5: the influence of different culture temperatures on the growth rate of the mycelium of the fleshy black spore fungus.
FIG. 6: fruiting body formed after fruiting of the mycelium of the fleshy black spore fungus.
FIG. 7: and (3) performing a PCR amplification procedure.
Detailed Description
The following examples serve to illustrate the invention.
Example 1 isolation culture and characterization of a pure culture of fleshy Polyporus frondosus mycelia
And carrying out tissue separation on the collected wild fleshy fruit body of the black sporocarp. The tissue separation bacterium block has a size of 2 × 2 × 2mm cube, the tissue block part is the middle part of a pileus of a fruiting body, the bacterium meat at the position is thick, and the bacterium meat is easy to survive after separation; and (3) inoculating the separated tissue blocks on a PDA test tube slant culture medium, culturing in an incubator at 20-25 ℃ in a dark place, obtaining a test tube full of mycelia after 10-15 days, and storing in a refrigerator at 4 ℃ for later use.
And respectively identifying the obtained mycelium and the source sporocarp by adopting an ITS method. Preparing DNA by using a fungus DNA extraction kit and detecting the concentration. And establishing a PCR amplification system according to the DNA content. The amplification products were collected, sequenced, and BLAST-aligned analysis of ITS sequencing results with the NCBI database (see sequence diagram). The specific implementation steps are as follows:
(1) freeze drying collected mycelium or fruiting body with liquid nitrogen, and grinding into powder.
(2) 0.1g of sample was weighed and prepared by DNA extraction according to the protocol of the fungal DNA extraction kit.
(3) And (4) carrying out concentration detection on the prepared DNA sample.
(4) The prepared mycelium or fruiting body DNA is used as a template, and ITS universal primers ITS1/ITS4 are used as amplification primers to establish a PCR reaction system.
The ITS primers are as follows:
ITS1：5’—TCCGTAGGTGAACCTGCGG—3’
ITS4：5’—TCCTCCGCTTATTGATATGC—3’
the PCR amplification reaction system comprises the following components:
the PCR amplification procedure is shown in FIG. 7. And (3) carrying out agarose gel electrophoresis detection on the PCR amplification product, and sending the cut band to a sequencing company for sequencing.
(5) The sequencing results were BLAST-aligned in the NCBI database, and the results were that the samples were compared with Fusarium carnosum (Amylosporus succinutenus) Identites 1317/1317 (99.59%) and the homology number was NR 153527.1. Accordingly, it was confirmed that the pure cultured mycelia and the source fruiting body isolated in example 1 were all the Polyporus umbilicalis (Amylosporus succinutes) according to the present invention.
The PDA culture medium comprises the following components in percentage by weight: 200g/L peeled potato, 20g/L glucose, 2.5g/L peptone, 3g/L potassium dihydrogen phosphate, 1.5g/L anhydrous magnesium sulfate, 20g/L agar powder and 1L water. The sterilization conditions of the PDA culture medium are as follows: sterilizing at 121 deg.C for 20 min.
The ITS sequencing, alignment and analysis results are shown in figure 1, and the ITS sequence alignment chart of the separated mycelium is shown.
Example 2 screening of culture Medium for subculture propagation of pure cultured mycelia of Botrytis cinerea
Selecting mycelium blocks with the square size of 2 multiplied by 2mm from a slant culture medium of a preservation test tube, inoculating the mycelium blocks on a PDA culture medium plate, taking the mycelium blocks by using a circular hole puncher with the diameter of 0.7cm after 15-20 days, respectively inoculating the mycelium blocks on 11 plates with different culture medium formulas, and screening a culture medium suitable for the subculture propagation of the mycelia of the fleshy black spore polyporus according to the growth vigor, the edge uniformity, the white degree, the mycelium concentration and the like of the mycelia. And (3) repeating each culture medium for 5 times, and culturing in an incubator at 25 ℃ in a dark place for 15-20 days.
The screening result shows that the mycelium of the fleshy black spore fungus can normally grow on the 11 culture mediums, but the growth speed, the thickening degree and the whiteness degree of the mycelium on the corn flour culture medium are all superior to those of the other 10 culture mediums. Therefore, the formula E corn flour culture medium is determined to be the optimal culture medium for subculture propagation, and the results are shown in table 1 and figure 2.
The 11 culture medium formulas in this example are:
a: PDA + wood chip cooking juice culture medium: 100g of wood chips (boiled juice), 200g of potatoes (peeled, sliced and boiled juice), 20g of glucose, 3g of monopotassium phosphate, 3g of peptone, 1.5g of anhydrous magnesium sulfate, 20g of agar and 1L of water.
B: soybean cake powder culture medium: 20g of soybean cake powder, 20g of glucose, 3g of monopotassium phosphate, 3g of peptone, 1.5g of anhydrous magnesium sulfate, 20g of agar and 1L of water.
C: potato sucrose culture medium: 200g of potatoes (peeled, sliced and boiled juice), 20g of cane sugar, 6g of yeast powder, 3g of potassium dihydrogen phosphate, 1.5g of anhydrous magnesium sulfate, 20g of agar and 1L of water.
D: CPDA medium: 200g of potatoes (peeled, sliced and boiled juice), 20g of glucose, 3g of monopotassium phosphate, 3g of peptone, 1.5g of anhydrous magnesium sulfate, 20g of agar and 1L of water.
E: corn flour culture medium: 20g of corn flour, 20g of glucose, 3g of monopotassium phosphate, 3g of peptone, 1.5g of anhydrous magnesium sulfate, 20g of agar and 1L of water.
F: cow dung cooking juice culture medium: 100g of cow dung (taking cooking juice), 200g of potatoes, 3g of monopotassium phosphate, 3g of peptone, 1.5g of anhydrous magnesium sulfate, 20g of agar and 1L of water.
G: wheat grain cooking juice culture medium: 200g of wheat grains (boiled juice), 3g of monopotassium phosphate, 3g of peptone, 1.5g of anhydrous magnesium sulfate, 20g of agar and 1L of water.
H: fermentation material decoction culture medium: 100g of fermentation material (taking cooking juice), 200g of potato (peeling, slicing and cooking juice), 3g of monopotassium phosphate, 3g of peptone, 1.5g of anhydrous magnesium sulfate, 20g of agar and 1L of water.
I: PDA + bran cooking broth culture medium: 100g of bran (taking cooking juice), 200g of potatoes (peeling, slicing and cooking juice), 20g of glucose, 3g of monopotassium phosphate, 3g of peptone, 1.5g of anhydrous magnesium sulfate, 20g of agar and 1L of water.
J: PDA culture medium: 200g of potatoes (peeled, sliced and boiled juice), 20g of glucose, 20g of agar and 1L of water. K: orthogonal formulation: 17.3g of sucrose, 1.8g of yeast extract powder, 3g of monopotassium phosphate, 1.5g of magnesium sulfate, 20g of agar and 1L of water.
The sterilization conditions of the 11 culture media are as follows: sterilizing at 121 deg.C for 20 min.
The specification of the plate culture medium is a disposable plastic culture plate with the diameter of 9 cm.
Example 3 Polyporus fomentarius mycelium grain Medium screening
Taking a bacterium block from a corn flour culture medium flat plate full of hyphae by using a circular puncher with the diameter of 1.2cm, and selecting 3-5 blocks to be respectively inoculated in 5 different culture media. And determining a propagation culture medium of the mycelium strains of the Botrytis cinerea according to the growth speed and the growth vigor of the mycelium. The culture conditions are 20-25 ℃ and dark culture. After 25-30 days, the mycelium of the Botrytis cinerea can normally grow on 4 grain culture media (except for buckwheat culture media), but the mycelium grows best on the grain culture media. The most suitable culture medium for the original strain or cultivated strain of the fleshy black spore fungus is determined to be the millet granule culture medium. The results are shown in Table 2 and FIG. 3.
The 5 culture medium formulas in the present example are respectively:
a: sorghum culture medium: sorghum 98%, gypsum 2% and water content 60%
B: corn kernel culture medium: corncob 98%, gypsum 2% and water content 60%
C: buckwheat culture medium: buckwheat 98%, gypsum 2% and water content 60%
D: wheat grain culture medium: 98% of wheat grain, 2% of gypsum and 60% of water content
E: millet granule culture medium: 98% of millet, 2% of gypsum and 60% of water content
The sterilization conditions of the 5 culture media are as follows: the autoclave is sterilized at 121 ℃ for 1.5 to 2 hours.
The above screening was carried out using a glass tube having a 3cm × 20 cm-sized culture medium container and a single opening.
The strain bottle used for strain preparation after screening is a 800ml plastic bottle.
Example 4 fleshy Polyporus frondosus mycelium culture material formula screening
Respectively inoculating the prepared grain culture medium strains to the cultivation materials with different formulas in equal amount, and determining the cultivation material formula of the fleshy black spore polypore mycelium according to the material eating speed and the growth vigor of the mycelium. Preparing 6 kinds of cultivation materials according to different formulas, piling for 2 hours after the preparation is finished so as to fully absorb water, then subpackaging in polypropylene plastic bags with the size of 140 multiplied by 280 multiplied by 0.05mm, putting 300 g-400 g of the stirred cultivation materials in each bag, sterilizing for 2 hours at the temperature of 121 ℃ in a high-pressure steam sterilization pot, and inoculating after cooling. And inoculating 30 bags of each formula respectively, and culturing in a spawn running room at 20-25 ℃ in a dark place. And checking whether the bacteria are infected or not in time. When the hyphae overgrow the opening of the fungus bag and start to extend downwards, measuring the feeding speed of the hyphae by adopting a scribing method every 2d, and observing and recording the color and luster of the hyphae, the existence or nonexistence of pigment, the density of the hyphae, the regularity of the hyphae and the like. The result shows that the most suitable cultivation material formula of the fleshy black spore fungus mycelium is as follows: no. 3 corncob culture material formula. The results are shown in Table 3 and FIG. 4.
The 6 cultivation materials described in this embodiment respectively have the following formulas:
formula 1: 78% of wood dust, 20% of bran, 1% of gypsum, 1% of sugar, 55-60% of water content and natural pH.
The formula 2 comprises 78% of cottonseed hulls, 20% of bran, 1% of gypsum, 1% of sugar, 60-65% of water content and natural pH.
The formula 3 comprises 78% of corncobs, 20% of bran, 1% of gypsum, 1% of sugar, 60-65% of water content and natural pH.
And (4) formula: 39% of wood dust, 39% of cottonseed hulls, 20% of bran, 1% of gypsum, 1% of sugar, 55-60% of water content and natural pH.
And (5) formula: 39% of wood chips, 39% of corncobs, 20% of bran, 1% of gypsum, 1% of sugar, 55-60% of water content and natural pH.
And (6) formula: 39% of corncobs, 39% of cottonseed hulls, 20% of bran, 1% of gypsum, 1% of sugar, 55-60% of water content and natural pH.
EXAMPLE 5 screening of mycelial Medium of Botrytis cinerea for appropriate growth temperature
The data records that the fleshy black spore fungus is mostly wild in tropical regions and is a temperature-preference type edible fungus. Wood chips and a cottonseed hull culture medium (formula 4) are adopted, different temperature gradients are set, and the proper growth temperature of the mycelia is determined according to the feeding speed and the growth vigor of the mycelia. Screening is carried out by adopting single-opening large test tubes, and 60g of sawdust and cottonseed hull culture materials are filled into each test tube. During inoculation, a circular puncher with the diameter of 0.7cm is used for picking up the bacteria blocks, and 3-5 blocks are picked up each timeInoculating on the culture material of a large test tube. The incubation temperature range was set at 19-31 ℃ with one temperature gradient every 3 ℃ with 5 replicates of each temperature gradient. Recording the growth speed, growth vigor and the like of hyphae at different culture temperatures. The result shows that the mycelial growth speed of the fleshy black spore fungus mycelium is slower at lower culture temperature, and the mycelial growth speed is accelerated along with the gradual rise of the temperature; at 28 deg.C, the growth rate of hyphae is 8.43 + -0.09 mm. d-1. Accordingly, the optimal growth temperature of the mycelium of the fleshy black spore fungus is determined to be 28 ℃, the optimal growth temperature range of the mycelium is determined to be 28-31 ℃, and the mycelium belongs to a high-temperature variety, and the result is shown in the attached figure 5.
The formula of the wood chip and cottonseed hull culture medium is as follows: 39% of wood dust, 39% of cottonseed hulls, 20% of bran, 1% of gypsum, 1% of sugar, 55-60% of water content and natural pH.
The sterilization conditions of the culture medium are as follows: the autoclave is sterilized for 2 hours at 121 ℃.
Example 6 acclimatization and cultivation of fleshy Phellinus Linteus mycelia
Under aseptic condition, the millet cultivated species are uniformly spread on the surface of a plastic bag filled with sterilized corncob culture material, and the inoculation amount is 10-15% of the weight of the culture material. And (4) after inoculation, tying the fungus bags, performing light-resistant culture in a fungus growing room at the temperature of 20-25 ℃, and obtaining the cultivation fungus bags full of mycelia after 20-25 days.
Transferring the cultivation fungus bags into a mushroom shed, opening the bag opening, increasing the relative humidity of air in the mushroom shed to 85-90% through ground watering and space spraying, increasing ventilation and air exchange, increasing scattered light, increasing the day and night temperature difference stimulation, keeping the temperature of the mushroom shed at 25-33 ℃, and seeing the formation of primordium on the surface of a plastic bag material after 10-15 days; after the primordia are formed, continuously keeping the same humidity, reducing the stimulation of temperature difference between day and night, keeping the temperature at 25-26 ℃, simultaneously strengthening scattered light irradiation and ventilation and air exchange management, and gradually growing the primordia into sporocarp; and when the fungus sticks are soft, harvesting the sporocarp. Fruiting body formed by fruiting is shown in figure 6. The mushroom growing shed is a plastic greenhouse.
TABLE 1 growth of fleshy Polyporus frondosus mycelia on 11 propagation media
Note: "+ + + +", "+" indicate that hyphae grow fast, fast and slow, respectively; the hyphae are dense, dense and sparse; capital letters indicate very different significance at the 0.01 level (P <0.01), lower case letters indicate different significance at the 0.05 level (P <0.05), the following.
TABLE 2 growth of fleshy Polyporus frondosus mycelia on different grain media
TABLE 3 growth of the fleshy Polyporus frondosus mycelia on different cultures
Claims (6)
1. The application of the pure culture mycelium of the fleshy black spore polypore is characterized in that the application of the pure culture mycelium of the fleshy black spore polypore in artificial domestication cultivation comprises the following steps: the strain is used for artificially domesticating and cultivating the fleshy black spore fungus and is propagated; the propagation strain is used for manufacturing the culture strain of the meat quality black spore fungus through artificial domestication and cultivation; the cultured strain is used in the artificial domestication and cultivation process of the fleshy black spore fungus and fruiting bodies are obtained;
the method for artificially domesticating and cultivating the strain of the fleshy black spore fungus and performing propagation comprises the following steps:
selecting a succulent black spore pore fungus mycelium block with the specification of 2 multiplied by 2mm from a preservation test tube slant culture medium, inoculating the mycelium block on a PDA culture medium plate, culturing for 15-20d at 20-25 ℃, punching a bacterial sheet along the edge of a mycelium colony by using a circular puncher with the diameter of 0.7cm, inoculating the circular bacterial sheet on a corn flour culture medium plate, subculturing and propagating, and obtaining a plate propagation strain full of mycelia after 15-20d at 20-25 ℃ and under a dark culture condition;
the strain of the fleshy black spore fungus is preserved in the common microorganism center of China Committee for culture Collection of microorganisms with the preservation number as follows: CGMCC No. 18584.
2. The application of the pure cultured mycelium of the fleshy black spore fungus as claimed in claim 1, wherein the propagation expanding strain is used for preparing the culture strain of the artificially domesticated and cultured fleshy black spore fungus, and the method comprises the following steps:
selecting 3-5 mycelium blocks with the diameter of 1.5-2 cm from the mycelium overgrowth propagation strain plate, inoculating the mycelium blocks into a sterilized millet culture medium, culturing in a dark place at the temperature of 28-31 ℃, and obtaining the mycelium overgrowth culture strain after 30-40 days.
3. The application of the pure cultured mycelium of the Botrytis cinerea as claimed in claim 1, wherein the cultured strain is used in the artificial domestication and cultivation process of the Botrytis cinerea and fruiting bodies are obtained by the following steps:
(1) seeding and spawn running culture
Under aseptic conditions, uniformly scattering millet cultivars on the surface of a plastic bag filled with sterilized corncob compost, wherein the inoculation amount is 10-15% of the weight of the compost, tying the fungus bag after inoculation, performing light-tight culture in a fungus growing room at 20-25 ℃, and obtaining a cultivation fungus bag full of mycelia after 20-25 days;
(2) fruiting culture
After the cultivation fungus bags are transferred into a mushroom shed, opening the bag opening, increasing the relative humidity of air in the mushroom shed to 85% -90% through ground watering and space spraying, increasing ventilation and air exchange, increasing scattered light, increasing the stimulation of day and night temperature difference, keeping the temperature of the mushroom shed at 25-33 ℃, and seeing the formation of primordium on the surface of plastic bag material after 10-15 days; after the primordia are formed, continuously keeping the same humidity, reducing the stimulation of temperature difference between day and night, keeping the temperature at 25-26 ℃, simultaneously strengthening scattered illumination and ventilation and air exchange management, and gradually growing the primordia into sporocarp; when the fungus sticks are soft, harvesting the fruit bodies.
4. The application of the pure cultured mycelium of Botrytis cinerea according to claim 1, wherein the corn flour culture formula comprises: 20g/L of corn flour, 20g/L of glucose, 2.5g/L of peptone, 3g/L of monopotassium phosphate, 1.5g/L of anhydrous magnesium sulfate, 20g/L of agar powder and 1L, pH 5-6 of water.
5. The application of the pure cultured mycelium of Botrytis cinerea according to claim 2, wherein the formulation of the medium of the millet granules comprises: 96-98% of rice grains, 1-2% of glucose, 1-2% of gypsum and 60-65% of water content.
6. The application of the pure cultured mycelium of the succulent black spore fungus as claimed in claim 3, wherein the formula of the corncob culture material is as follows: 78% of corncobs, 20% of bran, 1% of gypsum, 1% of sugar, 60-65% of water content and natural pH.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010551792.7A CN111758496B (en) | 2020-06-17 | 2020-06-17 | Pure culture mycelium of fleshy black spore fungus and application of pure culture mycelium in artificial domestication and cultivation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010551792.7A CN111758496B (en) | 2020-06-17 | 2020-06-17 | Pure culture mycelium of fleshy black spore fungus and application of pure culture mycelium in artificial domestication and cultivation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111758496A CN111758496A (en) | 2020-10-13 |
| CN111758496B true CN111758496B (en) | 2022-01-14 |
Family
ID=72720906
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010551792.7A Active CN111758496B (en) | 2020-06-17 | 2020-06-17 | Pure culture mycelium of fleshy black spore fungus and application of pure culture mycelium in artificial domestication and cultivation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111758496B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101817704A (en) * | 2010-04-28 | 2010-09-01 | 北京市农林科学院 | Cultivation material of edible fungi |
| CN101822171A (en) * | 2010-05-24 | 2010-09-08 | 云南省农业科学院 | Artificially cultured black termitornyces albuminosus berk heim entity and culture method thereof |
| CN110447467A (en) * | 2019-07-23 | 2019-11-15 | 河北师范大学 | A kind of fragrance cup umbrella pure culture body strain and its cultural method |
| EP3593631A1 (en) * | 2018-07-12 | 2020-01-15 | Bromyc B.V. | Production process and composition of casing material for growing mushrooms |
-
2020
- 2020-06-17 CN CN202010551792.7A patent/CN111758496B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101817704A (en) * | 2010-04-28 | 2010-09-01 | 北京市农林科学院 | Cultivation material of edible fungi |
| CN101822171A (en) * | 2010-05-24 | 2010-09-08 | 云南省农业科学院 | Artificially cultured black termitornyces albuminosus berk heim entity and culture method thereof |
| EP3593631A1 (en) * | 2018-07-12 | 2020-01-15 | Bromyc B.V. | Production process and composition of casing material for growing mushrooms |
| CN110447467A (en) * | 2019-07-23 | 2019-11-15 | 河北师范大学 | A kind of fragrance cup umbrella pure culture body strain and its cultural method |
Non-Patent Citations (5)
| Title |
|---|
| Basidiomycota) Evidenced by Morphological Characters and Phylogenetic Analysis.《Cryptogamie * |
| Jia-Jia Chen 等.Amylosporus succulentus sp. nov. (Russulales * |
| Mycologie》.2014,(第3期),第271-282页. * |
| 大型真菌ITS鉴定及8种野生蕈菌的驯化研究;刘红霞;《中国优秀硕士学位论文全文数据库 基础科学辑》;20140915(第9期);第26-30页 * |
| 纹盖黑孢孔菌—一种新食用菌的驯化及营养成分分析研究;黄福常;《基因组学与应用生物学》;20191225;第38卷(第12期);第5483-5494页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111758496A (en) | 2020-10-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220033762A1 (en) | Penicillium oxalicum SDF-25 strain and application thereof | |
| CN109906877B (en) | Lentinula edodes new strain and domestication cultivation method and application thereof | |
| CN110447467B (en) | Pure culture mycelium strain of aromatic clitocybe maxima and culture method thereof | |
| CN109280632A (en) | A kind of method of liquid state fermentation production selenium-rich pleurotus eryngii quel strains | |
| CN110713956B (en) | Lysine bacillus S12 and application thereof | |
| CN111758496B (en) | Pure culture mycelium of fleshy black spore fungus and application of pure culture mycelium in artificial domestication and cultivation | |
| US5349121A (en) | Biologically pure mushroom culture and method for mushroom cultivation | |
| CN108728368B (en) | Pure white black fungus strain and application thereof | |
| CN102986536A (en) | Flammulina velutipes strain and preparation method | |
| CN110305819A (en) | One plant of feather efficient degrading bacterial strain and its application | |
| CN115074259A (en) | Alkali-resistant Lentinus edodes strain Jinxiang 194 and application thereof | |
| CN111727809B (en) | Lentinus edodes strain and cultivation method and application thereof | |
| CN111727808B (en) | Lentinus edodes strain and cultivation method and application thereof | |
| CN115088557A (en) | Agaricus blazei murill strain ZJJJSR 001 and cultivation method thereof | |
| CN106434381A (en) | Pure white hypsizigus marmoreus strain, and molecular marker, specific primer pair and application thereof | |
| CN109566271B (en) | Culture medium for culturing wild ruffle crimp strain mother strain | |
| CN112136966A (en) | Preparation method of aquatic product fully-matured fermented feed | |
| CN111411046A (en) | Dark color endophytic fungus agent and application thereof | |
| CN110923156A (en) | Yeast Y5 for resisting aquatic pathogenic bacteria and producing lipase, separation method and application thereof, feed additive and preparation method thereof | |
| CN117305135B (en) | Trichoderma pseudokoningii T0027 and application thereof in preventing and treating soft rot of kiwi fruits | |
| CN114540198B (en) | High-temperature fruiting type Lentinula edodes JAUCC3146 and cultivation method thereof | |
| CN116286548B (en) | Novel microbacterium strain for degrading fibers and application thereof | |
| CN117568198B (en) | Jerusalem artichoke straw fermentation product of chrysobacterium, chrysobacterium and trichoderma and application of jerusalem artichoke straw fermentation product in promoting plant growth | |
| CN111394259B (en) | Preparation method of DSE dry microbial inoculum capable of promoting plant growth and easy to store and transport | |
| TWI496885B (en) | A new species of Pleurotus sp. And its breeding methods |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |